A NEW APPROACH TO HOLISTIC NITROGEN MANAGEMENT IN CHINA

Highlights

● Progress on nitrogen management in agriculture is overviewed in China.

● 4R principles are key to high N use efficiency and low N losses in soil-crop systems.

● A new framework of food-chain-N-management is proposed.

● China’s success in N management provides models for other countries.

Abstract

Since the 1980s, the widespread use of N fertilizer has not only resulted in a strong increase in agricultural productivity but also caused a number of environmental problems, induced by excess reactive N emissions. A range of approaches to improve N management for increased agricultural production together with reduced environmental impacts has been proposed. The 4R principles (right product, right amount, right time and right place) for N fertilizer application have been essential for improving crop productivity and N use efficiency while reducing N losses. For example, site-specific N management (as part of 4R practice) reduced N fertilizer use by 32% and increased yield by 5% in China. However, it has not been enough to overcome the challenge of producing more food with reduced impact on the environment and health. This paper proposes a new framework of food-chain-nitrogen-management (FCNM). This involves good N management including the recycling of organic manures, optimized crop and animal production and improved human diets, with the aim of maximizing resource use efficiency and minimizing environmental emissions. FCNM could meet future challenges for food demand, resource sustainability and environmental safety, key issues for green agricultural transformation in China and other countries.

Graphical abstract

Keywords

4R technology / food chain N management / N use efficiency / soil-crop system / sustainable management

1 INTRODUCTION

Environmental changes such as fluctuations in temperature and light, mechanical damage, drought, salinity, insect herbivory and pathogens, directly impact plant growth. Unlike animals, plants cannot escape. Plants must endure these changes and make appropriate acclimation or defense responses in a fixed location to survive. Signal transduction events generally occur during the early growth of plants and in response to abiotic or biotic environment interactions. Previous studies show a range of signals in plants including reactive oxygen species signals, ${\mathrm{Ca}}^{\mathrm{2+}}$ fluxes, and electrical signals, all of which have essential functions in plant responses to abiotic and biotic stresses^[1–7].

The existence of electrical signals in plants was first demonstrated by Burden-Sanderson^[8] and Charles Darwin^[9]. Since then, electrical signals have generally been reported in plants in response to various environmental changes and have been shown to have biological function. For example, electrical signals are induced by mechanical and flame-induced damage and are involved in activating protease inhibitor genes in tomato^[10]. Mousavi et al. reported that electrical signals could be detected after insect herbivory, cold water stimuli and mechanical wounding of Arabidopsis and after exogenous electric shock, activating jasmonic acid (JA) signaling^[6]. During the process of systemic acquired resistance, electrical signals are integrated together with reactive oxygen species and ${\mathrm{Ca}}^{\mathrm{2+}}$ flux to participate in the rapid propagation of systemic signals^[3]. Rapid electrical signals generated in response to local heat stimuli regulate systemic changes in nonphotochemical quenching and photosystem II quantum efficiency in Arabidopsis and dandelion^[11]. In addition, previous work shows that electrical signals are generated in response to nematode attack in tomato roots, after which the signals are then propagated to the shoots to activate JA accumulation^[12].

Recent work has linked glutamate receptor-like (GLR) genes to electrical signal transduction and JA signaling in Arabidopsis in which GLR3.3 and GLR3.6 were shown to mediate leaf-to-leaf wound signaling^[6]. GLR proteins belong to a family of cation-permeable ion channels that function in various plant processes ranging from growth and development to stress response and defense. GLR genes facilitate ${\mathrm{Ca}}^{\mathrm{2+}}$ influx across the plasma membrane to modulate the apical [${\mathrm{Ca}}^{\mathrm{2+}}$]_cyt gradient and consequently affect pollen tube growth and morphogenesis^[13]. In addition, GLR genes regulate lateral root initiation and root development^[14,15], and GLR genes have been reported to participate in both the salt stress response in Arabidopsis and cold tolerance in Arabidopsis and tomato^[16–19]. In terms of biotic stress responses, GLR genes are dominant in defense against pathogens and herbivores. AtGLR3.3 is a key component of resistance against Hyaloperonospora arabidopsidis, Pseudomonas syringae pv. tomato DC3000 and the herbivore Spodoptera littoralis^[20–22]. Also, earlier studies have characterized the role of GLR3.5 in the long-distance transduction of electrical signals elicited by nematodes, leading to nematode resistance^[12]. The functions of GLR genes have mostly been studied in the model plant species Arabidopsis but the possible functions of GLR genes in crop plant species remain largely unknown.

Tomato (Solanum lycopersicum) is an important crop species worldwide and has been used as a model species to study interactions between plants and herbivores. Here, the characteristics of electrical signals induced by herbivory and mechanical wounds in tomato were investigated. In addition, glr3.3 and glr3.5 mutants and the glr3.3/3.5 double mutant were used to examine the functions of GLR genes in electrical signal transduction and JA signaling.

2 MATERIALS AND METHODS

2.1 Plant materials and growth conditions

Tomato (S. lycopersicum cv. Ailsa Craig) was used in all experiments. The target sequence (TGAGTAGGAATGGCACTTCA) for GLR3.3 was designed using the web tool CRISPR-P^[23]. A GLR3.3 CRISPR/Cas9 vector was constructed as described by Pan et al.^[24] and then transformed into Agrobacterium tumefaciens strain EHA105. The transformed A. tumefaciens was then introduced into tomato Ailsa Craig (AC) and glr3.5 mutants for the generation of glr3.3 mutants and glr3.3/3.5 double mutants, respectively^[25]. Mutations induced by CRISPR/Cas9 were genotyped by DNA sequencing and homozygous lines in the F₂ generation were selected and used. Seedlings were cultivated in a plant nursery and treated with Hoagland’s nutrient solution. Plants were grown under a 12:12 h L:D photoperiod at 25 and 20°C with a photosynthetic photon flux density of 400 µmol·m⁻²·s⁻¹.

2.2 Plant treatments

Tomato seedlings with three fully expanded leaves were used. Cotton bollworm (Helicoverpa armigera) larvae were obtained from Jiyuan Baiyun Industry Co., Ltd. (Jiyuan, Henan, China). H. armigera larvae at the fourth-instar stage were starved for 1 d and then used for herbivory treatments. Mechanical wounding was conducted by crushing one-third of the terminal leaflet of the second true compound leaf with plastic hemostatic forceps. Herbivory was simulated by crushing both sides of the leaflets of plants with plastic hemostatic forceps followed by the immediate application of 10 μL of 20% oral secretions (OS) from H. armigera at each wound side (W+ OS). In herbivory trials, uniform H. armigera third-instar larvae (~ 5 mg) reared on an artificial diet were starved for 1 d. After starvation three larvae were placed on one tomato plant at the six-leaf stage, and there were eight plants of each treatment. After the larvae fed on the plants for 3 d the larval masses were determined.

2.3 Electrical signal recording

Electrical signals were detected as previously reported^[6,12] with minor modifications. Briefly, silver electrodes (0.5 mm in diameter, World Precision Instruments, Sarasota, FL) were connected to a drop (10 μL) of 10 mmol·L⁻¹ KCl in 0.5% (w/v) agar placed on the tomato leaf or petiole, and the ground electrode was placed in the soil. Two dual-channel amplifiers (FD 223 and Duo 773, World Precision Instruments) were used to detect the signals. The amplitude was the potential difference relative to the baseline before the changes, ‘n’ was the total number of plants detected, and ‘x’ was the number of plants in which changes in potential were detected. Each experiment comprised at least five separate plants.

2.4 qRT-PCR analysis

Total RNA was extracted from leaf tissues using an RNA Prep Pure Plant Kit (Tiangen, Beijing, China) and then reverse transcribed to cDNA using a ReverTra Ace qPCR RT Kit (Vazyme Biotech Co., Ltd., Nanjing, China) according to the manufacturer’s instructions. The qRT-PCR experiments were conducted on a Light Cycler 480 II Real-Time PCR detection system (Roche, Mannheim, Germany). Each 20 μL reaction system consisted of 10 μL of SYBR Green PCR Master Mix (AceQ qPCR SYBR Green Master Mix Kit, Vazyme Biotech Co., Ltd., Nanjing, China), 1 μL of cDNA, and forward and reverse primers (0.1 μmol·L⁻¹ each), according to the manufacturer’s instructions. The housekeeping genes ACTIN2 and UBI3 were used as internal references to calculate the relative expression of target genes^[26]. The sequences of the primer pairs are listed in supplemental materials (Table S1).

2.5 Determination of jasmonic acid, jasmonoyl-isoleucine, salicylic acid and indole-3-acetic acid concentrations

The concentrations of the phytohormones indole-3-acetic acid (IAA), JA, salicylic acid (SA) and jasmonoyl-isoleucine (JA-Ile) were determined by HPLC-MS/MS (Agilent 6460; Agilent Technologies, Santa Clara, CA) with D5-IAA, D5-JA, D4-SA (OlChemlm, Olomouc, Czechia) and D6-JA-Ile (Quality Control Chemicals, Newark, DE) used as internal standards, as described previously^[27].

2.6 Statistical analysis

At least three independent biological replicates were included in each experiment. The data were statistically analyzed by analysis of variance using SAS software (version 8, SAS Institute, Cary, NC). The significance of treatment differences was determined using Student’s t-test or Tukey’s test as indicated in the Figure legends.

3 RESULTS

3.1 Herbivory activated electrical signals in tomato leaves

Three electrodes were placed, one on the terminal leaflet at the midrib (P1), one on the petiole of the second true compound foliage (P2) and the third on the petiole of the first leaf (P3) to investigate whether insect chewing is associated with the induction of electrical signals in tomato. After 1 d of starvation, cotton bollworm (H. armigera) larvae at the fourth-instar stage were placed on the second leaf at a position 1 cm away from P1 (Fig.1(a)). No electrical activity was induced at P1, P2 or P3 but the larvae were crawling or resting on the leaves. However, larval herbivory on the lamina elicited significant changes in the surface potential, with a reduction in amplitude of about −20 mV at P1. In contrast, no change was observed at P2 or P3 (Fig.1(b)). However, H. armigera larvae feeding on the base of the petiole elicited a surface potential with an amplitude of about −40 mV and both the frequency and duration were greater in response to feeding on the base of the petiole than on the lamina (Fig.1(c,d)).

Fig.1 Insect herbivory induced changes in the surface potential of tomato leaves. (a) Experimental design for measuring electrical signals elicited by herbivory on a leaf. Measuring electrodes: P1, midrib; P2, petiole; P3, petiole of the first leaf. Helicoverpa armigera larvae were allowed to feed at a position about 1 cm from electrode P1. (b) Electrical signals measured at electrodes P1, P2 and P3 of (a). (c) Experimental design for measuring electrical signals elicited by herbivory of the petiole. Measuring electrodes: P1, petiole (1 cm from the larval herbivory site); P2, petiole (1 cm from P2); P3, midpoint of the midrib of the terminal leaflet. (d) Electrical signals measured at electrodes P1, P2 and P3 of (c). The starting time of larval herbivory is indicated with a filled triangle. For (b) and (d), typical surface potential changes are shown (n = 6).

Full size|PPT slide

3.2 Characteristics of leaf/petiole wound-activated surface potential changes

Insect chewing usually induces mechanical wounding with the release of chemical elicitors. The effects of mechanical wounding on electrical activity were investigated to gain insight into the characteristics and propagation of the electrical signals. One-third of the terminal leaflet of the second true compound leaf was mechanically wounded by crushing the leaflet with plastic forceps. Electrical signals were measured at 1 and 3 cm from the wounding position, respectively (P1 and P2) and the junction of the terminal leaflet and petiole (P3) (Fig.2(a)). After wounding, changes in surface potential were soon detected thereafter at P1 in a total of 9 of 12 plants, with an amplitude of −26.3±10.8 mV (Fig.2(b) and Tab.1). In addition, the surface potential varied for several seconds to several minutes and failed to return to normal levels in some leaves. Several seconds later a surface potential with an amplitude of −14.8±7.48 and a frequency of 5 of 12 plants was observed at P2. Wounding elicited a potential amplitude of about −15 mV at P3 in 3 of 12 observations (Fig.2(b) and Tab.1). By determining the delay time between P1 and P2 it was estimated that the rate of electrical signal transduction within the leaflet was 6.91±2.52 cm·min⁻¹ (Tab.1).

Fig.2 Electrical signals caused by leaf wounding and petiole wounding. (a) Experimental design for measuring electrical signals elicited by mechanical wounding of a leaf. Measuring electrodes: P1, midrib 1 cm from the wounding position; P2, midrib 2 cm from electrode P1; P3, junction of the terminal leaflet and petiole. Dashed line, position of the mechanical wounding of one-third of the terminal leaflet. (b) Electrical signals measured at electrodes P1, P2 and P3 of (a). (c) Experimental design for measuring electrical signals activated by mechanical wounding of the petiole. Measuring electrodes: P1 (petiole 1 cm from the wound position; P2, the junction of the terminal leaflet and petiole; P3, the midpoint of the midrib of the terminal leaflet. Dashed line, position of the mechanical wound of the petiole. (d) Electrical signals measured at electrodes P1, P2 and P3 of (c). For (b) and (d), typical surface potential changes are shown (n = 12).

Full size|PPT slide

We then determined the characteristics of petiole wound-elicited surface potential changes. Petiole wound-elicited surface potential was first detected at P1, which was 1 cm from the wounding site, and these electrical signals were transduced to the junction of the petiole and terminal leaflet (P2) or the midrib of the terminal leaflet (P3, Fig.2(c,d)). The amplitude of the surface potential decreased from −39.3 mV at P1 to −16.4 mV at P2 and to −14.2 mV at P3. Also, the percentage of leaves with detectable changes in surface potential (x/n) decreased from 100% at P1 to 25% at P3. The speed of signal propagation in the petiole from P1 to P2 was estimated to be about 10 cm·min⁻¹, greater than in the leaves (Tab.1).

Tab.1 Amplitude and speed of leaf and petiole wound-elicited electrical signals

Position	P1			P2			P3			Speed (cm·min−1)
	Amplitude (mV)	x/n		Amplitude (mV)	x/n		Amplitude (mV)	x/n
Leaf wound	−26.32±10.76 a	9/12		−14.78±7.48 a	5/12		−14.74±2.53 a	3/12		6.91±2.52
Petiole wound	−39.33±9.31 a	12/12		−16.43±13.10 b	8/12		−14.17±5.22 b	3/12		10.05±4.14

Note: x, the number of plants in which changes in potential were detected; n, the total number of plants tested. The means denoted by the same letter do not significantly differ at P<0.05 according to Tukey's test among P1, P2 and P3.

We then examined whether the electrical signals could propagate between leaflets. To this end, three electrodes (P1, P2 and P3) were placed on the junction of the petiole and leaflet (three leaflets: L1, L2 and L3). The middle of leaflet L1 was wounded (Fig.3(a)). After wounding, changes in the surface potentials were detectable at P1 and P2 but very small changes were detected at P3. Also, wound-induced changes in the surface potential decreased from P1 to P3 (Fig.3(b) and Tab.2). When L2 was wounded, substantial changes in the surface potential were detected at P2 and P3, but few changes were detected at P1 (Fig. S1(a,b)).

3.3 GLR3.3 and GLR3.5 mediated electrical signal transduction within a compound leaf

The role of tomato GLR3.3 and GLR3.5, which are homologs of Arabidopsis GLR3.3 and GLR3.6^[6], in electrical signal transduction was examined by generating glr3.3, glr3.5^[12] and glr3.3/3.5 double mutants via CRISPR/Cas9 technology (Fig. S2). In comparison with untransformed plants, the wound-elicited surface potential at P1 was significantly reduced in the glr3.5 mutants and glr3.3/3.5 double mutants but not in the glr3.3 mutants. The propagation of the electrical signals was also attenuated in all three mutants, with lower amplitude and decreased frequency at P2 and P3. Notably, the transduction of the electrical signal from P1 to P3 was totally abolished in all glr3.3, glr3.5 and glr3.3/3.5 plants (Fig.3 and Tab.2).

Fig.3 GLR mutants present reduced amplitude and transduction of electrical signals. (a) Experimental design for measuring electrical signals within a compound leaf. Measuring electrodes: P1, junction of the petiole and leaflet 1; P2, junction of the petiole and leaflet 2; P3, junction of the petiole and leaflet 3. Dashed line, position of the mechanical wound at the center of leaflet 1. L1, leaflet 1; L2, leaflet 2; L3, leaflet 3. (b) Electrical signals measured at P1, P2 and P3 in untransformed plants. (c) Electrical signals measured at P1, P2 and P3 in glr3.3 mutants. (d) Electrical signals measured at P1, P2 and P3 in glr3.5 mutants. (e) Electrical signals measured at P1, P2 and P3 in glr3.3/3.5 double mutants. For (b–e), typical surface potential changes are shown (n = 10).

Full size|PPT slide

Tab.2 Amplitude of electrical signals in GLR mutants

Position	P1			P2			P3
	Amplitude (mV)	x/n		Amplitude (mV)	x/n		Amplitude (mV)	x/n
WT	−43.21±15.25 a	10/10		−36.94±18.67	5/10		−6.12±1.89	4/10
glr3.3	−38.37±18.13 a	10/10		−20.78±14.60	2/10		/	0/10
glr3.5	−17.10±3.64 b	10/10		/	0/10		/	0/10
glr3.3/3.5	−13.11±6.71 b	10/10		−8.26±2.08	2/10		/	0/10

Note: x, the number of plants in which changes in potential were detected; n, the total number of plants tested. The means denoted by the same letter do not significantly differ at P<0.05 according to Tukey’s test.

3.4 Herbivory-induced JA accumulation and Helicoverpa armigera resistance were reduced in glr3.3/3.5 plants

We next investigated how the transcription of JA biosynthesis- and JA signaling-related genes was altered by wounding. The transcript levels of the JA synthesis-related genes LOXD, AOC and OPR3 and the JA signaling-related gene JAZ10 were determined in L1, L2 and L3 45 min after L1 wounding (Fig.3(a)). Wounding caused 18, 15, 17 and 54 times increases in transcript levels of LOXD, AOC, OPR3, and JAZ10, respectively, in L1 leaves compared with undamaged L1 leaves (control). The transcript levels of LOXD, OPR3 and JAZ10 also increased significantly in L2 and L3 after L1 wounding (Fig.4). Similarly, L2 wounding greatly increased the transcription of these four genes in L2. However, this wounding induced fewer but significant increases in the transcript numbers of these genes in L1 and L3 (Fig. S3). Using UPLC-MS/MS we compared the accumulation of JA, JA-Ile, SA and IAA in the untransformed plants and glr3.3/3.5 mutants in response to herbivory. Herbivory was simulated by crushing both sides of the leaflets followed by the immediate application of OS from H. armigera at the wound sites (W+OS). There were no significant differences in the accumulation of JA, JA-Ile, SA or IAA in the control leaves between the untransformed plants and glr3.3/3.5 plants (Fig.5(a) and Fig. S4). W+ OS induced 20- and 88-times increases in the accumulation of JA and JA-Ile, respectively, in the leaves of the untransformed plants. However, these increases were greatly attenuated in the glr3.3/3.5 mutants (Fig.5(a)). W+OS induced little change in the accumulation of SA but a significant increase in the accumulation of IAA in the leaves. However, no significant differences were found between the glr3.3/3.5 mutants and untransformed plants (Fig. S4). Herbivory trials show that, compared with untransformed plants, glr3.5 single mutant and glr3.3/3.5 double mutant plants were less resistant to H. armigera as indicated by the greater larval mass in response to feeding on the mutant plants (Fig.5(b)).

Fig.4 L1 Wounding induced JA biosynthesis and signaling-related gene expression within compound leaves. (a) Transcript level of LOXD after L1 wounding. (b) Transcript level of AOC after L1 wounding. (c) Transcript level of OPR3 after L1 wounding. (d) Transcript level of JAZ10 after L1 wounding. Samples were collected 45 min after L1 wounding. Three biological samples were used for qRT-PCR determination. ACTIN2 and UBI3 were used as internal references to calculate the relative expression of the target genes, and the gene expression in L1/L2/L3 under control conditions was defined as 1. The data represent the mean±SD (n = 3). L1, leaflet 1; L2, leaflet 2; L3, leaflet 3. Statistically significant differences are indicated with asterisks (*, P<0.05; **, P<0.01) according to Student’s t-test.

Full size|PPT slide

Fig.5 GLR mutants present reduced herbivory-induced JA and JA-Ile accumulation and Helicoverpa armigera resistance. (a) JA and JA-Ile contents in WT plants and glr3.3/3.5 mutants upon W+ OS. Samples were collected 1 h after W+ OS. Three biological samples were used. The data represent the mean±SD (n = 3). The means denoted by the same letter do not significantly differ at P<0.05 according to Tukey’s test. (b) Mean weight increase (upper panel) and representative images of larvae after 3 d of herbivory on glr3.3 and glr3.5 single mutants and on glr3.3/3.5 double mutants (lower panel). The data represent the mean±SD (n = 24). Bar= 1 cm.

Full size|PPT slide

4 DISCUSSION

Electrical signals are universal signals in response to various environmental changes in plants. A previous study in Arabidopsis showed that wounding causes changes in surface potential, with an amplitude close to –70 mV, in local rosette leaves and unwounded systemic leaves. The speed of electrical signal transduction in the lamina is approximately 2.6 cm·min⁻¹ but reaches 9 cm·min⁻¹ along the midrib^[6]. Here, we show that (1) herbivory and mechanical wounding induced electrical signals; (2) the amplitude of herbivory- and mechanical wounding-induced electrical signals was about –20 to –40 mV and the rates of electrical signal transduction in the midrib and petiole were about 7 cm·min⁻¹ and 10 cm·min⁻¹, respectively; (3) electrical signals elicited by petiole wounds were stronger than those caused by leaf wounds, with larger amplitude and greater propagation; and (4) electrical signals were not transduced from leaf to leaf in tomato but could propagate from leaflet to leaflet within a compound leaf. The characteristics of electrical signals shown in this study display some similarities to and differences from those in Arabidopsis. First, the rates of electrical signal transduction were similar to the signal propagation speed in Arabidopsis. Second, the amplitude of electrical signals in tomato was much lower than in Arabidopsis. In addition, electrical signals caused by root knot nematode infection were even weaker with an amplitude of about –5 mV and a duration of about 30 s^[12]. Third, electrical signal transduction from leaf to leaf was not detected in the tomato seedlings. Consistently, Wildon et al. reported that mechanical damage of one cotyledon of tomato seedlings led to the propagation of electrical activity to the petiole of the same leaf and stem and systemic accumulation of protease inhibitor activity at the one-expanded-leaf stage, but such induction was not as reproducible at two-expanded-leaf stage. Much greater reproducibility was observed when a heat stimulus was applied to the leaf^[10]. Thus, electrical signals in plants vary widely and the strength and transduction of electrical signals depend on the type of damage, wound position, plant species and plant growth stage.

JA is crucial in plant defense against herbivores and pathogens^[28–30]. JA accumulates within minutes in both wounded and intact tissues of Arabidopsis^[31–33]. This may be due to the fast systemic transduction of electrical signals which occurs upstream of JA signaling^[6]. Here, we provide evidence that JA signaling was activated within compound leaves, and the intensity was consistent with the transduction of electrical signals (Fig.3, 4, S1, and S3). Leaf-to-leaf systemic propagation of herbivore-induced electrical signals was not observed in tomato, as it was in Arabidopsis. These findings are strongly supported by evidence from Li et al.^[34] who suggested that JA, or a related compound derived from the octadecanoid pathway, may act as a transmissible wound signal in tomato. Importantly, we found that wounding of different organs caused different levels of response. Petiole damage from wounding or herbivory resulted in stronger electrical signals than leaf damage (Fig.2 and Tab.1). Previous studies show that electrical signals can inhibit photosynthesis^[11,35], suggesting that electrical signals may function as a potential regulator in balancing defense and growth tradeoffs in plants in response to herbivory. However, further research is needed to confirm this.

GLR genes have been reported to mediate electrical signals, ${\mathrm{Ca}}^{\mathrm{2+}}$ signals and JA signaling in Arabidopsis^[5,6,22]. The roles of tomato GLR3.3 or/and GLR3.5 in regulating electrical signals and JA accumulation are demonstrated in the present study. First, glr3.5 mutants and glr3.3/3.5 double mutants showed reduced electrical signal intensity in response to mechanical wounding, displaying lower amplitudes within the wounded leaflets compared with those displayed by untransformed plants (Fig.3 and Tab.2). Second, the propagation of electrical signals from wounded leaflet 1 to undamaged leaflet 3 was abolished in the glr3.3, glr3.5 and glr3.3/3.5 mutants (Fig.3 and Tab.2). Third, the glr3.3/3.5 mutants accumulated reduced amounts of JA and JA-Ile upon W+ OS (Fig.5(a)). Fourth, the glr3.5 and glr3.3/3.5 mutants presented significantly decreased resistance to H. armigera (Fig.5(b)). These results are consistent with those of an earlier study that showed that GLR3.5-mediated nematodes induced both systemic transduction of electrical signals and JA accumulation^[12]. Given that there were no differences in electrical signal amplitude detected in the wounded leaflets between the glr3.3 mutants and untransformed plants, we suggest that GLR3.3 may function mainly in the propagation of electrical signals rather than in the generation of these signals.

5 CONCLUSIONS

This study shows the characteristics of electrical signals in tomato elicited by herbivory and wounding. Both herbivory and mechanical wounding induced electrical signals. However, petiole wounding produced stronger electrical signals than did leaflet wounding. Wounding of a leaflet caused electrical signal transduction and JA signaling within a whole compound leaf. Further investigation revealed that GLR3.3- and GLR3.5-mediated herbivory/wound-elicited the propagation of electrical signals within a compound leaf, further activating JA signaling.

References

[1] AlexandratosN, BruinsmaJ. World agriculture towards 2030/2050: the 2012 revision. Rome: FAO , 2012

[2] Foodand Agriculture Organization of the United Nations (FAO). The Future of Food and Agriculture-Alternative Pathways to 2050. FAO, 2018. Available at FAO website on May 29, 2022

[3] CrewsT E, PeoplesM B. Legume versus fertilizer sources of nitrogen: ecological tradeoffs and human needs. Agriculture, Ecosystems & Environment , 2004, 102( 3): 279–297

[4] ErismanJ W, SuttonM A, GallowayJ, KlimontZ, WiniwarterW. How a century of ammonia synthesis changed the world. Nature Geoscience , 2008, 1( 10): 636–639

[5] CelestinaC, HuntJ R, SaleP W G, FranksA E. Attribution of crop yield responses to application of organic amendments: a critical review. Soil & Tillage Research , 2019, 186 : 135–145

[6] DiaconoM, MontemurroF. Long-term effects of organic amendments on soil fertility. A review. Agronomy for Sustainable Development , 2010, 30( 2): 401–422

[7] Foodand Agriculture Organization of the United Nations (FAO). FAOSTAT Statistical Database. Rome: FAO , 2022. Available at FAO website on May 29, 2022

[8] QaimM. Globalisation of agrifood systems and sustainable nutrition. Proceedings of the Nutrition Society , 2017, 76( 1): 12–21

[9] JiaoX, LyuY, WuX, Li H, ChengL, ZhangC, YuanL, JiangR, JiangB, RengelZ, ZhangF, DaviesW J, ShenJ. Grain production versus resource and environmental costs: towards increasing sustainability of nutrient use in China. Journal of Experimental Botany , 2016, 67( 17): 4935–4949

[10] LiuL, ZhangX, XuW, Liu X, LiY, WeiJ, GaoM, BiJ, Lu X, WangZ, WuX. Challenges for global sustainable nitrogen management in agricultural systems. Journal of Agricultural and Food Chemistry , 2020, 68( 11): 3354–3361

[11] GallowayJ N, TownsendA R, ErismanJ W, BekundaM, CaiZ, FreneyJ R, MartinelliL A, SeitzingerS P, SuttonM A. Transformation of the nitrogen cycle: recent trends, questions, and potential solutions. Science , 2008, 320( 5878): 889–892

[12] ErismanJ W, GallowayJ N, DiseN B, SuttonM A, BleekerA, GrizzettiB, LeachA M, deVries W. Nitrogen: Too Much of a Vital Resource: Science Brief. Zeist: WWF Netherlands , 2015

[13] UnitedNations (UN). Sustainable Development Goals. New York: UN , 2015. Available at UN website on May 29, 2022

[14] LiuX, ZhangY, HanW, TangA, ShenJ, CuiZ, VitousekP, ErismanJ W, GouldingK, ChristieP, FangmeierA, ZhangF. Enhanced nitrogen deposition over China. Nature , 2013, 494( 7438): 459–462

[15] YuC, Huang X, ChenH, GodfrayH C J, WrightJ S, HallJ W, GongP, NiS, Qiao S, HuangG, XiaoY, ZhangJ, FengZ, JuX, Ciais P, StensethN C, HessenD O, SunZ, YuL, Cai W, FuH, HuangX, ZhangC, LiuH, TaylorJ. Managing nitrogen to restore water quality in China. Nature , 2019, 567( 7749): 516–520

[16] KanterD, MauzerallD L, RavishankaraA R, DanielJ S, PortmannR W, GrabielP M, MoomawW R, GallowayJ N. A post-Kyoto partner: considering the stratospheric ozone regime as a tool to manage nitrous oxide. Proceedings of the National Academy of Sciences of the United States of America , 2013, 110( 12): 4451–4457

[17] GuoJ H, LiuX J, ZhangY, ShenJ L, HanW X, ZhangW F, ChristieP, GouldingK W T, VitousekP M, ZhangF S. Significant acidification in major Chinese croplands. Science , 2010, 327( 5968): 1008–1010

[18] ZhuQ, LiuX, HaoT, ZengM, ShenJ, ZhangF, deVries W. Cropland acidification increases risk of yield losses and food insecurity in China. Environmental Pollution , 2020, 256 : 113145

[19] NorseD, JuX T. Environmental costs of China’s food security. Agriculture, Ecosystems & Environment , 2015, 209 : 5–14

[20] RockströmJ, SteffenW, NooneK, PerssonA, ChapinF S 3rd, LambinE F, LentonT M, SchefferM, FolkeC, SchellnhuberH J, NykvistB, deWit C A, HughesT, vander Leeuw S, RodheH, SörlinS, SnyderP K, CostanzaR, SvedinU, FalkenmarkM, KarlbergL, CorellR W, FabryV J, HansenJ, WalkerB, LivermanD, RichardsonK, CrutzenP, FoleyJ A. A safe operating space for humanity. Nature , 2009, 461( 7263): 472–475

[21] DeVries W, KrosJ, KroezeC, SeitzingerS P. Assessing planetary and regional nitrogen boundaries related to food security and adverse environmental impacts. Current Opinion in Environmental Sustainability , 2013, 5( 3−4): 392–402

[22] SteffenW, RichardsonK, RockströmJ, CornellS E, FetzerI, BennettE M, BiggsR, CarpenterS R, deVries W, deWit C A, FolkeC, GertenD, HeinkeJ, MaceG M, PerssonL M, RamanathanV, ReyersB, SörlinS. Sustainability. Planetary boundaries: guiding human development on a changing planet. Science , 2015, 347( 6223): 1259855

[23] HillebrandH, DonohueI, HarpoleW S, HodappD, KuceraM, LewandowskaA M, MerderJ, MontoyaJ M, FreundJ A. Thresholds for ecological responses to global change do not emerge from empirical data. Nature Ecology & Evolution , 2020, 4( 11): 1502–1509

[24] ChenX, CuiZ, FanM, VitousekP, ZhaoM, MaW, Wang Z, ZhangW, YanX, YangJ, DengX, GaoQ, ZhangQ, GuoS, RenJ, LiS, Ye Y, WangZ, HuangJ, TangQ, SunY, PengX, ZhangJ, HeM, Zhu Y, XueJ, WangG, WuL, An N, WuL, MaL, Zhang W, ZhangF. Producing more grain with lower environmental costs. Nature , 2014, 514( 7523): 486–489

[25] ZhangX, DavidsonE A, MauzerallD L, SearchingerT D, DumasP, ShenY. Managing nitrogen for sustainable development. Nature , 2015, 528( 7580): 51–59

[26] JohnstonA M, BruulsemaT W. 4R nutrient stewardship for improved nutrient use efficiency. Procedia Engineering , 2014, 83 : 365–370

[27] ChenX P, CuiZ L, VitousekP M, CassmanK G, MatsonP A, BaiJ S, MengQ F, HouP, YueS C, RömheldV, ZhangF S. Integrated soil-crop system management for food security. Proceedings of the National Academy of Sciences of the United States of America , 2011, 108( 16): 6399–6404

[28] SuttonM A, BleekerA, HowardC M, BekundaM, GrizzettiB, deVries W, vanGrinsven H J M, AbrolY P, AdhyaT K, BillenG, DavidsonE A, DattaA, DiazR, ErismanJ W, LiuX J, OenemaO, PalmC, RaghuramN, ReisS, ScholzR W, SimsT, WesthoekH, ZhangF S. Our Nutrient World: The challenge to produce more food and energy with less pollution. Edinburgh: Centre for Ecology and Hydrology , 2013

[29] KanterD R, ChodosO, NordlandO, RutiglianoM, WiniwarterW. Gaps and opportunities in nitrogen pollution policies around the world. Nature Sustainability , 2020, 3( 11): 956–963

[30] LiuX, VitousekP, ChangY, ZhangW, MatsonP, ZhangF. Evidence for a historic change occurring in China. Environmental Science & Technology , 2016, 50( 2): 505–506

[31] SwaneyD P, HowarthR W, HongB. Nitrogen use efficiency and crop production: patterns of regional variation in the United States, 1987−2012. Science of the Total Environment , 2018, 635 : 498–511

[32] MuellerN D, GerberJ S, JohnstonM, RayD K, RamankuttyN, FoleyJ A. Closing yield gaps through nutrient and water management. Nature , 2012, 490( 7419): 254–257

[33] StevensC J. Nitrogen in the environment. Science , 2019, 363( 6427): 578–580

[34] HowarthR W, RamakrishnaK, ChoiE, ElmgrenR, Zhao-LiangZ. Chapter 9: nutrient management, responses assessment. In: Chopra K, Leemans R, eds. Ecosystems and Human Well-being, Volume 3. Policy Responses, the Millennium Ecosystem Assessment. Washington: Island Press , 2005, 3: 295–311

[35] KanterD R, SearchingerT D. A technology-forcing approach to reduce nitrogen pollution. Nature Sustainability , 2018, 1( 10): 544–552

[36] HoultonB Z, AlmarazM, AnejaV, AustinA T, BaiE, CassmanK G, ComptonJ E, DavidsonE A, ErismanJ W, GallowayJ N, GuB, Yao G, MartinelliL A, ScowK, SchlesingerW H, TomichT P, WangC, ZhangX. A world of co-benefits: solving the global nitrogen challenge. Earth’s Future , 2019, 7( 8): 1–8

[37] GallowayJ N, AberJ D, ErismanJ W, SeitzingerS P, HowarthR W, CowlingE B, CosbyB J. The nitrogen cascade. Bioscience , 2003, 53( 4): 341–356

[38] LadhaJ K, JatM I, StirlingC M, ChakrabortyD, PradhanP, KrupnikT J, SapkotaT B, PathakH, RanaD S, TesfayeK, GerardB. Achieving the sustainable development goals in agriculture: The crucial role of nitrogen in cereal-based systems. Advances in Agronomy , 2020, 163 : 39–116

[39] SuttonM A, OenemaO, ErismanJ W, LeipA, vanGrinsven H, WiniwarterW. Too much of a good thing. Nature , 2011, 472( 7342): 159–161

[40] VitousekP M, NaylorR, CrewsT, DavidM B, DrinkwaterL E, HollandE, JohnesP J, KatzenbergerJ, MartinelliL A, MatsonP A, NziguhebaG, OjimaD, PalmC A, RobertsonG P, SanchezP A, TownsendA R, ZhangF S. Nutrient imbalances in agricultural development. Science , 2009, 324( 5934): 1519–1520

[41] GuB, van Grinsven H J M, Lam S K, OenemaO, SuttonM A, MosierA, ChenD. A credit system to solve agricultural nitrogen pollution. Innovation , 2021, 2( 1): 100079

[42] LiuX, XuW, Du E, TangA, ZhangY, ZhangY, WenZ, HaoT, PanY, ZhangL, GuB, Zhao Y, ShenJ, ZhouF, GaoZ, FengZ, ChangY, GouldingK, CollettJ L Jr, VitousekP M, ZhangF. Environmental impacts of nitrogen emissions in China and the role of policies in emission reduction. Philosophical Transactions of the Royal Society Series A-Mathematical , Philosophical Transactions of the Royal Society Series A-Mathematical , 2020, 378( 2183): 20190324

[43] LiuX, ShaZ, SongY, DongH, PanY, GaoZ, LiY, Ma L, DongW, HuC, Wang W, WangY, GengH, ZhengY, GuM. China’s atmospheric ammonia emission characteristics, mitigation options and policy recommendations. Research of Environmental Sciences , 2021, 34(1): 149−157 ( in Chinese)

[44] ZhanX, AdalibiekeW, CuiX, WiniwarterW, ReisS, ZhangL, BaiZ, WangQ, HuangW, ZhouF. Improved estimates of ammonia emissions from global croplands. Environmental Science & Technology , 2021, 55( 2): 1329–1338

[45] LiuL, XuW, Lu X, ZhongB, GuoY, LuX, Zhao Y, HeW, WangS, ZhangX, LiuX, VitousekP. Exploring global changes in agricultural ammonia emissions and their contribution to nitrogen deposition since 1980. Proceedings of the National Academy of Sciences of the United States of America , 2022, 119( 14): e2121998119

[46] GuB, Sutton M A, ChangS X, GeY, Chang J. Agricultural ammonia emissions contribute to China’s urban air pollution. Frontiers in Ecology and the Environment , 2014, 12( 5): 265–266

[47] XuW, Liu X, LiuL, DoreA J, TangA, LuL, Wu Q, ZhangY, HaoT, PanY, ChenJ, ZhangF. Impact of emission controls on air quality in Beijing during APEC 2014: implications from water-soluble ions and carbonaceous aerosol in PM_2.5 and their precursors. Atmospheric Environment , 2019, 210 : 241–252

[48] VelthofG L, OudendagD, WitzkeH P, AsmanW A H, KlimontZ, OenemaO. Integrated assessment of nitrogen losses from agriculture in EU-27 using MITERRA-EUROPE. Journal of Environmental Quality , 2009, 38( 2): 402–417

[49] KesikM, AmbusP, BaritzR, BrüggemannN, Butterbach-BahlK, DammM, DuyzerJ, HorváthL, KieseR, KitzlerB, LeipA, LiC, Pihlatie M, PilegaardK, SeufertS, SimpsonD, SkibaU, SmiatekG, VesalaT, Zechmeister-BoltensternS. Inventories of N₂O and NO emissions from European forest soils. Biogeosciences , 2005, 2( 4): 353–375

[50] BangeH W. Nitrous oxide and methane in European coastal waters. Estuarine, Coastal and Shelf Science , 2006, 70( 3): 361–374

[51] DuE, de Vries W. Nitrogen-induced new net primary production and carbon sequestration in global forests. Environmental Pollution , 2018, 242(Pt B): 1476–1487

[52] SchulzeE D, HögbergP, vanOene H, PerssonT, HarrisonA F, ReadD, KjøLlerA, MatteucciG. Interactions between the carbon and nitrogen cycles and the role of biodiversity: a synopsis of a study along a north-south transect through Europe. In: Schulze E D, eds. Carbon and Nitrogen Cycling in European Forest Ecosystems. Berlin, Heidelberg: Springer , 2000, 468–491

[53] JanssensI A, DielemanW, LuyssaertS, SubkeJ A, ReichsteinM, CeulemansR, CiaisP, DolmanA J, GraceJ, MatteucciG, PapaleD, PiaoS L, SchulzeE D, TangJ, LawB E. Reduction of forest soil respiration in response to nitrogen deposition. Nature Geoscience , 2010, 3( 5): 315–322

[54] DingT, NingY, ZhangY. Estimation of greenhouse gas emissions in China 1990–2013. Greenhouse Gases (Chichester, UK) , 2017, 7( 6): 1097–1115

[55] LiuX, ZhangF. Nitrogen fertilizer induced greenhouse gas emissions in China. Current Opinion in Environmental Sustainability , 2011, 3( 5): 407–413

[56] ZhouF, ShangZ, CiaisP, TaoS, PiaoS, RaymondP, HeC, Li B, WangR, WangX, PengS, ZengZ, ChenH, YingN, HouX, XuP. A new high-resolution N₂O emission inventory for China in 2008. Environmental Science & Technology , 2014, 48( 15): 8538–8547

[57] KobayashiH, SagoR. A study on life cycle assessment of energy consumption and CO₂ emissions in the manufacturing and transportation processes of nitrogen and phosphate fertilizers . Japanese Journal of Farm Work Research , 2001, 36(3): 141−151 ( in Japanese)

[58] FollettR F. Soil management concepts and carbon sequestration in cropland soils. Soil & Tillage Research , 2001, 61( 1−2): 77–92

[59] ZhangW F, DouZ X, HeP, Ju X T, PowlsonD, ChadwickD, NorseD, LuY L, ZhangY, WuL, Chen X P, CassmanK G, ZhangF S. New technologies reduce greenhouse gas emissions from nitrogenous fertilizer in China. Proceedings of the National Academy of Sciences of the United States of America , 2013, 110( 21): 8375–8380

[60] DuanS, LiangT, ZhangS, WangL, ZhangX, ChenX. Seasonal changes in nitrogen and phosphorus transport in the lower Changjiang River before the construction of the Three Gorges Dam. Estuarine, Coastal and Shelf Science , 2008, 79( 2): 239–250

[61] BillenG, GarnierJ, LassalettaL. The nitrogen cascade from agricultural soils to the sea: modelling nitrogen transfers at regional watershed and global scales. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences , 2013, 368( 1621): 20130123

[62] GruberN, GallowayJ N. An earth-system perspective of the global nitrogen cycle. Nature , 2008, 451( 7176): 293–296

[63] BillenG, SilvestreM, GrizzettiB, LeipA, GarnierJ, VossM, HowarthR, BouraouiF, LepistöA, KortelainenP, JohnesP, CurtisC, HumborgC, SmedbergE, KasteØ, GaneshramR, BeusenA, LancelotC. Nitrogen flows from European watersheds to coastal marine waters. In: Sutton, M. A, Howard C M, Erisman J W, Billen G, Bleeker A, Grennfelt P, van Grinsven H, Grizzetti B, eds. The European Nitrogen Assessment. Cambridge: Cambridge University Press , 2011, 271–297

[64] HanY, FanY, YangP, WangX, WangY, TianJ, XuL, Wang C. Net anthropogenic nitrogen inputs (NANI) index application in Mainland China. Geoderma , 2014, 213 : 87–94

[65] HowarthR, SwaneyD, BillenG, GarnierJ, HongB, HumborgC, JohnesP, MörthC M, MarinoR. Nitrogen fluxes from the landscape are controlled by net anthropogenic nitrogen inputs and by climate. Frontiers in Ecology and the Environment , 2012, 10( 1): 37–43

[66] ShenJ, LiuJ, LiY, Li Y, WangY, LiuX, WuJ. Contribution of atmospheric nitrogen deposition to diffuse pollution in a typical hilly red soil catchment in southern China. Journal of Environmental Sciences , 2014, 26( 9): 1797–1805

[67] GaoW, HowarthR W, HongB, SwaneyD P, GuoH C. Estimating net anthropogenic nitrogen inputs (NANI) in the Lake Dianchi basin of China. Biogeosciences , 2014, 11( 16): 4577–4586

[68] HanY, FengG, SwaneyD P, DentenerF, KoebleR, OuyangY, GaoW. Global and regional estimation of net anthropogenic nitrogen inputs (NANI). Geoderma , 2020, 361 : 114066

[69] WangJ, BeusenA H W, LiuX, DingenenR V, DentenerF, YaoQ, XuB, Ran X, YuZ, BouwmanA F. Spatially explicit inventory of sources of nitrogen inputs to the Yellow Sea, East China Sea, and South China Sea for the period 1970–2010. Earth’s Future , 2020, 8( 10): e2020EF001516

[70] StrokalM, YangH, ZhangY, KroezeC, LiL, Luan S, WangH, YangS, ZhangY. Increasing eutrophication in the coastal seas of China from 1970 to 2050. Marine Pollution Bulletin , 2014, 85( 1): 123–140

[71] StrokalM, MaL, Bai Z, LuanS, KroezeC, OenemaO, VelthofG, ZhangF. Alarming nutrient pollution of Chinese rivers as a result of agricultural transitions. Environmental Research Letters , 2016, 11( 2): 024014

[72] LiuY, JiangQ, SunY, JianY, ZhouF. Decline in nitrogen concentrations of eutrophic Lake Dianchi associated with policy interventions during 2002−2018. Environmental Pollution , 2021, 288 : 117826

[73] YangY, JiC, Ma W, WangS, WangS, HanW, MohammatA, RobinsonD, SmithP. Significant soil acidification across northern China’s grasslands during 1980s−2000s. Global Change Biology , 2012, 18( 7): 2292–2300

[74] ZhuQ, deVries W, LiuX, ZengM, HaoT, DuE, Zhang F, ShenJ. The contribution of atmospheric deposition and forest harvesting to forest soil acidification in China since 1980. Atmospheric Environment , 2016, 146 : 215–222

[75] FageriaN K, NascenteA S. Management of soil acidity of South American soils for sustainable crop production. Advances in Agronomy , 2014, 128 : 221–275

[76] LuX, Mao Q, GilliamF S, LuoY, MoJ. Nitrogen deposition contributes to soil acidification in tropical ecosystems. Global Change Biology , 2014, 20( 12): 3790–3801

[77] DeVries W, DobbertinM H, SolbergS, VanDobben H F, SchaubM. Impacts of acid deposition, ozone exposure and weather conditions on forest ecosystems in Europe: an overview. Plant and Soil , 2014, 380( 1−2): 1–45

[78] ZhaoB, LiX, Li X, ShiX, HuangS, WangB, ZhuP, YangX, LiuH, ChenY, PoultonP, PowlsonD, ToddA, PayneR. Long-term fertilizer experiment network in China: crop yields and soil nutrient trends. Agronomy Journal , 2010, 102( 1): 216–230

[79] HaoT, ZhuQ, ZengM, ShenJ, ShiX, LiuX, ZhangF, deVries W. Quantification of the contribution of nitrogen fertilization and crop harvesting to soil acidification in a wheat-maize double cropping system. Plant and Soil , 2019, 434( 1−2): 167–184

[80] ZhuQ, deVries W, LiuX, HaoT, ZengM, ShenJ, ZhangF. Enhanced acidification in Chinese croplands as derived from element budgets in the period 1980−2010. Science of the Total Environment , 2018, 618 : 1497–1505

[81] KochianL V, HoekengaO A, PiñerosM A. How do crop plants tolerate acid soils? Mechanisms of aluminum tolerance and phosphorous efficiency. Annual Review of Plant Biology , 2004, 55( 1): 459–493

[82] WangB L, ShenJ B, ZhangW H, ZhangF S, NeumannG. Citrate exudation from white lupin induced by phosphorus deficiency differs from that induced by aluminum. New Phytologist , 2007, 176( 3): 581–589

[83] ZhuQ, LiuX, HaoT, ZengM, ShenJ, ZhangF, DeVries W. Modeling soil acidification in typical Chinese cropping systems. Science of the Total Environment , 2018, 613–614: 1339–1348

[84] ZhangX, LiuW, ZhangG, JiangL, HanX. Mechanisms of soil acidification reducing bacterial diversity. Soil Biology & Biochemistry , 2015, 81 : 275–281

[85] IntergovernmentalScience-Policy Platform on Biodiversity and Ecosystem Services (IPBES). Summary for policymakers of the global assessment report on biodiversity and ecosystem services. Paris: IPBES , 2019

[86] LeadleyP W, KrugC B, AlkemadeR, PereiraH M, SumailaU R, WalpoleM, MarquesA, NewboldT, TehL S L, vanKolck J, BellardC, Januchowski-HartleyS R, MumbyP J. Progress towards the Aichi Biodiversity Targets: an Assessment of Biodiversity Trends, Policy Scenarios and Key Actions. CBD Technical Series 78. Montreal, Canada: Secretariat of the Convention on Biological Diversity , 2014

[87] BobbinkR, HicksK, GallowayJ, SprangerT, AlkemadeR, AshmoreM, BustamanteM, CinderbyS, DavidsonE, DentenerF, EmmettB, ErismanJ W, FennM, GilliamF, NordinA, PardoL, DeVries W. Global assessment of nitrogen deposition effects on terrestrial plant diversity: a synthesis. Ecological Applications , 2010, 20( 1): 30–59

[88] ShenJ, ChenD, BaiM, SunJ, LamS K, MosierA, LiuX, LiY. Spatial variations in soil and plant nitrogen levels caused by ammonia deposition near a cattle feedlot. Atmospheric Environment , 2018, 176 : 120–127

[89] PitcairnC E R, LeithL D, SheppardL J, SuttonA M, FowlerD, MunroR C, TangS, WilsonD, LeithI D. The relationship between nitrogen deposition, species composition and foliar nitrogen concentrations in woodland flora in the vicinity of livestock farms. Environmental Pollution , 1998, 102( Suppl.1): 41–48

[90] ClarkC M, SimkinS M, AllenE B, BowmanW D, BelnapJ, BrooksM L, CollinsS L, GeiserL H, GilliamF S, JovanS E, PardoL H, SchulzB K, StevensC J, SudingK N, ThroopH L, WallerD M. Potential vulnerability of 348 herbaceous species to atmospheric deposition of nitrogen and sulfur in the United States. Nature Plants , 2019, 5( 7): 697–705

[91] HaoT, SongL, GouldingK, ZhangF, LiuX. Cumulative and partially recoverable impacts of nitrogen addition on a temperate steppe. Ecological Applications , 2018, 28( 1): 237–248

[92] Vanden Berg L J L, VergeerP, RichT C G, SmartS M, GuestD, AshmoreM R. Direct and indirect effects of nitrogen deposition on species composition change in calcareous grasslands. Global Change Biology , 2011, 17( 5): 1871–1883

[93] BrittonA J, FisherJ M. Terricolous alpine lichens are sensitive to both load and concentration of applied nitrogen and have potential as bioindicators of nitrogen deposition. Environmental Pollution , 2010, 158( 5): 1296–1302

[94] StevensC J, SmartS M, HenrysP A, MaskellL C, CroweA, SimkinJ, CheffingsC M, WhitfleldC, GowingD J G, RoweE C, DoreA J, EmmettB A. Terricolous lichens as indicators of nitrogen deposition: evidence from national records. Ecological Indicators , 2012, 20 : 196–203

[95] WorldHealth Organization (WHO). Regional Office for Europe. Air quality guidelines for Europe, 2nd ed. WHO: Regional Office for Europe Publishing , 2000

[96] LüX, LiK, Song L, LiuX. Impacts of nitrogen deposition on China’s grassland ecosystems. In: Liu X, Du E, eds. Atmospheric Reactive Nitrogen in China. Singapore: Springer , 2020, 215–243

[97] StevensC J, ThompsonK, GrimeJ P, LongC J, GowingD J G. Contribution of acidification and eutrophication to declines in species richness of calcifuge grasslands along a gradient of atmospheric nitrogen deposition. Functional Ecology , 2010, 24( 2): 478–484

[98] SimkinS M, AllenE B, BowmanW D, ClarkC M, BelnapJ, BrooksM L, CadeB S, CollinsS L, GeiserL H, GilliamF S, JovanS E, PardoL H, SchulzB K, StevensC J, SudingK N, ThroopH L, WallerD M. Conditional vulnerability of plant diversity to atmospheric nitrogen deposition across the United States. Proceedings of the National Academy of Sciences of the United States of America , 2016, 113( 15): 4086–4091

[99] StevensC J, DiseN B, GowingD J G, MountfordJ O. Loss of forb diversity in relation to nitrogen deposition in the UK: regional trends and potential controls. Global Change Biology , 2006, 12( 10): 1823–1833

[100] DavidT I, StorkeyJ, StevensC J. Understanding how changing soil nitrogen affects plant-pollinator interactions. Arthropod-Plant Interactions , 2019, 13( 5): 671–684

[101] StevensC J, DavidT I, StorkeyJ. Atmospheric nitrogen deposition in terrestrial ecosystems: Its impact on plant communities and consequences across trophic levels. Functional Ecology , 2018, 32( 7): 1757–1769

[102] YuG, Jia Y, HeN, ZhuJ, ChenZ, WangQ, PiaoS, LiuX, HeH, Guo X, WenZ, LiP, Ding G, GouldingK. Stabilization of atmospheric nitrogen deposition in China over the past decade. Nature Geoscience , 2019, 12( 6): 424–429

[103] WenZ, XuW, Li Q, HanM, TangA, ZhangY, LuoX, ShenJ, WangW, LiK, Pan Y, ZhangL, LiW, Collett J L Jr, ZhongB, WangX, GouldingK, ZhangF, LiuX. Changes of nitrogen deposition in China from 1980 to 2018. Environment International , 2020, 144 : 106022

[104] NortonR, DavidsonE, RobertsT. Nitrogen use efficiency and nutrient performance indicators. Global Partnership on Nutrient Management (GPNM), Washington: GPNM, 2015

[105] OenemaO. Nitrogen use efficiency (NUE): an indicator for the utilisation of nitrogen in agricultural and food systems. Proceedings - International Fertiliser Society , 2015, 773 : 1–32

[106] LiuX, ZhangW, ZhangF. Chemical fertilizer and agriculture. Bulletin of Chinese Academy of Sciences , 2011, 26(Suppl.): 119−124 ( in Chinese)

[107] ZhangW, CaoG, LiX, Zhang H, WangC, LiuQ, ChenX, CuiZ, ShenJ, JiangR, MiG, Miao Y, ZhangF, DouZ. Closing yield gaps in China by empowering smallholder farmers. Nature , 2016, 537( 7622): 671–674

[108] ZhangC, JuX, Powlson D, OenemaO, SmithP. Nitrogen surplus benchmarks for controlling N pollution in the main cropping systems of China. Environmental Science & Technology , 2019, 53( 12): 6678–6687

[109] CassmanK G, DobermannA, WaltersD T. Agroecosystems, nitrogen-use efficiency, and nitrogen management. Ambio , 2002, 31( 2): 132–140

[110] CuiZ, ZhangF, ChenX, DouZ, LiJ. In-season nitrogen management strategy for winter wheat: Maximizing yields, minimizing environmental impact in an over-fertilization context. Field Crops Research , 2010, 116( 1−2): 140–146

[111] XiaL, LamS K, ChenD, WangJ, TangQ, YanX. Can knowledge-based N management produce more staple grain with lower greenhouse gas emission and reactive nitrogen pollution? A meta-analysis. Global Change Biology , 2017, 23( 5): 1917–1925

[112] CuiX, ZhouF, CiaisP, DavidsonE A, TubielloF N, NiuX, JuX, Canadell J G, BouwmanA F, JacksonR B, MuellerN D, ZhengX, KanterD R, TianH Q, AdalibiekeW, BoY, Wang Q, ZhanX, ZhuD. Global mapping of crop-specific emission factors highlights hotspots of nitrous oxide mitigation. Nature Food , 2021, 2( 11): 886–893

[113] LiT, Zhang X, GaoH, LiB, Wang H, YanQ, OllenburgerM, ZhangW. Exploring optimal nitrogen management practices within site-specific ecological and socioeconomic conditions. Journal of Cleaner Production , 2019, 241 : 118295

[114] JuX T, XingG X, ChenX P, ZhangS L, ZhangL J, LiuX J, CuiZ L, YinB, ChristieP, ZhuZ L, ZhangF S. Reducing environmental risk by improving N management in intensive Chinese agricultural systems. Proceedings of the National Academy of Sciences of the United States of America , 2009, 106( 9): 3041–3046

[115] ZhangF, CuiZ, ChenX, JuX, Shen J, ChenQ, LiuX, ZhangW, MiG, Fan M, JiangR. Integrated nutrient management for food security and environmental quality in China. Advances in Agronomy , 2012, 116 : 1–40

[116] CuiZ, ZhangF, ChenX, MiaoY, LiJ, Shi L, XuJ, YeL, Liu C, YangZ, ZhangQ, HuangS, BaoD. On-farm evaluation of an in-season nitrogen management strategy based on soil N_min test. Field Crops Research , 2008, 105( 1−2): 48–55

[117] PengS, BureshR J, HuangJ, ZhongX, ZouY, YangJ, WangG, LiuY, HuR, Tang Q, CuiK, ZhangF, DobermannA. Improving nitrogen fertilization in rice by site-specific N management. A review. Agronomy for Sustainable Development , 2010, 30( 3): 649–656

[118] LadhaJ K, PathakH, KrupnikT J, SixJ, vanKessel C. Efficiency of fertilizer nitrogen in cereal production: retrospects and prospects. Advances in Agronomy , 2005, 87 : 85–156

[119] SongstadD D, HatfieldJ L, TomesD T. Convergence of food security, energy security and sustainable agriculture. Berlin, Heidelberg: Springer , 2014

[120] LiT, Zhang W, YinJ, ChadwickD, NorseD, LuY, Liu X, ChenX, ZhangF, PowlsonD, DouZ. Enhanced-efficiency fertilizers are not a panacea for resolving the nitrogen problem. Global Change Biology , 2018, 24( 2): e511–e521

[121] AbalosD, JefferyS, Sanz-CobenaA, GuardiaG, VallejoA. Meta-analysis of the effect of urease and nitrification inhibitors on crop productivity and nitrogen use efficiency. Agriculture, Ecosystems & Environment , 2014, 189 : 136–144

[122] ShaZ, MaX, Loick N, LvT, CardenasL M, YanM, LiuX, MisselbrookT. Nitrogen stabilizers mitigate reactive N and greenhouse gas emissions from an arable soil in North China Plain: field and laboratory investigation. Journal of Cleaner Production , 2020, 258 : 121025

[123] LamS K, SuterH, MosierA R, ChenD. Using nitrification inhibitors to mitigate agricultural N₂O emission: a double-edged sword. Global Change Biology , 2017, 23( 2): 485–489

[124] ZhouM, ZhuB, WangS, ZhuX, VereeckenH, BrüggemannN. Stimulation of N₂O emission by manure application to agricultural soils may largely offset carbon benefits: a global meta-analysis. Global Change Biology , 2017, 23( 10): 4068–4083

[125] ZhangX, FangQ, ZhangT, MaW, Velthof G L, HouY, OenemaO, ZhangF. Benefits and trade-offs of replacing synthetic fertilizers by animal manures in crop production in China: a meta-analysis. Global Change Biology , 2020, 26( 2): 888–900

[126] ZhouP, ShengH, LiY, Tong C, GeT, WuJ. Lower C sequestration and N use efficiency by straw incorporation than manure amendment on paddy soils. Agriculture, Ecosystems & Environment , 2016, 219 : 93–100

[127] FanJ, XiaoJ, LiuD, YeG, Luo J, HoulbrookeD, LaurensonS, YanJ, ChenL, TianJ, DingW. Effect of application of dairy manure, effluent and inorganic fertilizer on nitrogen leaching in clayey fluvo-aquic soil: a lysimeter study. Science of the Total Environment , 2017, 592 : 206–214

[128] XiaL, LamS K, YanX, ChenD. How does recycling of livestock manure in agroecosystems affect crop productivity, reactive nitrogen losses, and soil carbon balance. Environmental Science & Technology , 2017, 51( 13): 7450–7457

[129] SwarbreckS M, WangM, WangY, KindredD, Sylvester-BradleyR, ShiW, Varinderpal-Singh, BentleyA R, GriffithsH. A roadmap for lowering crop nitrogen requirement. Trends in Plant Science , 2019, 24( 10): 892–904

[130] YingH, YinY, ZhengH, WangY, ZhangQ, XueY, StefanovskiD, CuiZ, DouZ. Newer and select maize, wheat, and rice varieties can help mitigate N footprint while producing more grain. Global Change Biology , 2019, 25( 12): 4273–4281

[131] ChenF, FangZ, GaoQ, YeY, Jia L, YuanL, MiG, Zhang F. Evaluation of the yield and nitrogen use efficiency of the dominant maize hybrids grown in North and Northeast China. Science China: Life Sciences , 2013, 56( 6): 552–560

[132] MiG, Chen F, YuanL, ZhangF. Ideotype root system architecture for maize to achieve high yield and resource use efficiency in intensive cropping systems. Advances in Agronomy , 2016, 139 : 73–97

[133] ChenX, ChenF, ChenY, GaoQ, YangX, YuanL, ZhangF, MiG. Modern maize hybrids in Northeast China exhibit increased yield potential and resource use efficiency despite adverse climate change. Global Change Biology , 2013, 19( 3): 923–936

[134] ChenF, LiuJ, LiuZ, ChenZ, RenW, GongX, WangL, CaiH, PanQ, YuanL, ZhangF, MiG. Breeding for high-yield and nitrogen use efficiency in maize: lessons from comparison between Chinese and US cultivars. Advances in Agronomy , 2021, 166 : 251–275

[135] LiuQ, WuK, Harberd N P, FuX. Green Revolution DELLAs: from translational reinitiation to future sustainable agriculture. Molecular Plant , 2021, 14( 4): 547–549

[136] LiS, Tian Y, WuK, YeY, Yu J, ZhangJ, LiuQ, HuM, Li H, TongY, HarberdN P, FuX. Modulating plant growth-metabolism coordination for sustainable agriculture. Nature , 2018, 560( 7720): 595–600

[137] WuK, Wang S, SongW, ZhangJ, WangY, LiuQ, YuJ, Ye Y, LiS, ChenJ, ZhaoY, WangJ, WuX, Wang M, ZhangY, LiuB, WuY, Harberd N P, FuX. Enhanced sustainable green revolution yield via nitrogen-responsive chromatin modulation in rice. Science , 2020, 367( 6478): eaaz2046

[138] LvS, Yang X, LinX, LiuZ, ZhaoJ, LiK, Mu C, ChenX, ChenF, MiG. Yield gap simulations using ten maize cultivars commonly planted in Northeast China during the past five decades. Agricultural and Forest Meteorology , 2015, 205 : 1–10

[139] CuiZ, ZhangH, ChenX, ZhangC, MaW, Huang C, ZhangW, MiG, Miao Y, LiX, GaoQ, YangJ, WangZ, YeY, Guo S, LuJ, HuangJ, LvS, Sun Y, LiuY, PengX, RenJ, LiS, Deng X, ShiX, ZhangQ, YangZ, TangL, WeiC, JiaL, ZhangJ, HeM, Tong Y, TangQ, ZhongX, LiuZ, CaoN, KouC, YingH, YinY, JiaoX, ZhangQ, FanM, JiangR, ZhangF, DouZ. Pursuing sustainable productivity with millions of smallholder farmers. Nature , 2018, 555( 7696): 363–366

[140] ZhangF, ChenX, VitousekP. Chinese agriculture: an experiment for the world. Nature , 2013, 497( 7447): 33–35

[141] JuX, Zhang F, BaoX, RömheldV, RoelckeM. Utilization and management of organic wastes in Chinese agriculture: past, present and perspectives. Science China: Life Sciences , 2005, 48(Suppl. 2): 965–979

[142] BaiZ, MaW, Ma L, VelthofG L, WeiZ, HavlíkP, OenemaO, LeeM R F, ZhangF. China’s livestock transition: driving forces, impacts, and consequences. Science Advances , 2018, 4( 7): eaar8534

[143] MaL, Wang F, ZhangW, MaW, Velthof G, QinW, OenemaO, ZhangF. Environmental assessment of management options for nutrient flows in the food chain in China. Environmental Science & Technology , 2013, 47( 13): 7260–7268

[144] GerberP J, UwizeyeA, SchulteR P O, OpioC I, deBoer I J M. Nutrient use efficiency: a valuable approach to benchmark the sustainability of nutrient use in global livestock production? Current Opinion in Environmental Sustainability , 2014, 9–10: 122–130

[145] UwizeyeA, GerberP J, OpioC I, TempioG, MottetA, MakkarH P S, FalcucciA, SteinfeldH, deBore I J M. Nitrogen flows in global pork supply chains and potential improvement from feeding swill to pigs. Resources, Conservation and Recycling , 2019, 146 : 168–179

[146] CaoY, WangX, LiuL, VelthofG L, MisselbrookT, BaiZ, MaL. Acidification of manure reduces gaseous emissions and nutrient losses from subsequent composting process. Journal of Environmental Management , 2020, 264 : 110454

[147] ZhangN, BaiZ, WiniwarterW, LedgardS, LuoJ, LiuJ, GuoY, MaL. Reducing ammonia emissions from dairy cattle production via cost-effective manure management techniques in China. Environmental Science & Technology , 2019, 53( 20): 11840–11848

[148] GuoY, ChenY, SearchingerT D, ZhouM, PanD, YangJ, WuL, Cui Z, ZhangW, ZhangF, MaL, Sun Y, ZondloM A, ZhangL, MauzerallD L. Air quality, nitrogen use efficiency and food security in China are improved by cost-effective agricultural nitrogen management. Nature Food , 2020, 1( 10): 648–658

[149] ShangZ, ZhouF, SmithP, SaikawaE, CiaisP, ChangJ, TianH, DelGrosso S J, ItoA, ChenM, WangQ, BoY, Cui X, CastaldiS, JuszczakR, KasimirÅ, MagliuloV, MedinetsS, MedinetsV, ReesR M, WohlfahrtG, SabbatiniS. Weakened growth of cropland-N₂ O emissions in China associated with nationwide policy interventions. Global Change Biology , 2019, 25( 11): 3706–3719

[150] LassalettaL, BillenG, GrizzettiB, AngladeJ, GarnierJ. 50 year trends in nitrogen use efficiency of world cropping systems: the relationship between yield and nitrogen input to cropland. Environmental Research Letters , 2014, 9( 10): 105011

[151] SinghA, JaswalA, SinghM. Impact of neem coated urea on rice yield and nutrient use efficiency (NUE). Agricultural Reviews , 2019, 40( 1): 70–74

[152] NationalBureau of Statistics of China (NBSC). China Statistical Database. Beijing: NBSC , 2022. Available at National Bureau of Statistics website on May 29, 2022

[153] HefferP, Prud’hommeM. Global nitrogen fertilizer demand and supply: trend, current level and outlook. In: Proceedings of the 2016 International Nitrogen Initiative Conference. Melbourne, Australia: International Fertilizer Association , 2016

[154] UnitedNations (UN). The sustainable development goals report 2019. New York: UN , 2019. Available at UN website on May 29, 2022

[155] ShenJ, ZhuQ, JiaoX, YingH, WangH, WenX, XuW, Li T, CongW, LiuX, HouY, CuiZ, OenemaO, DaviesW J, ZhangF. Agriculture green development: a model for China and the world. Frontiers of Agricultural Science and Engineering , 2020, 7( 1): 5–13

[156] MaL, Bai Z, MaW, GuoM, JiangR, LiuJ, OenemaO, VelthofG L, WhitmoreA P, CrawfordJ, DobermannA, SchwoobM, ZhangF. Exploring future food provision scenarios for China. Environmental Science & Technology , 2019, 53( 3): 1385–1393

[157] UwizeyeA, deBoer I J M, OpioC I, SchulteR P O, FalcucciA, TempioG, TeillardF, CasuF, RulliM, GallowayJ N, LeipA, ErismanJ W, RobinsonT P, SteinfeldH, GerberP J. Nitrogen emissions along global livestock supply chains. Nature Food , 2020, 1( 7): 437–446

[158] WangM, MaL, Strokal M, MaW, LiuX, KroezeC. Hotspots for nitrogen and phosphorus losses from food production in China: a county-scale analysis. Environmental Science & Technology , 2018, 52( 10): 5782–5791

[159] Schulte-UebbingL, deVries W. Reconciling food production and environmental boundaries for nitrogen in the European Union. Science of the Total Environment , 2021, 786 : 147427

[160] DeVries W, Schulte-UebbingL, KrosH, VoogdJ C, LouwagieG. Spatially explicit boundaries for agricultural nitrogen inputs in the European Union to meet air and water quality targets. Science of the Total Environment , 2021, 786 : 147283

[161] GuB, Leach A M, MaL, GallowayJ N, ChangS X, GeY, Chang J. Nitrogen footprint in China: food, energy, and nonfood goods. Environmental Science & Technology , 2013, 47( 16): 9217–9224

[162] BaiZ, MaL, Jin S, MaW, VelthofG L, OenemaO, LiuL, ChadwickD, ZhangF. Nitrogen, phosphorus, and potassium flows through the manure management chain in China. Environmental Science & Technology , 2016, 50( 24): 13409–13418

[163] KanterD R, BartoliniF, KugelbergS, LeipA, OenemaO, UwizeyeA. Nitrogen pollution policy beyond the farm. Nature Food , 2020, 1( 1): 27–32

[164] LemaireG, CarvalhoP, KronbergS, RecousS. Agroecosystem diversity: reconciling contemporary agriculture and environmental quality. UK: Elsevier , 2018

[165] LiuX, XuW, Sha Z, ZhangY, WenZ, WangJ, ZhangF, GouldingK. A green eco-environment for sustainable development-framework and action. Frontiers of Agricultural Science and Engineering , 2020, 7( 1): 67–74

[166] McBratneyA, WhelanB, AncevT, BoumaJ. Future directions of precision agriculture. Precision Agriculture , 2005, 6( 1): 7–23

[167] LiT, Zhang W, CaoH, YingH, ZhangQ, RenS, LiuZ, YinY, QinW, CuiZ, LiuX, JuX, Oenema O, deVries W, ZhangF. Region-specific nitrogen management indexes for sustainable cereal production in China. Environmental Research Communications , 2020, 2( 7): 075002

[168] DavidsonE A, NifongR L, FergusonR B, PalmC, OsmondD L, BaronJ S. Nutrients in the nexus. Journal of Environmental Studies and Sciences , 2016, 6( 1): 25–38

[169] LiL, Li S M, SunJ H, ZhouL L, BaoX G, ZhangH G, ZhangF S. Diversity enhances agricultural productivity via rhizosphere phosphorus facilitation on phosphorus-deficient soils. Proceedings of the National Academy of Sciences of the United States of America , 2007, 104( 27): 11192–11196

[170] VanGrinsven H J M, TenBerge H F M, DalgaardT, FratersB, DurandP, HartA, HofmanG, JacobsenB H, LalorS T J, LesscheJ P, OsterburgB, RichardsK G, TechenA K, VertèsF, WebbJ, WillemsW J. Management, regulation and environmental impacts of nitrogen fertilization in northwestern Europe under the Nitrates Directive; a benchmark study. Biogeosciences , 2012, 9( 12): 5143–5160

[171] DeBoer I J M, vanIttersum M K. Circularity in agricultural production. Wageningen: Wageningen University & Research , 2018

[172] ChadwickD R, WilliamsJ R, LuY, Ma L, BaiZ, HouY, ChenX, MisselbrookT H. Strategies to reduce nutrient pollution from manure management in China. Frontiers of Agricultural Science and Engineering , 2020, 7( 1): 45–55

[173] HouY, VelthofG L, CaseS D C, OelofseM, GrignaniC, BalsariP, ZavattaroL, GioelliF, BernalM P, FangueiroD, TrindadeH, JensenL S, OenemaO. Stakeholder perceptions of manure treatment technologies in Denmark, Italy, the Netherlands and Spain. Journal of Cleaner Production , 2018, 172 : 1620–1630

[174] PanneerselvamP, HalbergN, VaarstM, HermansenJ E. Indian farmers’ experience with and perceptions of organic farming. Renewable Agriculture and Food Systems , 2012, 27( 2): 157–169

[175] ReganJ T, MartonS, BarrantesO, RuaneE, HanegraafM, BerlandJ, KorevaarH, PellerinS, NesmeT. Does the recoupling of dairy and crop production via cooperation between farms generate environmental benefits? A case-study approach in Europe. European Journal of Agronomy , 2017, 82 : 342–356

[176] Foodand Agriculture Organization of the United Nations (FAO). The State of Food and Agriculture 2019. Rome: FAO , 2019. Available at FAO website on May 29, 2022

[177] ProspectiveIndustry Research Institute (PIRI). Report of prospects and investment strategy planning analysis on China food waste treatment industry (2020–2025). Beijing: PIRI , 2018. Available at PIRI website on May 29, 2022

Acknowledgements

This work was supported by the National Natural Science Foundation of China (41425007), the National Key R&D Project of China (2018YFC0213302), the UK-China Virtual Joint Centre for Improved Nitrogen Agronomy, Deutsche Forschungsgemeinschaft (German Research Foundation), Sino-German International Research Training Group AMAIZE-P (328017493/GRK 2366), and the High-level Team Project of China Agricultural University.

Compliance with ethics guidelines

Xuejun Liu, Zhenling Cui, Tianxiang Hao, Lixing Yuan, Ying Zhang, Baojing Gu, Wen Xu, Hao Ying, Weifeng Zhang, Tingyu Li, Xiaoyuan Yan, Keith Goulding, David Kanter, Robert Howarth, Carly Stevens, Jagdish Ladha, Qianqian Li, Lei Liu, Wim de Vries, and Fusuo Zhang declare that they have no conflicts of interest or financial conflicts to disclose. This article does not contain any studies with human or animal subjects performed by any of the authors.

RIGHTS & PERMISSIONS

The Author(s) 2022. Published by Higher Education Press. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0)