AGRONOMIC AND ENVIRONMENTAL BENEFITS OF REINTRODUCING HERB- AND LEGUME-RICH MULTISPECIES LEYS INTO ARABLE ROTATIONS: A REVIEW

Highlights

● Arable-ley rotations can alleviate soil degradation and erosion.

● Multispecies leys can improve livestock health and reduce greenhouse gas emissions.

● Ley botanical composition is crucial for determining benefits.

● Lack of livestock infrastructure in arable areas may prevent arable-ley uptake.

● Long-term (10–25 years) research is needed to facilitate evidence-based decisions.

Abstract

Agricultural intensification and the subsequent decline of mixed farming systems has led to an increase in continuous cropping with only a few fallow or break years, undermining global soil health. Arable-ley rotations incorporating temporary pastures (leys) lasting 1–4 years may alleviate soil degradation by building soil fertility and improving soil structure. However, the majority of previous research on arable-ley rotations has utilized either grass or grass-clover leys within ungrazed systems. Multispecies leys, containing a mix of grasses, legumes, and herbs, are rapidly gaining popularity due to their promotion in agri-environment schemes and potential to deliver greater ecosystem services than conventional grass or grass-clover leys. Livestock grazing in arable-ley rotations may increase the economic resilience of these systems, despite limited research of the effects of multispecies leys on ruminant health and greenhouse gas emissions. This review aims to evaluate previous research on multispecies leys, highlighting areas for future research and the potential benefits and disbenefits on soil quality and livestock productivity. The botanical composition of multispecies leys is crucial, as legumes, deep rooted perennial plants (e.g., Onobrychis viciifolia and Cichorium intybus) and herbs (e.g., Plantago lanceolata) can increase soil carbon, improve soil structure, reduce nitrogen fertilizer requirements, and promote the recovery of soil fauna (e.g., earthworms) in degraded arable soils while delivering additional environmental benefits (e.g., biological nitrification inhibition and enteric methane reduction). Multispecies leys have the potential to deliver biologically driven regenerative agriculture, but more long-term research is needed to underpin evidence-based policy and farmer guidance.

Graphical abstract

Keywords

bioactive forages / integrated crop-livestock systems / nitrogen cycling / plant secondary metabolites / soil carbon / soil quality

Introduction

Lactoferrin (LF) is a multifunctional iron binding glycoprotein belonging to the transferrin family, with a molecular weight of 80 kDa. In 1938, LF was first identified as a red protein that was present in bovine milk[1]. In 1960, it was isolated from human milk by Groves and was subsequently recognized as a major iron binding protein[2−4]. LF is not only present in milk and several other exocrine secretions, but it is also present in the secondary granules of neutrophils. Several biological functions have been described for LF, including iron homeostasis, immunomodulation, cellular growth and differentiation, antimicrobial, antioxidant, anti-inflammatory, antiviral and anticancer properties[5−14]. However, the mechanisms underlying these functions are not clear. In this study, we aimed to obtain mice in which LF expression was reduced or eliminated, thereby providing a model to study the functions and mechanisms of LF.

Of the next-generation genome editing technologies, the CRISPR (clustered regularly interspaced short palindromic repeats)/Cas (CRISPR-associated) system has been demonstrated to be a robust tool for genome engineering. The CRISPR/Cas system is an RNA-based adaptive immune system in bacteria and archaea that can destroy invasive plasmids, phages and viruses[15−17]. Compared with the complex and time-consuming design and generation of zinc finger nucleases and transcription activator-like effector nucleases, the CRISPR/Cas gene-editing approach only requires Cas9 and small guide RNAs (sgRNAs). Because of its simplicity, low cost and high efficiency, the CRISPR/Cas system has become a widely used platform for genome editing in animals and plants[18]. Recently, the type II CRISPR/Cas system has been demonstrated to be an efficient gene-editing technology that has been used successfully to produce many gene-targeted cell lines and animals[19−24].

In this study, we injected plasmid pX330 expressing an sgRNA and human codon-optimized SpCas9 (hSpCas9) into mouse zygotes to modify the mouse LF promoter, and we obtained LF gene promoter mutation mice without detectable random plasmid integration and off-targeting. These mutated mice can provide a model for studying the functions and mechanisms of LF.<FootNote>

The Author(s) 2015.This article is published with open access at http://engineering.cae.cn

</FootNote>

Materials and methods

Animals

Kunming mice used in this project were bought from the Chinese Experimental Animal Resources Research Institute for Food and Drug Control. Animals were handled according to the Guidelines for the Care and Use of Laboratory Animals established by the Beijing Association for Laboratory Animal Science. Animal experiments were approved by the Animal Ethics Committee of the College of Biological Sciences, China Agricultural University.

pX330-sgRNA and 2Se-sgRNA plasmid construction

The targeting sites were designed in the basic LF promoter areas using the free website (http://crispr.mit.edu). We synthesized oligonucleotides that were complementary to the targeting sites with the three highest scores (<CitationRef CitationID="tab000201"/>). The polymerase chain reaction (PCR) primers used in this work are shown in Table S1 (Appendix A). Six pairs of oligonucleotides were designed for three target sites. Three pairs of oligonucleotides (C-mRJM-1-1-F/R, C-mRJM-1-2-F/R, C-mRJM-1-3-F/R) were annealed to double-stranded DNA and then individually ligated to the Bbs I sites of plasmid pX330 (authorized by Dr. Feng Zhang from the Massachusetts Institute of Technology and obtained from Dr. Bo Zhang at the College of Life Sciences, Peking University) to construct three pX330-sgRNA plasmids. The other three pairs of oligos (DC-mRJM-1-1-F/R, DC-mRJM-1-2-F/R, DC-mRJM-1-3-F/R) were individually ligated into the EcoRI and BamHI (New England Biolabs, Ipswich, MA, USA) sites of the dual-color reporter vector 2Se (which was constructed in our laboratory). Then, the pX330-sgRNA and 2Se-sgRNA plasmids were confirmed by sequence analysis.

Tab.1 Three target sites within the basic LF promoter sequences

Score	gRNA
92	CCCTACACAGGCGCTGGTACAGG
88	AGTACCCCCTACACAGGCGCTGG
82	AGCGCCTGTGTAGGGGGTACTGG

Note: The gRNAs are scored by inverse likelihood of offtarget binding.

Verifying the targeting efficiency in HEK293T cells

The human embryonic kidney HEK293T cell line was cultured in Dulbecco’s modified Eagle’s medium (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Gibco, Grand Island, NY, USA) under 5% CO₂ at 37°C. The cells were seeded into 24-well plates (Thermo Fisher Scientific, Waltham, MA, USA). After 24 h, cells were co-transfected with a 1∶1 mixture of plasmid pX330-sgRNA and plasmid 2Se-sgRNA (200 ng per well) using Lipofectamine 2000 reagent (Life Technologies, Grand Island, NY, USA). Cell fluorescence was detected by fluorescence microscopy at 24 h post-transfection. Mutation frequencies were counted by flow cytometry 48 h after transfection.

Construction of pX330-EF1α-sgRNA

Plasmid pX330 was digested with KpnI-HF and AgeI-HF (New England Biolabs, Ipswich, MA, USA) to remove the CBh promoter, and then the linearized pX330 vector was gel purified. The EF1α promoter of plasmid pBudCE 4.1 (purchased from Invitrogen, Carlsbad, CA, USA) was PCR amplified using Q5 high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA) with a pair of primers (KpnI-EF1a-F/XmaI-EF1a-R). After electrophoresis, the PCR products were purified using the E.Z.N.A Gel Extraction Kit (Omega Bio-Tek, Norcross, GA, USA). The purified PCR products were digested by KpnI-HF and XmaI (New England Biolabs, Ipswich, MA, USA), and then ligated to the linearized pX330 vector. Finally, the construction of pX330-EF1α-sgRNA was confirmed by sequence analysis.

Verifying the targeting efficiency of pX330-EF1α-sgRNA in C2C12 cells

The C2C12 cell line was cultured in Dulbecco’s modified Eagle’s medium (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (Gibco, Grand Island, NY, USA) under 5% CO₂ at 37°C. Cells were seeded into six-well plates (Thermo Fisher Scientific, Waltham, MA, USA). After 24 h of culture, plasmids pX330-sgRNA, pX330-EF1α-sgRNA and pGFP (expressing the green fluorescent protein) (4 μg per well) in 150 μL of electroporation medium were electro-transfected into C2C12 cells using electroporation cuvettes. The cells were harvested at 48 h post-transfection, and genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA). The genomic region flanking the CRISPR target site was PCR amplified using Q5 high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA) with the primer pair LF-F1-1/LF-R1-1. After electrophoresis, PCR products were purified using the E.Z.N.A Gel Extraction Kit. A total of 400 ng of the purified PCR products were mixed with 1 μL 10 × LA Buffer, and ultrapure water was added to a final volume of 10 μL, and subjected to a re-annealing process to enable heteroduplex formation: 95°C for 10 min, 95 to 85°C with ramping at −2°C/s, 85°C for 1 min, 85 to 75°C with ramping at −0.3°C/s, 75°C for 1 min, 75 to 65°C with ramping at −0.3°C/s, 65°C for 1 min, 65 to 55°C with ramping at −0.3°C/s, 55°C for 1 min, 55 to 45°C with ramping at − 0.3°C/s, 45°C for 1 min, 45 to 35°C with ramping at −0.3°C/s, 35°C for 1 min, 35 to 25°C with ramping at − 0.3°C/s, 25°C for 1 min, and a final hold at 4°C. After annealing, 10 μL of the products were treated with 2 μL of NEB buffer 2 and 0.5 μL T7 endonuclease 1 (T7EN1) (New England Biolabs, Ipswich, MA, USA), and 7.5 μL of ultrapure water was added, resulting in a final volume of 20 μL. After incubation at 37°C for 1 h, the products were added to 4 μL of 6 × loading buffer and analyzed on 8% Tris-borate-EDTA (TBE) polyacrylamide gels. Gels were stained with ethidium bromide for 5 min and imaged with a Gel Logic 212 Imaging System (Eastman Kodak, Rochester, NY, USA). Quantification was based on relative band intensities. The indel percentage was determined by the formula 100 × (1 − (1 − (b+ c)/(a+ b+ c))^1/2), wherein a is the integrated intensity of the undigested PCR product and b and c are the integrated intensities of each cleavage product.

Pronuclear microinjection

Kunming female mice were superovulated and mated with Kunming male mice, and fertilized eggs were collected from the oviduct. Pronuclear stage eggs were injected with pX330-EF1α-sgRNA at a concentration of 1 ng·μL⁻¹. The eggs were cultivated in M16 (Sigma–Aldrich, St. Louis, MO, USA) for a moment and then transferred into both sides of the fallopian tubes of pseudopregnant Kunming females.

Detection of mutations in mice

Twenty days after birth, genomic DNA was extracted from the tails of mice. The regions surrounding the target locus in the LF gene of the postnatal mice were genotyped by PCR (the primers for the 11 mice used in the first microinjection were LF-F1-1/LF-R1-1; the primers for the 18 mice used in the second microinjection were TB-LF-F/TB-LF-R). Then, genomic DNA was PCR amplified using Q5 high-fidelity DNA polymerase. After purifying the PCR products, a total of 400 ng of the purified PCR products were then denatured, annealed and treated with T7EN1 nuclease. Then, the products with mutations detected by the T7EN1 assay were subcloned into the pMD-19T vector (Takara, Dalian, China), and the clones for each sample were randomly picked and sequenced.

Plasmid integration analysis

Four pairs of primers were randomly designed for different locations in the plasmids (cas9-ZL-F1/R1, cas9-ZL-F2/R2, cas9-ZL-F3/R3, cas9-ZL-F4/R4). To determine whether the plasmid was integrated into the mouse genome, genomic DNA isolated from the mutants was subjected to PCR amplification with the four pairs of primers.

Off-target analysis

To test whether there were off-target mutations, 12 potential off-target candidates were selected using CRISPR Genome Engineering Resources. We designed 12 pairs of primers (OT-LF-F1/1-OT-LF-F12/12) that were complementary to approximately 600 bp regions of potential off-target sites. Then, the regions containing the potential off-target sites were amplified with KOD-plus high-fidelity DNA polymerase (TOYOBO, Osaka, Japan) and sequenced.

Results

Design of sgRNA and preparation of the CRISPR/Cas9 plasmids

The size of the mouse lactoferrin gene promoter is 7.5 kb. The transcription level directed by the LF minimal promoter is controlled by three regions, including both positive (between nucleotides −1739 and −922) and negative (between nucleotides −2644 and −1739, and between nucleotides −589 and −291) regulatory sequences. Moreover, the basic promoter of the mouse lactoferrin gene is located between nucleotides −234 and −21; deletion of this region completely abolishes its activity[25]. Thus, we designed three sgRNAs (sgRNA1-1, sgRNA1-2, sgRNA1-3) targeting this critical area (<CitationRef CitationID="fig000301"/>a), and completed the construction of three pX330-sgRNA and three 2Se-sgRNA plasmids. To validate which sgRNA sequence works, a dual-color reporter vector (2Se) was used to indicate the activity of RNA-guided hSpCas9. The reporter comprises a monomeric red fluorescent protein (mRFP) gene, an RNA-guided hSpCas9 target sequence, and one enhanced GFP (eGFP) gene. The reporter-transfected cells will express only mRFP in the absence of hSpCas9 nuclease activity; in the presence of nuclease activity, the transfected cells will express both mRFP and eGFP[26]. To select the best pX330-sgRNA, we co-transfected pX330-sgRNA and 2Se-sgRNA into HEK293T cells. Twenty-four hours after the transfection, most of the cells expressed mRFP. Only a small fraction of cells expressed both mRFP and eGFP, suggesting that RNA-guided hSpCas9 indeed worked (<CitationRef CitationID="fig000301"/>b). Forty-eight hours after the transfection, the mutation frequencies of the three targets (sgRNA1-1, sgRNA1-2, sgRNA1-3) were 28.6%, 26.0%, and 22.0%, respectively, as assessed by flow cytometry (<CitationRef CitationID="fig000301"/>c).

The promoter of hSpCas9 is CBh in the initial pX330 plasmid. We replaced the CBh promoter with the EF1α promoter, which is constitutively expressed in mouse cells, to improve the expression efficiency of hSpCas9[27]. This promoter replacement was applied to pX330-sgRNA1-1, which had the highest targeting efficiency. To verify that the new plasmid, pX330-EF1α-sgRNA1-1, could still play a role, we transfected pX330-sgRNA1-1, pX330-EF1α-sgRNA1-1, and pGFP into mouse C2C12 cells. Then, we isolated genomic DNA and performed a T7EN1 assay. Apparent cleavages of bands were found in pX330-EF1α-sgRNA1-1-transfected cells (<CitationRef CitationID="fig000301"/>d), indicating that it cleaved the target locus efficiently.

Fig.1 Preparation of the CRISPR/Cas9 plasmids. (a) Schematic of sgRNAs targeting sites at critical regions of the LF promoter. The protospacer adjacent motif (PAM) sequence is labeled in blue and a 12 bp seed sequence is highlighted in red; (b) observed expression of red fluorescent protein (RFP) and green fluorescent protein (GFP), 24 h after co-transfection of pX330-sgRNA and 2Se-sgRNA, by fluorescence microscopy. (c) The percentage of RFP+GFP+ cells by flow cytometry 48 h after co-transfection is shown; (d) T7EN1 assay for Cas9-mediated cleavage in C2C12 cells and its densitometry analysis by Image J.

Full size|PPT slide

One-step generation of LF gene promoter mutant mice by pronuclear injection of circular plasmid

Following validation of the pX330-EF1α-sgRNA1-1 plasmids in mouse C2C12 cells, we directly injected it into the pronucleus of fertilized eggs twice. The two microinjections are summarized in <CitationRef CitationID="tab000301"/>. The regions surrounding the target locus in the LF gene of postnatal mice were genotyped by PCR (Appendix B, Fig. S1). The PCR results demonstrated that the CRISPR/Cas9 system did not produce long insertions or deletions and the T7EN1 assay was performed to assess the targeted cleavage efficiency (<CitationRef CitationID="fig000302"/>a, <CitationRef CitationID="fig000302"/>b). Clear cleavage bands were detected in three mice born after the first microinjection and four mice born after the second microinjection. To confirm this gene mutation, subsequent sequence analysis (<CitationRef CitationID="fig000302"/>c) showed that the seven mice had LF gene promoter mutations at the target site (three mice from the second microinjection) or 40 bp upstream of the target locus (three mice from the first microinjection) or both (one mouse from the second microinjection).

Tab.2 Generation of mutant mice via pX330 plasmid injection

No.	Injected	Pregnancy	Newborn	Mutation	Indel mutation frequency	Mutation type
1	238	4	11	3	3/11 (27%)	Three mice were all mutated 40 bp upstream of the target locus
2	325	5	18	4	4/18 (22%)	Three of four were mutated at the target site, and the other one was mutated at both the target site and 40 bp upstream of the target locus.

Fig.2 Generation of LF gene promoter mutation mice via the CRISPR/Cas9 system. (a) T7EN1 assay for Cas9-mediated cleavage in newborn mice from the first microinjection. Four pregnant mice resulting from the first microinjection gave birth to 11 mice. WT is the genome of Kunming wild-type mice; (b) T7EN1 assay for Cas9-mediated cleavage in newborn mice from the second microinjection. 3′, 10′, 14′, and 17′ represent the genomes of the newborn mice from the second microinjection; (c) DNA sequences of the WT and four mutant alleles in seven mice. The target site is underlined, and the PAM sequence is labeled in green. -//- represents an omitted base, and 18 and 15 bp are omitted from left to right. The numbers of mutant mice are in brackets.

Full size|PPT slide

Plasmid integration and off-target analysis

An injected plasmid may integrate into the gene target in the mouse genome. To determine whether the plasmid integrated, four pairs of primers were randomly designed in different locations of the plasmid. Genomic DNA, isolated from the seven mice generated by CRISPR/Cas9, was subjected to PCR amplification with the four pairs of primers. The final PCR results showed that the plasmid did not integrate into the mouse genome at this level of detection (Appendix B, Fig. S2).

It is known that a small number of mismatches between sgRNAs and the target DNA can be tolerated, and one to four base-pair mismatches did not affect the ability of sgRNAs to identify their potential targets[28,29]. To test whether there were off-target mutations in these genetically modified mice, we searched for off-target sites in the mouse genome containing up to three or four base-pair mismatches compared with the 20 bp sgRNA coding sequence. We predicted 12 potential off target candidates, then the approximate 600 bp regions containing the potential off-target sites were amplified and sequenced. No mutations were observed at these 12 hypothetical off-target loci in any of the seven gene-targeted mice (<CitationRef CitationID="tab000302"/>).

Tab.3 Off-target analysis in LF mutant mice

Site name	Sequence	Indel mutation frequency (Mutant/Total)	Coordinate	Strand
Target site	CCCTACACAGGCGCTGGTACAGG	/	chr 9: 111019095–111019117	−
OT1	aCaTACtCAGGCtCTGGTACAGG	0/7	chr 19: 48087277– 48087299	−
OT2	CtgTACACAGGtGCTGGTAaTGG	0/7	chr 18: 35579256–35579278	+
OT3	tCCTgCACAGGCtCTGGTAtAGG	0/7	chr 2: 121955005–121955027	−
OT4	tCCTgCACAGGCtCTGGTAtAGG	0/7	chr X: 91332097–91332119	+
OT5	tCCTgCACAGGCtCTGGTAtAGG	0/3	chr X: 92015969–92015991	−
OT6	CCacACACAGGgaCTGGTACAGG	0/3	chr 4: 135896156–135896178	+
OT7	CaCTACACAGGaGCTtGTACTGG	0/3	chr 7: 107035334–107035356	−
OT8	CCCTgCgCtGGCcCTGGTACAGG	0/3	chr 3: 27673749–27673771	−
OT9	CCCcACACAaGCtCTGcTACTGG	0/3	chr 10: 111084383–111084405	+
OT10	CCCcAaACAGGaGCTGGTAgGGG	0/3	chr X: 134240517–134240539	+
OT11	CCCTttACAGtCcCTGGTACAGG	0/3	chr 1: 166363559–166363581	−
OT12	CCCTACAtAGatGCTGtTACAGG	0/3	chr 19: 48586214–48586236	−

Note: +, sense strand; −, antisense strand. Mismatches from the on-target sequence are lower-case and boldfaced.

Discussion

In this study, we used CRISPR/Cas-mediated genome editing and obtained mice genetically modified in the LF promoter by injecting plasmid pX330, which expresses sgRNA and hSpCas9, into fertilized eggs of mice. The mutation efficiency was 24% (7/29), which indicates that zygote injection of circular plasmid is a viable and efficient method for generating mouse models with gene modification. Previously, the generation of gene-targeted animals via the CRISPR/Cas9 system was realized through microinjection of a Cas9 RNA∶sgRNA mixture into fertilized eggs. Instead, in this study, we avoided the complex preparation, careful handling and storage of RNA, and injected plasmid pX330 expressing sgRNA and hSpCas9 instead of RNA. Differences have been found when using mRNA and plasmids to generate mutant mice via pronuclear injection of circular plasmid[30] and injecting exogenous components may have an adverse effect on mice. To minimize such a risk, we used a circular plasmid to reduce plasmid integration into the mouse genome. Moreover, we also analyzed plasmid integration in the mouse genome, and the results showed that the injected plasmid did not integrate into the genome. In addition, although prolonged existence of plasmid may increase the chance of off-target mutations, transient expression by pronuclear injection could decrease this risk.

The CRISPR/Cas9 system makes rapid, simple and cost-effective gene mutations, but the high off-target mutation rate cannot be ignored. Previous reports have suggested that one to four base-pair mismatches will not affect the ability of sgRNAs to identify their potential targets. This degree of mismatch reduces, rather than completely preventing, Cas9 cleavage, which leads to a high frequency of off-target mutations[28,29]. We analyzed the off-target rate of seven genetically modified mice, and no mutations were detected in 12 potential off-target sites. However, with the optimization of the CRISPR/Cas9 system, there are also solutions to improve CRISPR-Cas nuclease specificity, for example, using truncated sgRNAs (17 or 18 bp)[31], double-nick[32] and dimeric CRISPR RNA-guided FokI nucleases[33].

The CRISPR/Cas9 system mediated gene mutations at the target sites in previous reports[28,34], but it also mediated gene mutations at both the target site and 40 bp upstream of the target locus in our study. In the first microinjection, we obtained three mice that had a 4 bp insertion 40 bp upstream of the target locus, and in the second microinjection, we still generated one mouse with a mutation 40 bp upstream of the designated target locus. The reason for this is more than likely to be due to the structure of the LF gene promoter. Furthermore, double-stranded break and non-homologous end joining mediated by the CRISPR/Cas9 system may occur at non-target sites.

Conclusions

We have successfully obtained LF gene promoter mutation mice by injecting plasmid pX330 expressing Cas9/gRNA complexes into zygotes without detectable random plasmid integration and off-target mutations. This simple and quick gene editing system will have many potential applications for generating genetically modified small animal models.

References

[1] United Nations. World Population Prospects 2019 Highlights. United Nations, 2019. Available at United Nations website on February 21, 2021

[2] Food and Agriculture Organization of the United Nations (FAO). The future of food and agriculture: Trends and challenges. FAO, 2017. Available at FAO website on February 24, 2020

[3] Committee on Climate Change (CCC). Land use: reducing emissions and preparing for climate change. CCC, 2018. Available at the CCC website on February 24, 2020

[4] Bell M J, Hinton N, Cloy J M, Topp C F E, Rees R M, Cardenas L, Scott T, Webster C, Ashton R W, Whitmore A P, Williams J R, Balshaw H, Paine F, Goulding K W T, Chadwick D R. Nitrous oxide emissions from fertilised UK arable soils: fluxes, emission factors and mitigation. Agriculture, Ecosystems & Environment, 2015, 212 : 134–147

[5] Bouwman A F, Boumans L J M, Batjes N H. Emissions of N₂O and NO from fertilized fields: summary of available measurement data. Global Biogeochemical Cycles, 2002, 16(4): 6–1−6–1

[6] Hicks H L, Comont D, Coutts S R, Crook L, Hull R, Norris K, Neve P, Childs D Z, Freckleton R P. The factors driving evolved herbicide resistance at a national scale. Nature Ecology & Evolution, 2018, 2( 3): 529–536

[7] Ramsden M W, Kendall S L, Ellis S A, Berry P M. A review of economic thresholds for invertebrate pests in UK arable crops. Crop Protection, 2017, 96 : 30–43

[8] Donal P F, Green R E, Heath M F. Agricultural intensification and the collapse of Europe’s farmland bird populations. Proceedings of the Royal Society B: Biological Sciences, 2001, 268( 1462): 25–29

[9] Graves A R, Morris J, Deeks L K, Rickson R J, Kibblewhite M G, Harris J A, Farewell T S, Truckle I. The total costs of soil degradation in England and Wales. Ecological Economics, 2015, 119 : 399–413

[10] Gregory A S, Ritz K, McGrath S P, Quinton J N, Goulding K W T, Jones R J A, Harris J A, Bol R, Wallace P, Pilgrim E S, Whitmore A P. A review of the impacts of degradation threats on soil properties in the UK. Soil Use and Management, 2015, 31(Suppl 1): 1–15

[11] Panagos P, Standardi G, Borrelli P, Lugato E, Montanarella L, Bosello F. Cost of agricultural productivity loss due to soil erosion in the European Union: from direct cost evaluation approaches to the use of macroeconomic models. Land Degradation & Development, 2018, 29( 3): 471–484

[12] Verheijen F G A, Jones R J A, Rickson R J, Smith C J. Tolerable versus actual soil erosion rates in Europe. Earth-Science Reviews, 2009, 94( 1-4): 23–38

[13] Kibblewhite M G, Ritz K, Swift M J. Soil health in agricultural systems. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 2008, 363( 1492): 685–701

[14] European Commission. Thematic strategy for soil protection. European Commission, 2006. Available at European Commission website on October 20, 2021

[15] Nkonya E, Anderson W, Kato E, Mirzabaev A, von Braun J, Meyer S. Global Cost of Land Degradation. In: Nkonya E, Mirzabaev A, von Braun J, eds. Economics of Land Degradation and Improvement—A Global Assessment for Sustainable Development. Springer, 2016, 117–165

[16] Robinson R A, Sutherland W J. Post-war changes in arable farming and biodiversity in Great Britain. Journal of Applied Ecology, 2002, 39( 1): 157–176

[17] Knox O G G, Leake A R, Walker R L, Edwards A C, Watson C A. Revisiting the multiple benefits of historical crop rotations within contemporary UK agricultural systems. Journal of Sustainable Agriculture, 2011, 35( 2): 163–179

[18] Posthumus H, Deeks L K, Rickson R J, Quinton J N. Costs and benefits of erosion control measures in the UK. Soil Use and Management, 2015, 31( S1): 16–33

[19] Department for Environment, Food & Rural Affairs of United Kingdom (DEFRAUK). Agriculture in the United Kingdom 2019. DEFRAUK, 2019. Available at UK Government website on February 11, 2020

[20] Sekaran U, Lai L, Ussiri D A N, Kumar S, Clay S. Role of integrated crop-livestock systems in improving agriculture production and addressing food security—a review. Journal of Agriculture and Food Research, 2021, 5 : 100190

[21] Schut A G T, Cooledge E C, Moraine M, De Ven G W J V, Jones D L, Chadwick D R. Reintegration of crop-livestock systems in europe: an overview. Frontiers of Agricultural Science and Engineering, 2021, 8( 1): 111–129

[22] Johnston A E, Poulton P R, Coleman K, Macdonald A J, White R P. Changes in soil organic matter over 70 years in continuous arable and ley-arable rotations on a sandy loam soil in England. European Journal of Soil Science, 2017, 68( 3): 305–316

[23] Lemaire G, Franzluebbers A, Carvalho P C de F, Dedieu B. Integrated crop-livestock systems: strategies to achieve synergy between agricultural production and environmental quality. Agriculture, Ecosystems & Environment, 2014, 190 : 4–8

[24] Kumar S, Sieverding H, Lai L, Thandiwe N, Wienhold B, Redfearn D, Archer D, Ussiri D, Faust D, Landblom D, Grings E, Stone J J, Jacquet J, Pokharel K, Liebig M, Schmer M, Sexton P, Mitchell R, Smalley S, Osborne S, Ali S, Şentürklü S, Sehgal S, Owens V, Jin V. Facilitating crop–livestock reintegration in the northern great plains. Agronomy Journal, 2019, 111( 5): 2141–2156

[25] Cong W F, Eriksen J. Forbs differentially affect soil microbial community composition and functions in unfertilized ryegrass-red clover leys. Soil Biology & Biochemistry, 2018, 121 : 87–94

[26] Jing J, Søegaard K, Cong W F, Eriksen J. Species diversity effects on productivity, persistence and quality of multispecies swards in a four-year experiment. PLoS One, 2017, 12( 1): e0169208

[27] Moloney T, Sheridan H, Grant J, O’Riordan E G, O’Kiely P. Yield of binary- and multi-species swards relative to single-species swards in intensive silage systems. Irish Journal of Agricultural and Food Research, 2020, 59( 1): 12–26

[28] Kingston-Smith A H, Marshall A H, Moorby J M. Breeding for genetic improvement of forage plants in relation to increasing animal production with reduced environmental footprint. Animal, 2013, 7(Suppl 1): 79–88

[29] Pembleton K G, Tozer K N, Edwards G R, Jacobs J L, Turner L R. Simple versus diverse pastures: opportunities and challenges in dairy systems. Animal Production Science, 2015, 55( 7): 893–901

[30] Pembleton K G, Hills J L, Freeman M J, McLaren D K, French M, Rawnsley R P. More milk from forage: milk production, blood metabolites, and forage intake of dairy cows grazing pasture mixtures and spatially adjacent monocultures. Journal of Dairy Science, 2016, 99( 5): 3512–3528

[31] Ten Berge H F M, Pikula D, Goedhart P W, Schröder J J. Apparent nitrogen fertilizer replacement value of grass-clover leys and of farmyard manure in an arable rotation. Part I: grass-clover leys. Soil Use and Management, 2016, 32( S1): 9–19

[32] Hansen E M, Eriksen J. Nitrate leaching in maize after cultivation of differently managed grass-clover leys on coarse sand in Denmark. Agriculture, Ecosystems & Environment, 2016, 216 : 309–313

[33] Quijas S, Schmid B, Balvanera P. Plant diversity enhances provision of ecosystem services: a new synthesis. Basic and Applied Ecology, 2010, 11( 7): 582–593

[34] Sanderson M A, Goslee S C, Soder K J, Skinner R H, Tracy B F, Deak A. Plant species diversity, ecosystem function, and pasture management—a perspective. Canadian Journal of Plant Science, 2007, 87( 3): 479–487

[35] Grace C, Lynch M B, Sheridan H, Lott S, Fritch R, Boland T M. Grazing multispecies swards improves ewe and lamb performance. Animal, 2018, 13( 8): 1–9

[36] Bracken C J, Lanigan G J, Richards K G, Müller C, Tracy S R, Grant J, Krol D J, Sheridan H, Lynch M B, Grace C, Fritch R, Murphy P N C. Sward composition and soil moisture conditions affect nitrous oxide emissions and soil nitrogen dynamics following urea-nitrogen application. Science of the Total Environment, 2020, 722 : 137780

[37] Millennium Ecosystem Assessment. MA Conceptual Framework. Millennium Ecosystem Assessment, 2005. Available at Millennium Ecosystem Assessment website on February 21, 2021

[38] Foley J A, Defries R, Asner G P, Barford C, Bonan G, Carpenter S R, Chapin F S, Coe M T, Daily G C, Gibbs H K, Helkowski J H, Holloway T, Howard E A, Kucharik C J, Monfreda C, Patz J A, Prentice I C, Ramankutty N, Snyder P K. Global consequences of land use. Science, 2005, 309( 5734): 570–574

[39] Power A G. Ecosystem services and agriculture: tradeoffs and synergies. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences, 2010, 365( 1554): 2959–2971

[40] Ekroos J, Olsson O, Rundlöf M, Wätzold F, Smith H G. Optimizing agri-environment schemes for biodiversity, ecosystem services or both. Biological Conservation, 2014, 172 : 65–71

[41] Horrocks C A, Dungait J A J, Cardenas L M, Heal K V. Does extensification lead to enhanced provision of ecosystems services from soils in UK agriculture. Land Use Policy, 2014, 38 : 123–128

[42] UK Government. GS4: Legume and herb-rich swards. UK Government, 2020. Available at UK government website on February 12, 2020

[43] Welsh Audit Office. Tir Gofal. Welsh Audit Office, 2007. Available at Welsh Audit Office website on February 21, 2020

[44] UK Government. GS7: restoration towards species-rich grassland. UK Government, 2020. Available at UK government website on January 27, 2022

[45] UK Government. GS6: management of species-rich grassland. UK Government, 2021. Available at UK government website on January 27, 2022

[46] Arnott D, Chadwick D R, Harris I, Koj A, Jones D L. What can management option uptake tell us about ecosystem services delivery through agri-environment schemes. Land Use Policy, 2019, 81 : 194–208

[47] Jones J I, Murphy J F, Anthony S G, Arnold A, Blackburn J H, Duerdoth C P, Hawczak A, Hughes G O, Pretty J L, Scarlett P M, Gooday R D, Zhang Y S, Fawcett L E, Simpson D, Turner A W B, Naden P S, Skates J. Do agri-environment schemes result in improved water quality. Journal of Applied Ecology, 2017, 54( 2): 537–546

[48] Teagasc. Results-based Environment-Agri Pilot Project (REAP). Teagasc, 2021. Available at Teagasc website on March 16, 2022

[49] Horrocks C A, Heal K V, Harvie B, Tallowin J B, Cardenas L M, Dungait J A J. Can species-rich grasslands be established on former intensively managed arable soils. Agriculture, Ecosystems & Environment, 2016, 217 : 59–67

[50] Albizua A, Williams A, Hedlund K, Pascual U. Crop rotations including ley and manure can promote ecosystem services in conventional farming systems. Applied Soil Ecology, 2015, 95 : 54–61

[51] Lemaire G, Gastal F, Franzluebbers A, Chabbi A. Grassland-cropping rotations: an avenue for agricultural diversification to reconcile high production with environmental quality. Environmental Management, 2015, 56( 5): 1065–1077

[52] Malézieux E, Crozat Y, Dupraz C, Laurans M, Makowski D, Ozier-Lafontaine H, Rapidel B, De Tourdonnet S, de Tourdonnet S, Valantin-Morison M. Mixing plant species in cropping systems: concepts, tools and models. A review. Agronomy for Sustainable Development, 2009, 29( 1): 43–62

[53] Finn J A, Kirwan L, Connolly J, Sebastià M T, Helgadottir A, Baadshaug O H, Bélanger G, Black A, Brophy C, Collins R P, Čop J, Dalmannsdóttir S, Delgado I, Elgersma A, Fothergill M, Frankow-Lindberg B E, Ghesquiere A, Golinska B, Golinski P, Grieu P, Gustavsson A M, Höglind M, Huguenin-Elie O, Jørgensen M, Kadziuliene Z, Kurki P, Llurba R, Lunnan T, Porqueddu C, Suter M, Thumm U, Lüscher A. Ecosystem function enhanced by combining four functional types of plant species in intensively managed grassland mixtures: a 3-year continental-scale field experiment. Journal of Applied Ecology, 2013, 50( 2): 365–375

[54] Suter M, Huguenin-Elie O, Lüscher A. Multispecies for multifunctions: combining four complementary species enhances multifunctionality of sown grassland. Scientific Reports, 2021, 11( 1): 3835

[55] Grange G, Finn J A, Brophy C. Plant diversity enhanced yield and mitigated drought impacts in intensively managed grassland communities. Journal of Applied Ecology, 2021, 58( 9): 1864–1875

[56] McNally S R, Laughlin D C, Rutledge S, Dodd M B, Six J, Schipper L A. Root carbon inputs under moderately diverse sward and conventional ryegrass-clover pasture: implications for soil carbon sequestration. Plant and Soil, 2015, 392( 1−2): 289–299

[57] Modernel P, Dogliotti S, Alvarez S, Corbeels M, Picasso V, Tittonell P, Rossing W A H. Identification of beef production farms in the Pampas and Campos area that stand out in economic and environmental performance. Ecological Indicators, 2018, 89 : 755–770

[58] Nicholls C I, Altieri M A. Plant biodiversity enhances bees and other insect pollinators in agroecosystems. A review. Agronomy for Sustainable Development, 2013, 33( 2): 257–274

[59] Wagner S C. Biological nitrogen fixation. Nature Education Knowledge., 2011, 3( 10): 15

[60] Mueller K E, Tilman D, Fornara D A, Hobbie S E. Root depth distribution and the diversity-productivity relationship in a long-term grassland experiment. Ecology, 2013, 94( 4): 787–793

[61] Nevens F, Reheul D. The nitrogen- and non-nitrogen-contribution effect of ploughed grass leys on the following arable forage crops: Determination and optimum use. European Journal of Agronomy, 2002, 16( 1): 57–74

[62] Pagliai M, Vignozzi N, Pellegrini S. Soil structure and the effect of management practices. Soil & Tillage Research, 2004, 79( 2): 131–143

[63] Kabir Z. Tillage or no-tillage: impact on mycorrhizae. Canadian Journal of Plant Science, 2005, 85( 1): 23–29

[64] Yang T, Siddique K H M, Liu K. Cropping systems in agriculture and their impact on soil health—a review. Global Ecology and Conservation, 2020, 23 : e01118

[65] Berdeni D, Turner A, Grayson R P, Llanos J, Holden J, Firbank L G, Lappage M G, Hunt S P F, Chapman P J, Hodson M E, Helgason T, Watt P J, Leake J R. Soil quality regeneration by grass-clover leys in arable rotations compared to permanent grassland: effects on wheat yield and resilience to drought and flooding. Soil & Tillage Research, 2021, 212 : 105037

[66] Lehmann A, Zheng W, Rillig M C. Soil biota contributions to soil aggregation. Nature Ecology & Evolution, 2017, 1( 12): 1828–1835

[67] Anderson C, Beare M, Buckley H L, Lear G. Bacterial and fungal communities respond differently to varying tillage depth in agricultural soils. PeerJ, 2017, 5( 10): e3930

[68] Sun R, Li W, Dong W, Tian Y, Hu C, Liu B. Tillage changes vertical distribution of soil bacterial and fungal communities. Frontiers in Microbiology, 2018, 9 : 699

[69] Yvan C, Stéphane S, Stéphane C, Pierre B, Guy R, Hubert B. Role of earthworms in regenerating soil structure after compaction in reduced tillage systems. Soil Biology & Biochemistry, 2012, 55 : 93–103

[70] Langmaack M, Schrader S, Rapp-Bernhardt U, Kotzke K. Soil structure rehabilitation of arable soil degraded by compaction. Geoderma, 2002, 105( 1−2): 141–152

[71] Shah A N, Tanveer M, Shahzad B, Yang G, Fahad S, Ali S, Bukhari M A, Tung S A, Hafeez A, Souliyanonh B. Soil compaction effects on soil health and cropproductivity: an overview. Environmental Science and Pollution Research International, 2017, 24( 11): 10056–10067

[72] Grave R A, Nicoloso R da S, Cassol P C, da Silva M L B, Mezzari M P, Aita C, Wuaden C R. Determining the effects of tillage and nitrogen sources on soil N₂O emission. Soil & Tillage Research, 2018, 175 : 1–12

[73] Schneider F, Don A, Hennings I, Schmittmann O, Seidel S J. The effect of deep tillage on crop yield—what do we really know. Soil & Tillage Research, 2017, 174 : 193–204

[74] Intergovernmental Panel on Climate Change (IPCC). Climate Change and Land: an IPCC special report on climate change, desertification, land degradation, sustainable land management, food security, and greenhouse gas fluxes in terrestrial ecosystems. IPCC, 2019. Available at IPCC website on March 16, 2022

[75] Arai M, Miura T, Tsuzura H, Minamiya Y, Kaneko N. Two-year responses of earthworm abundance, soil aggregates, and soil carbon to no-tillage and fertilization. Geoderma, 2018, 332 : 135–141

[76] Lenssen A W, Sainju U M, Hatfield P G. Integrating sheep grazing into wheat-fallow systems: crop yield and soil properties. Field Crops Research, 2013, 146 : 75–85

[77] Elias D, Wang L, Jacinthe P A. A meta-analysis of pesticide loss in runoff under conventional tillage and no-till management. Environmental Monitoring and Assessment, 2018, 190( 2): 79

[78] Hull R, Tatnell L V, Cook S K, Beffa R, Moss S R. Current status of herbicide-resistant weeds in the UK. In: Crop Production in Southern Britain: Precision Decisions for Profitable Cropping. Aspects of Applied Biology, 2014, 127: 261–272

[79] Davies L R, Hull R, Moss S, Neve P. The first cases of evolving glyphosate resistance in UK poverty brome (Bromus sterilis) populations. Weed Science, 2019, 67( 1): 41–47

[80] Collavo A, Sattin M. Resistance to glyphosate in Lolium rigidum selected in Italian perennial crops: bioevaluation, management and molecular bases of target-site resistance. Weed Research, 2012, 52( 1): 16–24

[81] Alskaf K, Sparkes D L, Mooney S J, Sjögersten S, Wilson P. The uptake of different tillage practices in England. Soil Use and Management, 2020, 36( 1): 27–44

[82] Martin G, Durand J L, Duru M, Gastal F, Julier B, Litrico I, Louarn G, Médiène S, Moreau D, Valentin-Morison M, Novak S, Parnaudeau V, Paschalidou F, Vertès F, Voisin A S, Cellier P, Jeuffroy M H. Role of ley pastures in tomorrow’s cropping systems. A review. Agronomy for Sustainable Development, 2020, 40( 3): 17

[83] Da Silva F D, Amado T J C, Bredemeier C, Bremm C, Anghinoni I, Carvalho P C de F. Pasture grazing intensity and presence or absence of cattle dung input and its relationships to soybean nutrition and yield in integrated crop-livestock systems under no-till. European Journal of Agronomy, 2014, 57 : 84–91

[84] Detheridge A P, Brand G, Fychan R, Crotty F V, Sanderson R, Griffith G W, Marley C L. The legacy effect of cover crops on soil fungal populations in a cereal rotation. Agriculture, Ecosystems & Environment, 2016, 228 : 49–61

[85] Tracy B F, Davis A S. Weed biomass and species composition as affected by an integrated crop-livestock system. Crop Science, 2009, 49( 4): 1523–1530

[86] Christensen B T, Rasmussen J, Eriksen J, Hansen E M. Soil carbon storage and yields of spring barley following grass leys of different age. European Journal of Agronomy, 2009, 31( 1): 29–35

[87] Franzluebbers A J, Stuedemann J A. Early response of soil organic fractions to tillage and integrated crop-livestock production. Soil Science Society of America Journal, 2008, 72( 3): 613–625

[88] Low A J. Improvements in the structural state of soils under leys. Journal of Soil Science, 1955, 6( 2): 179–199

[89] Kautz T, Lüsebrink M, Pätzold S, Vetterlein D, Pude R, Athmann M, Küpper P M, Perkons U, Köpke U. Contribution of anecic earthworms to biopore formation during cultivation of perennial ley crops. Pedobiologia, 2014, 57( 1): 47–52

[90] Mytton L R, Cresswell A, Colbourn P. Improvement in soil structure associated with white clover. Grass and Forage Science, 1993, 48( 1): 84–90

[91] Kell D B. Large-scale sequestration of atmospheric carbon via plant roots in natural and agricultural ecosystems: why and how. Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences, 2012, 367( 1595): 1589–1597

[92] Riley H, Pommeresche R, Eltun R, Hansen S, Korsaeth A. Soil structure, organic matter and earthworm activity in a comparison of cropping systems with contrasting tillage, rotations, fertilizer levels and manure use. Agriculture, Ecosystems & Environment, 2008, 124( 3−4): 275–284

[93] Hodge A. Microbial ecology of the arbuscular mycorrhiza. FEMS Microbiology Ecology, 2000, 32( 2): 91–96

[94] Püschel D, Janoušková M, Voříšková A, Gryndlerová H, Vosátka M, Jansa J. Arbuscular mycorrhiza stimulates biological nitrogen fixation in two Medicago spp. through improved phosphorus acquisition. Frontiers in Plant Science, 2017, 8 : 390

[95] Haynes R J. Labile organic matter fractions and aggregate stability under short-term, grass-based leys. Soil Biology & Biochemistry, 1999, 31( 13): 1821–1830

[96] Studdert G A, Echeverría H E, Casanovas E M. Crop-pasture rotation for sustaining the quality and productivity of a typic argiudoll. Soil Science Society of America Journal, 1997, 61( 5): 1466–1472

[97] Hallam J, Berdeni D, Grayson R, Guest E J, Holden J, Lappage M G, Prendergast-Miller M T, Robinson D A, Turner A, Leake J R, Hodson M E. Effect of earthworms on soil physico-hydraulic and chemical properties, herbage production, and wheat growth on arable land converted to ley. Science of the Total Environment, 2020, 713 : 136491

[98] Prendergast-Miller M T, Jones D T, Berdeni D, Bird S, Chapman P J, Firbank L, Grayson R, Helgason T, Holden J, Lappage M, Leake J, Hodson M E. Arable fields as potential reservoirs of biodiversity: earthworm populations increase in new leys. Science of the Total Environment, 2021, 789 : 147880

[99] van Eekeren N, Bommelé L, Bloem J, Schouten T, Rutgers M, de Goede R, Reheul D, Brussaard L. Soil biological quality after 36 years of ley-arable cropping, permanent grassland and permanent arable cropping. Applied Soil Ecology, 2008, 40( 3): 432–446

[100] Säle V, Aguilera P, Laczko E, Mäder P, Berner A, Zihlmann U, van der Heijden M G A, Oehl F. Impact of conservation tillage and organic farming on the diversity of arbuscular mycorrhizal fungi. Soil Biology & Biochemistry, 2015, 84 : 38–52

[101] Abdalla M, Hastings A, Chadwick D R, Jones D L, Evans C D, Jones M B, Rees R M, Smith P. Critical review of the impacts of grazing intensity on soil organic carbon storage and other soil quality indicators in extensively managed grasslands. Agriculture, Ecosystems & Environment, 2018, 253 : 62–81

[102] Stavi I, Lal R, Owens L B. Effects of cattle grazing during the dormant season on soil surface hydrology and physical quality in a moist-temperate region. Ecohydrology, 2011, 4( 1): 106–114

[103] Martin G, Moraine M, Ryschawy J, Magne M A, Asai M, Sarthou J P, Duru M, Therond O. Crop–livestock integration beyond the farm level: a review. Agronomy for Sustainable Development, 2016, 36( 3): 53

[104] Ambus J V, Reichert J M, Gubiani P I, de Faccio Carvalho P C. Changes in composition and functional soil properties in long-term no-till integrated crop-livestock system. Geoderma, 2018, 330 : 232–243

[105] do Nascimento D M, Cavalieri-Polizeli K M V, da Silva A H, Favaretto N, Parron L M. Soil physical quality under long-term integrated agricultural production systems. Soil & Tillage Research, 2019, 186 : 292–299

[106] Schuster M Z, Pelissari A, de Moraes A, Harrison S K, Sulc R M, Lustosa S B C, Anghinoni I, Carvalho P C F. Grazing intensities affect weed seedling emergence and the seed bank in an integrated crop–livestock system. Agriculture, Ecosystems & Environment, 2016, 232 : 232–239

[107] Greenwood K L, McKenzie B M. Grazing effects on soil physical properties and the consequences for pastures: a review. Australian Journal of Experimental Agriculture, 2001, 41( 8): 1231–1250

[108] Laurenson S, Houlbrooke D J. Assessing the agronomic benefit of noninversion tillage for improving soil structure following winter grazing of cattle and sheep. Soil Use and Management, 2014, 30( 4): 595–602

[109] Ball B C, Watson C A, Baddeley J A. Soil physical fertility, soil structure and rooting conditions after ploughing organically managed grass/clover swards. Soil Use and Management, 2007, 23( 1): 20–27

[110] Six J, Frey S D, Thiet R K, Batten K M. Bacterial and fungal contributions to carbon sequestration in agroecosystems. Soil Science Society of America Journal, 2006, 70( 2): 555–569

[111] Jones D L, Cooledge E C, Hoyle F C, Griffiths R I, Murphy D V. pH and exchangeable aluminum are major regulators of microbial energy flow and carbon use efficiency in soil microbial communities. Soil Biology & Biochemistry, 2019, 138 : 107584

[112] Murphy D V, Stockdale E A, Poulton P R, Willison T W, Goulding K W T. Seasonal dynamics of carbon and nitrogen pools and fluxes under continuous arable and ley-arable rotations in a temperate environment. European Journal of Soil Science, 2007, 58( 6): 1410–1424

[113] Mellado-Vázquez P G, Lange M, Gleixner G. Soil microbial communities and their carbon assimilation are affected by soil properties and season but not by plants differing in their photosynthetic pathways (C3 vs. C4). Biogeochemistry, 2019, 142( 2): 175–187

[114] Collins M, Knutti R, Arblaster J, Dufresne J L, Fichefet T, Friedlingstein P, Gao X, Gutowski W J, Johns T, Krinner G, Shongwe M, Tebaldi C, Weaver A J, Wehner M F, Allen M R, Andrews T, Beyerle U, Bitz C M, Bony S, Booth B B B. Long-term climate change: projections, commitments and irreversibility. In: Stocker T F, Qin D, Plattner G K, Tignor M M B, Allen S K, Boschung J, Nauels A, Xia Y, Bex V, Midgley P M, eds. Climate Change 2013—the Physical Science Basis: Contribution of Working Group I to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change. New York: Cambridge University Press, 2013, 1029–1136

[115] Bölscher T, Ågren G I, Herrmann A M. Land-use alters the temperature response of microbial carbon-use efficiency in soils—a consumption-based approach. Soil Biology & Biochemistry, 2020, 140 : 107639

[116] McAuliffe G A, López-Aizpún M, Blackwell M S A, Castellano-Hinojosa A, Darch T, Evans J, Horrocks C, Le Cocq K, Takahashi T, Harris P, Lee M R F, Cardenas L. Elucidating three-way interactions between soil, pasture and animals that regulate nitrous oxide emissions from temperate grazing systems. Agriculture, Ecosystems & Environment, 2020, 300 : 106978

[117] Qu T, Guo W, Yang C, Zhang J, Yang Y, Wang D. Grazing by large herbivores improves soil microbial metabolic activity in a meadow steppe. Grassland Science, 2021, 67( 1): 30–40

[118] Kautz T, Amelung W, Ewert F, Gaiser T, Horn R, Jahn R, Javaux M, Kemna A, Kuzyakov Y, Munch J C, Pätzold S, Peth S, Scherer H W, Schloter M, Schneider H, Vanderborght J, Vetterlein D, Walter A, Wiesenberg G L B, Köpke U. Nutrient acquisition from arable subsoils in temperate climates: a review. Soil Biology & Biochemistry, 2013, 57 : 1003–1022

[119] Jarvis N, Forkman J, Koestel J, Kätterer T, Larsbo M, Taylor A. Long-term effects of grass-clover leys on the structure of a silt loam soil in a cold climate. Agriculture, Ecosystems & Environment, 2017, 247 : 319–328

[120] Zarea M J, Ghalavand A, Goltapeh E M, Rejali F, Zamaniyan M. Effects of mixed cropping, earthworms (Pheretima sp.), and arbuscular mycorrhizal fungi (Glomus mosseae) on plant yield, mycorrhizal colonization rate, soil microbial biomass, and nitrogenase activity of free-living rhizosphere bacteria. Pedobiologia, 2009, 52( 4): 223–235

[121] Chen X, Henriksen T M, Svensson K, Korsaeth A. Long-term effects of agricultural production systems on structure and function of the soil microbial community. Applied Soil Ecology, 2020, 147 : 103387

[122] Minasny B, Malone B P, McBratney A B, Angers D A, Arrouays D, Chambers A, Chaplot V, Chen Z S, Cheng K, Das B S, Field D J, Gimona A, Hedley C B, Hong S Y, Mandal B, Marchant B P, Martin M, McConkey B G, Mulder V L, O’Rourke S, Richer-de-Forges A C, Odeh I, Padarian J, Paustian K, Pan G, Poggio L, Savin I, Stolbovoy V, Stockmann U, Sulaeman Y, Tsui C C, Vågen T G, van Wesemael B, Winowiecki L. Soil carbon 4 per mille. Geoderma, 2017, 292 : 59–86

[123] Ostle N J, Levy P E, Evans C D, Smith P. UK land use and soil carbon sequestration. Land Use Policy, 2009, 26(Suppl 1): S274−S283

[124] Poulton P, Johnston J, Macdonald A, White R, Powlson D. Major limitations to achieving “4 per 1000” increases in soil organic carbon stock in temperate regions: Evidence from long-term experiments at Rothamsted Research, United Kingdom. Global Change Biology, 2018, 24( 6): 2563–2584

[125] UK Government. A Green Future: Our 25 Year Plan to Improve the Environment. UK Government, 2018. Available at UK Government website on January 20, 2020

[126] Börjesson G, Bolinder M A, Kirchmann H, Kätterer T. Organic carbon stocks in topsoil and subsoil in long-term ley and cereal monoculture rotations. Biology and Fertility of Soils, 2018, 54( 4): 549–558

[127] Krauss M, Ruser R, Müller T, Hansen S, Mäder P, Gattinger A. Impact of reduced tillage on greenhouse gas emissions and soil carbon stocks in an organic grass-clover ley-winter wheat cropping sequence. Agriculture, Ecosystems & Environment, 2017, 239 : 324–333

[128] Chan K Y, Conyers M, Li G D, Helyar K, Poile G, Oates A, Barchia I. Soil carbon dynamics under different cropping and pasture management in temperate Australia: results of three long-term experiments. Soil Research, 2011, 49( 4): 320–328

[129] Bolinder M A, Kätterer T, Andrén O, Ericson L, Parent L E, Kirchmann H. Long-term soil organic carbon and nitrogen dynamics in forage-based crop rotations in Northern Sweden (63–64°N). Agriculture, Ecosystems & Environment, 2010, 138( 3−4): 335–342

[130] Chirinda N, Olesen J E, Porter J R, Schjønning P. Soil properties, crop production and greenhouse gas emissions from organic and inorganic fertilizer-based arable cropping systems. Agriculture, Ecosystems & Environment, 2010, 139( 4): 584–594

[131] Clement C R, Williams T E. Leys and soil organic matter: I. The accumulation of organic carbon in soils under different leys. Journal of Agricultural Science, 1964, 63( 3): 377–383

[132] Hanley F, Ridgman W J, Allen E J. Some effects of the inclusion of leys in a six-course rotation on light land. Journal of Agricultural Science, 1973, 80( 1): 53–62

[133] Sun Z, Chen Q, Han X, Bol R, Qu B, Meng F. Allocation of photosynthesized carbon in an intensively farmed winter wheat-soil system as revealed by ¹⁴CO₂ pulse labelling. Scientific Reports, 2018, 8( 1): 3160

[134] Jensen J L, Schjønning P, Watts C W, Christensen B T, Obour P B, Munkholm L J. Soil degradation and recovery—changes in organic matter fractions and structural stability. Geoderma, 2020, 364 : 114181

[135] Knight S, Stockdale E, Stoate C, Rust N. Scoping study—achieving sustainable intensification by integrating livestock into arable systems—opportunities and impacts. Department for Environment, Food and Rural Affairs, 2019

[136] Crews T E, Peoples M B. Legume versus fertilizer sources of nitrogen: ecological tradeoffs and human needs. Agriculture, Ecosystems & Environment, 2004, 102( 3): 279–297

[137] Fornara D A, Tilman D. Plant functional composition influences rates of soil carbon and nitrogen accumulation. Journal of Ecology, 2008, 96( 2): 314–322

[138] Norton J, Ouyang Y. Controls and adaptive management of nitrification in agricultural soils. Frontiers in Microbiology, 2019, 10 : 1931

[139] Coskun D, Britto D T, Shi W, Kronzucker H J. How plant root exudates shape the nitrogen cycle. Trends in Plant Science, 2017, 22( 8): 661–673

[140] Zerulla W, Barth T, Dressel J, Erhardt K, Horchler von Locquenghien K, Pasda G, Rädle M, Wissemeier A. 3,4-Dimethylpyrazole phosphate (DMPP)—a new nitrification inhibitor for agriculture and horticulture: an introduction. Biology and Fertility of Soils, 2001, 34( 2): 79–84

[141] Ministry for Primary Industries (MPI). New Zealand Government assures safety of country’s dairy products. New Zealand: MPI, 2013. Available at New Zealand Government media website on February 21, 2021

[142] Abalos D, Jeffery S, Sanz-Cobena A, Guardia G, Vallejo A. Meta-analysis of the effect of urease and nitrification inhibitors on crop productivity and nitrogen use efficiency. Agriculture, Ecosystems & Environment, 2014, 189 : 136–144

[143] Misselbrook T H, Cardenas L M, Camp V, Thorman R E, Williams J R, Rollett A J, Chambers B J. An assessment of nitrification inhibitors to reduce nitrous oxide emissions from UK agriculture. Environmental Research Letters, 2014, 9( 11): 115006

[144] Marsden K A, Jones D L, Chadwick D R. DMPP is ineffective at mitigating N₂O emissions from sheep urine patches in a UK grassland under summer conditions. Agriculture, Ecosystems & Environment, 2017, 246 : 1–11

[145] Subbarao G V, Sahrawat K L, Nakahara K, Ishikawa T, Kishii M, Rao I M, Hash C T, George T S, Srinivasa Rao P, Nardi P, Bonnett D, Berry W, Suenaga K, Lata J C. Biological nitrification inhibition—a novel strategy to regulate nitrification in agricultural systems. Advances in Agronomy, 2012, 114 : 249–302

[146] Dietz M, Machill S, Hoffmann H C, Schmidtke K. Inhibitory effects of Plantago lanceolata L. on soil N mineralization. Plant and Soil, 2013, 368( 1−2): 445–458

[147] Gardiner C A, Clough T J, Cameron K C, Di H J, Edwards G R, de Klein C A M. Potential inhibition of urine patch nitrous oxide emissions by Plantago lanceolata and its metabolite aucubin. New Zealand Journal of Agricultural Research, 2018, 61( 4): 495–503

[148] Wu D, Cárdenas L M, Calvet S, Brüggemann N, Loick N, Liu S, Bol R. The effect of nitrification inhibitor on N₂O, NO and N₂ emissions under different soil moisture levels in a permanent grassland soil. Soil Biology & Biochemistry, 2017, 113 : 153–160

[149] Navarrete S, Kemp P D, Pain S J, Back P J. Bioactive compounds, aucubin and acteoside, in plantain (Plantago lanceolata L.) and their effect on in vitro rumen fermentation. Animal Feed Science and Technology, 2016, 222 : 158–167

[150] Office for National Statistics (ONS). Final UK greenhouse gas emissions national statistics: 1990–2017. UK: ONS, 2020. Available at UK Government website on June 30, 2020

[151] Intergovernmental Panel on Climate Change (IPCC). Climate Change 2014: Synthesis Report. Contribution of Working Groups I, II and III to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change. Geneva: IPCC, 2014. Available on IPCC website March 21, 2021

[152] Liu S, Proudman J, Mitloehner F M. Rethinking methane from animal agriculture. CABI Agriculture and Bioscience, 2021, 2( 1): 22

[153] Allen M R, Shine K P, Fuglestvedt J S, Millar R J, Cain M, Frame D J, Macey A H. A solution to the misrepresentations of CO₂-equivalent emissions of short-lived climate pollutants under ambitious mitigation. NPJ Climate and Atmospheric Science, 2018, 1( 1): 16

[154] Eggleston S, Buendia L, Miwa K, Ngara T, Tanabe K. 2006 IPCC Guidelines for National Greenhouse Gas Inventories. Japan: IGES, 2006

[155] Aboagye I A, Beauchemin K A. Potential of molecular weight and structure of tannins to reduce methane emissions from ruminants: a review. Animals, 2019, 9( 11): 856

[156] Bodas R, Prieto N, García-González R, Andrés S, Giráldez F J, López S. Manipulation of rumen fermentation and methane production with plant secondary metabolites. Animal Feed Science and Technology, 2012, 176( 1−4): 78–93

[157] Martin C, Morgavi D P, Doreau M. Methane mitigation in ruminants: from microbe to the farm scale. Animal, 2010, 4( 3): 351–365

[158] Ramírez-Restrepo C A, Barry T N. Alternative temperate forages containing secondary compounds for improving sustainable productivity in grazing ruminants. Animal Feed Science and Technology, 2005, 120( 3−4): 179–201

[159] Bharanidharan R, Arokiyaraj S, Kim E B, Lee C H, Woo Y W, Na Y, Kim D, Kim K H. Ruminal methane emissions, metabolic, and microbial profile of Holstein steers fed forage and concentrate, separately or as a total mixed ration. PLoS One, 2018, 13( 8): e0202446

[160] Wallace R J. Antimicrobial properties of plant secondary metabolites. Proceedings of the Nutrition Society, 2004, 63( 4): 621–629

[161] Hatew B, Hayot Carbonero C, Stringano E, Sales L F, Smith L M J, Mueller-Harvey I, Hendriks W H, Pellikaan W F. Diversity of condensed tannin structures affects rumen in vitro methane production in sainfoin (Onobrychis viciifolia) accessions. Grass and Forage Science, 2015, 70( 3): 474–490

[162] Aboagye I A, Oba M, Castillo A R, Koenig K M, Iwaasa A D, Beauchemin K A. Effects of hydrolyzable tannin with or without condensed tannin on methane emissions, nitrogen use, and performance of beef cattle fed a high-forage diet. Journal of Animal Science, 2018, 96( 12): 5276–5286

[163] Chen L, Bao X, Guo G, Huo W, Xu Q, Wang C, Liu Q. Treatment of alfalfa silage with tannin acid at different levels modulates ensiling characteristics, methane mitigation, ruminal fermentation patterns and microbiota. Animal Feed Science and Technology, 2021, 278 : 114997

[164] Stewart E K, Beauchemin K A, Dai X, MacAdam J W, Christensen R G, Villalba J J. Effect of tannin-containing hays on enteric methane emissions and nitrogen partitioning in beef cattle. Journal of Animal Science, 2019, 97( 8): 3286–3299

[165] Niderkorn V, Copani G, Martin C, Maxin G, Torrent A, Anglard F, Rochette Y, Ginane C. Effects of including bioactive legumes in grass silage on digestion parameters, nitrogen balance and methane emissions in sheep. Grass and Forage Science, 2019, 74( 4): 626–635

[166] Sun X Z, Hoskin S O, Zhang G G, Molano G, Muetzel S, Pinares-Patiño C S, Clark H, Pacheco D. Sheep fed forage chicory (Cichorium intybus) or perennial ryegrass (Lolium perenne) have similar methane emissions. Animal Feed Science and Technology, 2012, 172( 3-4): 217–225

[167] Fraser M D, Fleming H R, Theobald V J, Moorby J M. Effect of breed and pasture type on methane emissions from weaned lambs offered fresh forage. Journal of Agricultural Science, 2015, 153( 6): 1128–1134

[168] Niderkorn V, Jayanegara A. Opportunities offered by plant bioactive compounds to improve silage quality, animal health and product quality for sustainable ruminant production: a review. Agronomy, 2021, 11( 1): 86

[169] Simon P L, de Klein C A M, Worth W, Rutherford A J, Dieckow J. The efficacy of Plantago lanceolata for mitigating nitrous oxide emissions from cattle urine patches. Science of the Total Environment, 2019, 691 : 430–441

[170] López-Aizpún M, Horrocks C A, Charteris A F, Marsden K A, Ciganda V S, Evans J R, Chadwick D R, Cárdenas L M. Meta-analysis of global livestock urine-derived nitrous oxide emissions from agricultural soils. Global Change Biology, 2020, 26( 4): 2002–2013

[171] Butterbach-Bahl K, Baggs E M, Dannenmann M, Kiese R, Zechmeister-Boltenstern S. Nitrous oxide emissions from soils: how well do we understand the processes and their controls. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 2013, 368( 1621): 20130122

[172] Dangal S R S, Tian H, Xu R, Chang J, Canadell J G, Ciais P, Pan S, Yang J, Zhang B. Global nitrous oxide emissions from pasturelands and rangelands: magnitude, spatiotemporal patterns, and attribution. Global Biogeochemical Cycles, 2019, 33( 2): 200–222

[173] Misselbrook T H, Powell J M, Broderick G A, Grabber J H. Dietary manipulation in dairy cattle: laboratory experiments to assess the influence on ammonia emissions. Journal of Dairy Science, 2005, 88( 5): 1765–1777

[174] van Groenigen J W, Kuikman P J, De Groot W J M, Velthof G L. Nitrous oxide emission from urine-treated soil as influenced by urine composition and soil physical conditions. Soil Biology & Biochemistry, 2005, 37( 3): 463–473

[175] Marsden K A, Lush L, Holmberg J A, Whelan M J, King A J, Wilson R P, Charteris A F, Cardenas L M, Jones D L, Chadwick D R. Sheep urination frequency, volume, N excretion and chemical composition: implications for subsequent agricultural N losses. Agriculture, Ecosystems & Environment, 2020, 302 : 107073

[176] Bristow A W, Whitehead D C, Cockburn J E. Nitrogenous constituents in the urine of cattle, sheep and goats. Journal of the Science of Food and Agriculture, 1992, 59( 3): 387–394

[177] Dijkstra J, Oenema O, van Groenigen J W, Spek J W, van Vuuren A M, Bannink A. Diet effects on urine composition of cattle and N₂O emissions. Animal, 2013, 7(Suppl 2): 292–302

[178] Gardiner C A, Clough T J, Cameron K C, Di H J, Edwards G R, de Klein C A M. Potential for forage diet manipulation in New Zealand pasture ecosystems to mitigate ruminant urine derived N₂O emissions: a review. New Zealand Journal of Agricultural Research, 2016, 59( 3): 301–317

[179] Huyen N T, Desrues O, Alferink S J J, Zandstra T, Verstegen M W A, Hendriks W H, Pellikaan W F. Inclusion of sainfoin (Onobrychis viciifolia) silage in dairy cow rations affects nutrient digestibility, nitrogen utilization, energy balance, and methane emissions. Journal of Dairy Science, 2016, 99( 5): 3566–3577

[180] Intergovernmental Panel on Climate Change (IPCC). Chapter 11: N₂O Emissions from Managed Soils, and CO₂ Emissions from Lime and Urea Application In: 2006 IPCC Guidelines for National Greenhouse Gas Inventories. IPCC, 2006, 11.1–11.48

[181] Cardenas L M, Misselbrook T M, Hodgson C, Donovan N, Gilhespy S, Smith K A, Dhanoa M S, Chadwick D. Effect of the application of cattle urine with or without the nitrification inhibitor DCD, and dung on greenhouse gas emissions from a UK grassland soil. Agriculture, Ecosystems & Environment, 2016, 235 : 229–241

[182] Misselbrook T, Fleming H, Camp V, Umstatter C, Duthie C A, Nicoll L, Waterhouse T. Automated monitoring of urination events from grazing cattle. Agriculture, Ecosystems & Environment, 2016, 230 : 191–198

[183] Tully K L, Abwanda S, Thiong’o M, Mutuo P M, Rosenstock T S. Nitrous oxide and methane fluxes from urine and dung deposited on Kenyan pastures. Journal of Environmental Quality, 2017, 46( 4): 921–929

[184] Chadwick D R, Cardenas L M, Dhanoa M S, Donovan N, Misselbrook T, Williams J R, Thorman R E, McGeough K L, Watson C J, Bell M, Anthony S G, Rees R M. The contribution of cattle urine and dung to nitrous oxide emissions: quantification of country specific emission factors and implications for national inventories. Science of the Total Environment, 2018, 635 : 607–617

[185] Forrestal P J, Krol D J, Lanigan G J, Jahangir M M R, Richards K G. An evaluation of urine patch simulation methods for nitrous oxide emission measurement. Journal of Agricultural Science, 2017, 155( 5): 725–732

[186] Hoogendoorn C J, Luo J, Lloyd-West C M, Devantier B P, Lindsey S B, Sun S, Pacheco D, Li Y, Theobald P W, Judge A. Nitrous oxide emission factors for urine from sheep and cattle fed forage rape (Brassica napus L.) or perennial ryegrass/white clover pasture (Lolium perenne L./Trifolium repens). Agriculture, Ecosystems & Environment, 2016, 227 : 11–23

[187] Hyde B P, Forrestal P J, Jahangir M M R, Ryan M, Fanning A F, Carton O T, Lanigan G J, Richards K G. The interactive effects of fertiliser nitrogen with dung and urine on nitrous oxide emissions in grassland. Irish Journal of Agricultural and Food Research, 2016, 55( 1): 1–9

[188] Krol D J, Carolan R, Minet E, McGeough K L, Watson C J, Forrestal P J, Lanigan G J, Richards K G. Improving and disaggregating N₂O emission factors for ruminant excreta on temperate pasture soils. Science of the Total Environment, 2016, 568 : 327–338

[189] O’Connor P J, Minogue D, Lewis E, Lynch M B, Hennessy D. Applying urine collected from non-lactating dairy cows dosed with dicyandiamide to lysimeters and grass plots: Effects on nitrous oxide emissions, nitrate leaching and herbage production. Journal of Agricultural Science, 2016, 154( 4): 674–688

[190] Pelster D E, Gisore B, Goopy J, Korir D, Koske J K, Rufino M C, Butterbach-Bahl K. Methane and nitrous oxide emissions from cattle excreta on an East African grassland. Journal of Environmental Quality, 2016, 45( 5): 1531–1539

[191] Thomas B W, Gao X, Beck R, Hao X. Are distinct nitrous oxide emission factors required for cattle urine and dung deposited on pasture in western Canada. Environmental Science and Pollution Research International, 2017, 24( 33): 26142–26147

[192] Yamulki S, Jarvis S C, Owen P. Nitrous oxide emissions from excreta applied in a simulated grazing pattern. Soil Biology & Biochemistry, 1998, 30( 4): 491–500

[193] Balvert S F, Luo J, Schipper L A. Do glucosinolate hydrolysis products reduce nitrous oxide emissions from urine affected soil? Science of the Total Environment, 2017, 603–604: 370–380

[194] Di H J, Cameron K C, Podolyan A, Edwards G R, de Klein C A M, Dynes R, Woods R. The potential of using alternative pastures, forage crops and gibberellic acid to mitigate nitrous oxide emissions. Journal of Soils and Sediments, 2016, 16( 9): 2252–2262

[195] Galbally I E, Meyer M C P, Wang Y P, Smith C J, Weeks I A. Nitrous oxide emissions from a legume pasture and the influences of liming and urine addition. Agriculture, Ecosystems & Environment, 2010, 136( 3−4): 262–272

[196] Marsden K A, Jones D L, Chadwick D R. The urine patch diffusional area: an important N₂O source. Soil Biology & Biochemistry, 2016, 92 : 161–170

[197] Owens J, Clough T J, Laubach J, Hunt J E, Venterea R T. Nitrous oxide fluxes and soil oxygen dynamics of soil treated with cow urine. Soil Science Society of America Journal, 2017, 81( 2): 289–298

[198] Owens J, Clough T J, Laubach J, Hunt J E, Venterea R T, Phillips R L. Nitrous oxide fluxes, soil oxygen, and denitrification potential of urine- and non-urine-treated soil under different irrigation frequencies. Journal of Environmental Quality, 2016, 45( 4): 1169–1177

[199] van der Weerden T J, Styles T M, Rutherford A J, de Klein C A M, Dynes R. Nitrous oxide emissions from cattle urine deposited onto soil supporting a winter forage kale crop. New Zealand Journal of Agricultural Research, 2017, 60( 2): 119–130

[200] Loick N, Dixon E, Abalos D, Vallejo A, Matthews P, McGeough K, Watson C, Baggs E M, Cardenas L M. “Hot spots” of N and C impact nitric oxide, nitrous oxide and nitrogen gas emissions from a UK grassland soil. Geoderma, 2017, 305 : 336–345

[201] Allen A G, Jarvis S C, Headon D M. Nitrous oxide emissions from soils due to inputs of nitrogen from excreta return by livestock on grazed grassland in the U.K. Soil Biology & Biochemistry, 1996, 28( 4−5): 597–607

[202] Liu R, Hayden H L, Hu H, He J, Suter H, Chen D. Effects of the nitrification inhibitor acetylene on nitrous oxide emissions and ammonia-oxidizing microorganisms of different agricultural soils under laboratory incubation conditions. Applied Soil Ecology, 2017, 119 : 80–90

[203] Edwards G R, Bryant R H, Smith N, Hague H, Taylor S, Ferris A, Farrell L. Milk production and urination behaviour of dairy cows grazing diverse and simple pastures. Proceedings of the New Zealand Society of Animal Production, 2015, 75 : 79–83

[204] Woodward S L, Waugh C D, Roach C G, Fynn D, Phillips J. Are diverse species mixtures better pastures for dairy farming. Proceedings of the New Zealand Grassland Association, 2013, 75 : 79–84

[205] Woodward S L, Waghorn G C, Bryant M A, Benton A. Can diverse pasture mixtures reduce nitrogen losses? In: Proceedings of the 5th Australasian Dairy Science Symposium. Tallygaroopna: Australasian Dairy Science Symposium, 2012, 463–464

[206] Coles G C. Anthelmintic resistance—looking to the future: a UK perspective. Research in Veterinary Science, 2005, 78( 2): 99–108

[207] ADAS. Economic Impact of Health and Welfare Issues in Beef Cattle and Sheep in England. UK: ADAS, 2011

[208] Hoste H, Torres-Acosta J F J. Non chemical control of helminths in ruminants: adapting solutions for changing worms in a changing world. Veterinary Parasitology, 2011, 180( 1−2): 144–154

[209] Lazarus M, Rogers W P. The mode of action of phenothiazine as an anthelmintic; the uptake of 35S-labelled phenothiazine by the tissues of nematode parasites and their hosts. Australian Journal of Scientific Research, Series B: Biological Sciences, 1951, 4( 2): 163–179

[210] AHDB. Worm Control in Sheep for Better Returns. UK: AHDB Beef and Sheep, 2013

[211] Marley C L, Cook R, Keatinge R, Barrett J, Lampkin N H. The effect of birdsfoot trefoil (Lotus corniculatus) and chicory (Cichorium intybus) on parasite intensities and performance of lambs naturally infected with helminth parasites. Veterinary Parasitology, 2003, 112( 1−2): 147–155

[212] Roeber F, Jex A R, Gasser R B. Impact of gastrointestinal parasitic nematodes of sheep, and the role of advanced molecular tools for exploring epidemiology and drug resistance—an Australian perspective. Parasites & Vectors, 2013, 6( 1): 153

[213] Knight T L, Moss R A, Fraser T J, Rowarth J S, Burton R N. Effect of pasture species on internal parasites of lambs. Proceedings of the New Zealand Grassland Association, 1996, 58 : 59–62

[214] French K E. Plant-based solutions to global livestock anthelmintic resistance. Ethnobiology Letters, 2018, 9( 2): 110–123

[215] Alomar D, Ruiz P, Balocchi O, Valenzuela G, Goic D. Finishing lambs on a chicory-plantain mixture or a temperate grass-based pasture: live weight gain and gastrointestinal parasitism. Agrarian Science and Research, 2018, 45( 1): 11–20

[216] Corner-Thomas R A, Cranston L M, Kemp P D, Morris S T, Kenyon P R. The performance of single-rearing ewes and their lambs offered ryegrass pasture or herb−clover mix during lactation. New Zealand Journal of Agricultural Research, 2018, 61( 1): 67–80

[217] Somasiri S C, Kenyon P R, Kemp P D, Morel P C H, Morris S T. Mixtures of clovers with plantain and chicory improve lamb production performance compared to a ryegrass-white clover sward in the late spring and early summer period. Grass and Forage Science, 2016, 71( 2): 270–280

[218] Corner-Thomas R A, Cranston L M, Kemp P D, Morris S T, Kenyon P R. The influence of three herbage types on the liveweight change of twin-bearing hoggets and their lambs. New Zealand Journal of Agricultural Research, 2020, 63( 3): 365–378

[219] Kenyon P R, Morel P C H, Corner-Thomas R A, Perez H L, Somasiri S C, Kemp P D, Morris S T. Improved per hectare production in a lamb finishing system using mixtures of red and white clover with plantain and chicory compared to ryegrass and white clover. Small Ruminant Research, 2017, 151 : 90–97

[220] Taylor B R, Younie D, Matheson S, Coutts M, Mayer C, Watson C A, Walker R L. Output and sustainability of organic ley/arable crop rotations at two sites in northern Scotland. Journal of Agricultural Science, 2006, 144( 5): 435–447

[221] Agricultural Industries Confederation (AIC). AIC Fertilizer Statistics Report 2019. UK: AIC, 2019

[222] Cougnon M, Van Den Berge K, D’Hose T, Clement L, Reheul D. Effect of management and age of ploughed out grass-clover on forage maize yield and residual soil nitrogen. Journal of Agricultural Science, 2018, 156( 6): 748–757

[223] Alloway B J. Micronutrients and Crop Production: An Introduction. In: Alloway B J, eds. Micronutrient deficiencies in global crop production. Dordrecht: Springer, 2008, 1–39

[224] Gupta U C, Wu K, Liang S. Micronutrients in soils, crops, and livestock. Earth Science Frontiers, 2008, 15( 5): 110–125

[225] Ritchie H, Reay D S, Higgins P. Quantifying, projecting, and addressing India’s hidden hunger. Frontiers in Sustainable Food Systems, 2018, 2 : 11

[226] Fisher G E J. Micronutrients and animal nutrition and the link between the application of micronutrients to crops and animal health. Turkish Journal of Agriculture and Forestry, 2008, 32( 3): 221–233

[227] Lindström B E M, Frankow-Lindberg B E, Dahlin A S, Wivstad M, Watson C A. Micronutrient concentrations in common and novel forage species and varieties grown on two contrasting soils. Grass and Forage Science, 2013, 68( 3): 427–436

[228] Pirhofer-Walzl K, Søegaard K, Høgh-Jensen H, Eriksen J, Sanderson M A, Rasmussen J, Rasmussen J. Forage herbs improve mineral composition of grassland herbage. Grass and Forage Science, 2011, 66( 3): 415–423

[229] Smith L G, Kirk G J D, Jones P J, Williams A G. The greenhouse gas impacts of converting food production in England and Wales to organic methods. Nature Communications, 2019, 10( 1): 4641

Acknowledgements

This work was supported by funding provided by the UK Biotechnology and Biological Sciences Research Council under the Sustainable Agriculture Research and Innovation Club (SARIC) program (BB/R021716/1). We thank the two anonymous reviewers for their extremely helpful comments that helped to improve this manuscript.

Compliance with ethics guidelines

Emily C. Cooledge, David R. Chadwick, Lydia M. J. Smith, Jonathan R. Leake, and Davey L. Jones declare that they have no conflicts of interest or financial conflicts to disclose. This article does not contain any study with human or animal subjects performed by any of the authors.

RIGHTS & PERMISSIONS

The Author(s) 2022. Published by Higher Education Press. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0)