PtHAK5, a candidate for mediating high-affinity K⁺ uptake in the halophytic grass, Puccinellia tenuiflora

Abstract

Puccinellia tenuiflora is a typical salt-exclu-ding halophytic grass with strong salt-tolerance, which enhances tolerance by restricting Na⁺ influx as well as having a strong selectivity for K⁺ over Na⁺. The HAK5 K⁺ transporters generally modulate effective K⁺ acquisition in plants, especially under low K⁺ condition. In this study, PtHAK5 from P. tenuiflora was isolated by RT-PCR and characterized using yeast complementation. The results showed PtHAK5 consisted of 784 amino acids and shared over 80% homology with the identified high-affinity K⁺ transporter HAK5 from other higher plants. The expression of PtHAK5 rescued the K⁺-uptake-defective phenotype of yeast strain CY162. In conclusion, PtHAK5 is a candidate for mediating high-affinity K⁺ uptake under low K⁺ conditions.

Keywords

K⁺ uptake / PtHAK5 / Puccinellia tenuiflora / yeast complementation

1 Introduction

As a necessary, abundant and valuable mineral element, potassium is indispensable to growth and of plants, contributing to activation of a substantial number of enzymes, and other major physiological and biochemical processes^[1]. Among all the cationic components of the cell, K⁺ is the most abundant^[2,3] which accounts for 8% of plant dry weight^[4]. Despite potassium being an abundant element in the earth’s crust, only small quantities are present in the soil solution to be absorbed by plants. In general, since plants rapidly absorb nutrients, the actual concentration of K⁺ at the root surface of a plant is lower than it in the bulk soil solution, usually down to the micromolar range^[5]. To maintain adequate K⁺ concentrations under low K⁺ conditions, plants have complex mechanisms for obtaining K⁺ from soil. Previous studies have revealed that the KT/KUP/HAK family has an irreplaceable role in K⁺ transport in plants^[6]. The members of the KT/KUP/HAK family were initially cloned from Arabidopsis thaliana and Hordeum vulgare (barley). They have since been found in a substantial number of other plant species and are considered essential to maintaining K⁺ homeostasis in plants^[5]. The members of the KT/KUP/HAK family are classified into four clusters (I–IV)^[7]. Members of cluster I mediate high-affinity K⁺ transport, such as AtHAK5, OsHAK1 and OsHAK5^[8]. The sequences and functions of proteins in cluster II vary widely, e.g., AtKUP1 mediates high- and low-affinity K⁺ transport^[9], while other members merely mediate low-affinity K⁺ transport, e.g., HvHAK2^[10] and CnHAK1^[11]. Also, OsHAK2 preferentially mediates Na⁺ transport rather than K⁺ transport^[12]. At present, the proteins of cluster III and IV are not well characterized^[13]. Nieves-Cordones et al.^[14] assumed that inward-rectifying K⁺ channel AKT1 and high-affinity K⁺ transporter mediate K⁺ uptake synergistically under low K⁺ conditions (100 µmol·L⁻¹). However, it is import to recognize that HAK5 is the only system that participates in K⁺ uptake when the concentration of external K⁺ is exceedingly low (10 µmol·L⁻¹). Yang et al.^[8] also conclude that OsHAK5 is of immense importance in K⁺ acquisition by roots faced with low external K⁺ and in upward K⁺ transport from roots to shoots in K⁺-deficient rice plants. Therefore, members of HAKs are of great importance in K⁺ uptake.

Puccinellia tenuiflora is an excellent halophytic grass with strong salt-tolerance widely distributed in the saline-alkali soil of northern regions of China^[15,16]. As a typical salt-excluding halophytic grass, P. tenuiflora maintains higher K⁺ content and a higher K⁺/Na⁺ ratio in shoots to enhance salt tolerance under salinity^[15–17]. However, information about the molecular mechanism underlying K⁺ transport in P. tenuiflora is scarce.

We cloned PtHAK5 from P. tenuiflora by reverse transcription-polymerase chain reaction (RT-PCR) and then undertook a preliminarily demonstration of the function of PtHAK5 in mediating K⁺ uptake using expression test in yeast.

2 Materials and methods

2.1 Plant materials, growth conditions and treatments

Seeds of P. tenuiflora were collected from Yuzhong Campus of Lanzhou University, China. Surface-sterilized plump seeds were germinated in the dark on hydroponic culture wire gauze covered evenly with tissue paper in rectangular trays filled with distilled water. The distilled water was replaced with modified Hoagland nutrient solution (5 mmol·L⁻¹ KNO₃, 1.5 mmol·L⁻¹ Ca(NO₃)₂·4H₂O, 0.5 mmol·L⁻¹ NH₄H₂PO₄, 0.5 mmol·L⁻¹ Fe-citrate, 0.25 mmol·L⁻¹ MgSO₄₂·7H₂O, 92 µmol·L⁻¹ H₃BO₃, 18 µmol·L⁻¹ MnCl₂·4H₂O, 1.6 µmol·L⁻¹ ZnSO₄₂·7H₂O, 0.7 µmol·L⁻¹ (NH₄)₆Mo₇O₂₄·4H₂O, 0.6 µmol·L⁻¹ CuSO₂·5H₂O) and renewed every 3 d after germination was consistent. Seedlings were cultivated in a greenhouse with day and night temperatures of 28±2°C and 23±2°C, 16L:8D h photoperiod with flux density about 600 µmol·m⁻²·s⁻¹ and 60%–80% RH. The treatment solutions were changed once per day to maintain a constant ion concentration.

2.2 Bacteria and yeast strains

Escherichia coli DH5a competent cells were purchased from TransGen Biotech (Beijing, China). Functional complementation assays were carried out with K⁺ transporter-deficient (TRK1 and TRK2) Saccharomyces cerevisiae CY162 (MATa, Dtrk1, trk2:: pCK64, his3, leu2, ura3, trp1, ade2)^[18], in which growth is repressed when the K⁺ concentration is below 7 mmol·L^−1[19] and G19 (MATa, his3, leu2, ura3, trp1, ade2, ena1:: HIS3:: ena4), which has disrupted ENA1-4 genes encoding Na⁺ export pumps^[20].

2.3 Cloning the 3′-and 5′-end fragments of PtHAK5 gene

Four-week-old seedlings were submitted to K starvation treatment for 7 d and subsequently irrigated with modified Hoagland nutrient solution containing 0.01 mmol·L⁻¹ KCl for 6 h. Total RNA was extracted from roots of treated seedlings using the TRIzol reagent (Sangon, Biotech Co., Ltd, Shanghai, China) according to the manufacturer’s instructions. The first strand cDNA of 5′- and 3′-end fragments were synthesized from high purity total RNA following the manufacturer’s protocol for the 5′ RACE Kit (catalog nos. 634923 and 634924) and the 3′ RACE Kit (catalog no. L1500-01), respectively. 5′- and 3′-end fragment-specific primers were designed using DNAMAN 6.0 (Lynnon Biosoft, Qc, Canada) and Primer 5.0 software (Premier Biosoft International, Palo Alto, CA, USA), respectively. The 5′-end exon and nested fragments were amplified using 5′-end exon specific primer P1 (Table 1) and nested specific primer P2 (Table 1) paired with 5′-end primer and 5′-end nested primer provided in the GeneRacer^TM kit (Invitrogen™, USA), respectively. Similarly, the 3′-end exon and nested fragments were amplified using 3′-end exon specific primer P3 (Table 1) and nested specific primer P4 (Table 1) paired with 3′-end primer and 3′-end nested primer, respectively. PCR amplification was performed using 50 µL PCR with the following cycling profile: initial DNA denaturation at 98°C for 30 s, followed by 30 cycles of amplification (denaturation at 98°C for 10 s; primer annealing at 58°C for 5′-end and 60°C for 3′-end) for 30 s and primer extension at 72°C for 40 s, and a final extension at 72°C for 10 min. All gene-specific primers for RT-PCR were designed based on the sequences of the PtHAK5 fragment obtained from P. tenuiflora. RT-PCR products were detected and purified from 1.2% agarose gel electrophoresis and subsequently ligated into pMD19-T (simple) vector, followed by transformation of E. coli DH5a. Then PCR products were screened by blue and white spots in LB liquid medium containing ampicillin (100 µg·mL⁻¹), confirmed by agarose gel electrophoresis, and the positive clones were selected and sequenced by Sangon (Shanghai, China).

Tab.1 Primers used in this work

Primers	Sequences
P1	GTTGTTTGACACTTTGTTCTTGAGC
P2	AAATCGCTGAACAAGAAAGAGGAC
P3	TCGTGTCATCCACACTTCAAAAAC
P4	GCAATATAGAAACAAACGAACGGTTCC
P5	TGCTCTAGAATGGCTGAGCCTCTGAA
P6	GGACCCGGGCTAGATCTCATATGTCAT

2.4 Sequence and phylogenetic analysis

The sequences of PtHAK5 gene fragment were used for BLAST search on the NCBI^[21] against sequences from GeneBank^[22] and the predicted amino acid sequence were obtained. The translation and open reading frame (ORF) of PtHAK5 gene sequence was analyzed by the DNAMAN 6.0 software. Sequence alignments with homologous amino acid sequence were performed using BioEdit software (Tom Hall, Ibis Biosciences, Carlsbad, CA). Prediction of transmembrane regions of TMHMM amino acids was accomplished with online biology platform^[23]. The phylogenetic tree was constructed by the MEGA 6.0^[24] software using the maximum-likelihood method.

2.5 Plasmid construction

The cDNA fragment containing the ORF of PtHAK5 was verified using ORF Finder software^[25]. Upstream specific primer P5 (Table 1) (containing restriction site XbaI) and downstream specific primers P6 (Table 1) (containing SmaI restriction site) were designed at the beginning and end by Primer 5.0 and DNAMAN program, respectively. The ORF of PtHAK5 was amplified by RT-PCR under the following conditions: 98°C for 30 s; 30 cycles of 98°C for 10 s, 55°C for 30 s and 72°C for 40 s; and a final extension at 72°C for 10 min. Constructing PtHAK5 vectors after the sequences of the PtHAK5 ORF were verified and calibrated. The resulting products were ligated into a yeast expression vector p416 GPD with ampicillin resistance^[26] using T4DNA restriction endonuclease, transferred to E. coli DH5a and positive clones identified by ampicillin, obtained by PCR and sent to Sangon (Shanghai, China) for sequencing. Matched vectors p416-PtHAK5, p416-AtAKT1 and p416-AtHKT1;1 were used as positive controls.

2.6 Yeast complementation

Yeast transformations with p416-PtHAK5, p416-AtAKT1 and p416-AtHKT1;1 were accomplished using LiAc as described by Chen et al.^[27]. Positive monoclonal strains were selected in liquid uracil-free selective medium (0.67% w/v yeast nitrogen base without amino acids, 2% w/v dropout supplement without uracil, 20 g·L⁻¹ glucose and 100 mmol·L⁻¹ KCl). Yeast cells were plated on medium using 10-fold serial dilutions from OD₆₀₀ = 0.5 to 0.5 × 10⁻³. The CY162 strain transformed with plasmids and without an insert were cultured in arginine-phosphate (AP) medium (0.77 g·L⁻¹ dropout supplement without uracil, 10 mmol·L⁻¹ L-arginine, 2% w/v glucose, 0.2 mmol·L⁻¹ CaCl₂, 2 mmol·L⁻¹ MgSO₄, 8 mmol·L⁻¹ H₃PO₄, plus vitamins and trace elements, and 2% w/v agar powder, pH 6.5)^[28] containing different concentrations of K⁺ (0.1, 2, 10 or 100 mmol·L⁻¹) in the order of dilution from low to high. The G19 strain transformed with plasmids and without an insert were suspended in liquid AP medium with added K⁺ (1 mmol·L⁻¹) and supplemented with various concentrations of Na⁺ (0, 25, 50 or 75 mmol·L⁻¹). Yeast cells were incubated at 28°C for 48 h.

3 Results

3.1 Isolation and characterization of PtHAK5

The full-length sequence of PtHAK5 (Fig. 1) was 2880 bp with a 5′-untranslated region (UTR) of 111 nucleotides, and a predicted ORF of 2355 nucleotides encoding 784 amino acids and a 3′-UTR of 414 nucleotides. The predicted amino acid sequence has 11 highly conserved transmembrane regions (Fig. 2). We designated this gene as PtHAK5, i.e., HAK5 gene from P. tenuiflora.

Fig.1 The nucleic acid sequence and encoded amino acid sequence of PtHAK5 in Puccinellia tenuiflora. The full-length PtHAK5 sequence was used for BLAST search on the NCBI platform with sequences acquired from GenBank. The 2880 bp contained a 5′-untranslated region of 111 bp nucleotides, a predicted ORF of 2355 bp nucleotides encoding 784 amino acids and a 3′-untranslated region with 414 bp nucleotides.

Full size|PPT slide

Fig.2 Transmembrane domain prediction for PtHAK5 from Puccinellia tenuiflora. There are 11 highly conservative transmembrane domains predicted by TMHMM online biology platform. The abscissa indicates the amino acid site and contains a total of 784 amino acids.

Full size|PPT slide

The result of multiple sequence alignment indicated that PtHAK5 shared high similarity with other HAK sequences previously characterized in higher plants (Fig. 3). The amino acid sequence identity to OstHAK5 from Oryza sativa and ZmHAK5 from Zea mays was 86.1% and 81.9%, respectively. PtHAK5 also shared homology with SlHAK5 from Solanum lycopersicum (56.2%) and AtHAK5 from A. thaliana (54.7%) (Fig. 4). The phylogenetic tree results revealed that PtHAK5 belonged to a subcluster of the KT/HAK/KUP family known as cluster I, in the same clade as OsHAK5. Thus, PtHAK5 and OsHAK5 have a close evolutionary relationship (Fig. 5).

Fig.3 Sequence alignment of PtHAK5 and HAK5-like proteins from higher plants. Sources of HAK5 and their GenBank accession numbers were as follows: OsHAK5 (Oryza sativa, BAD87321.1), ZmHAK5 (Zea mays, AHH35045.1), SlHAK5 (Solanum lycopersicum, ABF22603.1), AtHAK5 (Arabidopsis thaliana, AT4G13420). The sequences were aligned with DNAMAN 6.0 software. The 11 putative transmembrane domains (TM1–TM11) are underlined.

Full size|PPT slide

Fig.4 Phylogenetic tree analysis of PtHAK5 amino acid sequences. AtHAK5 from Arabidopsis thaliana, SlHAK5 from Solanum lycopersicum, OsHAK5 from Oryza sativa, ZmHAK5 from Zea mays.

Full size|PPT slide

Fig.5 Phylogenetic tree analysis of PtHAK5 and HAK/KUP/KT family members from Arabidopsis thaliana and Oryza sativa (rice). The phylogenetic tree was generated by MEGA 6.0 software using the maximum-likelihood method. Sources of K+ transporter amino acid sequence and their GenBank accession numbers are as follows: in A. thaliana, AtKUP1 (AT2G30070), AtKUP2 (AT2G40540), AtKUP3 (AT3G02050), AtKUP4 (AT4G23640), AtKUP5 (AT4G33530), AtKUP6 (AT1G70300), AtKUP7 (AT5G09400), AtKUP8 (AT5G14880), AtKUP9 (AT4G19960), AtKUP10 (AT1G31120), AtKUP11 (AT2G35060), AtKUP12 (AT1G60160), AtHAK5 (AT4G13420); and in O. sativa, OsHAK1 (NC_008397), OsHAK2 (BAF07234), OsHAK3 (AJ427974), OsHAK4 (AK071698), OsHAK5 (AP003272), OsHAK6 (NP_001045298), OsHAK7 (AJ427976), OsHAK8 (Q8VXB5), OsHAK9 (AJ427978), OsHAK10 (AJ427979), OsHAK11 (AJ427980), OsHAK12 (AJ427981), OsHAK13 (BAF20244), OsHAK14 (AJ427983), OsHAK15 (AJ427984), OsHAK16 (BAF12444), OsHAK17 (AJ427975), OsHAK18 (NP_001063938), OsHAK19 (BAF08880), OsHAK20 (BAF08882), OsHAK21 (BAH92235), OsHAK22 (EEC81370), OsHAK23 (BAF24960), OsHAK24 (BAF19271), OsHAK25 (EEC73938), OsHAK26 (BAF24119), OsHAK27 (BAF12443).

Full size|PPT slide

3.2 PtHAK5 mediates K⁺ uptake in yeast cells

CY162 is a K⁺-uptake-deficient yeast mutant deficient in the two K⁺ transporters, TRK1 and TRK2^[18]. Arabidopsis AtAKT1 was able to complement the growth of yeast trk1Δ trk2Δ mutant under low K⁺ concentration by restoring the K⁺ uptake capacity of the yeast cells^[29]. To ascertain whether PtHAK5 is involved in K⁺ uptake, we expressed PtHAK5 and AtAKT1, AtHKT1;1 (as positive control) in CY162 (Fig. 6). All of the yeast transformants grew adequately and uniformly on the AP medium with high concentration of K⁺ (10 or 100 mmol·L⁻¹). However, CY162 transformed with empty p416 GPD and p416 AtHKT1;1 did not grow on the 2 mmol·L⁻¹ K⁺ and low-K⁺ 0.1 mmol·L⁻¹ medium after incubation for 48 h. Thus, the expression of PtHAK5 as well as AtAKT1 permitted CY162 cells to grow (Fig. 6) but p416-PtHAK5 transformants gave significantly weaker growth than p416-AtAKT1 transformants. In short, both p416-PtHAK5 and p416-AtAKT1 could rescue the growth defect of CY162, and mediate K⁺ uptake under low-K⁺ conditions. The lower ability of PtHAK5 to promote growth suggests that it may be less effective at restoring K⁺ uptake than AtAKT1.

Fig.6 Complementation of the K+ uptake-deficient Saccharomyces cerevisiae mutant strain CY162 by expressing PtHAK5, AtAKT1, AtHKT1;1 and empty vector p416 GPD. Each yeast cell was plated on minimal AP medium containing four concentrations of K+ (0.1, 2, 10 and 100 mmol·L−1) at 10-fold serial dilutions from OD600 = 0.6 to 0.6 × 10−3. AP medium with 100 mmol·L−1 K+ was used as a control, and CY162 expressing AtAKT1, AtHKT1;1 and p416 GPD were used as positive and negative controls, respectively. The triangles indicate that the cell concentration was diluted 10-fold from left to right.

Full size|PPT slide

3.3 PtHAK5 does not participated in Na⁺ transport in yeast cells

The Na⁺ transport activity of PtHAK5 was tested by transforming empty p416 GPD vector, p416-PtHAK5 and p416-AtAKT1, p416-AtHKT1;1 into a yeast mutant strain G19 (Fig. 7) which displays higher sensitivity to Na⁺ than the wild-type as a result of disruptions in genes ENA1 to ENA4 encoding Na⁺-extruding ATPase^[20]. Since AtHKT1;1 conferred increased Na⁺ sensitivity on G19 by mediating Na⁺ uptake^[30], we used AtHKT1;1 as a positive control for analyzing Na⁺ uptake. All the yeast cells grew equally well on the Na⁺-free control AP medium (Fig. 7). With the increasing Na⁺ concentration, the growth of G19 strains transformed with p416-PtHAK5 and empty p416 GPD vector were slightly weakened under high-Na⁺ conditions (50 or 75 mmol·L⁻¹), but their growth was almost uniform. These observations suggest that the expression of PtHAK5 does not enhance the Na⁺ sensitivity of yeast mutant G19, which is deficient in Na⁺-extrusion.

Fig.7 Na+-induced growth-inhibition of Saccharomyces cerevisiae mutant strain G19 expressing PtHAK5, AtAKT1, At HKT1;1 and empty vector p416 G19. Yeast cells were plated on minimal AP medium containing 1 mmol·L−1 K+ and various concentrations of Na+ (0, 25, 50 and 75 mmol·L−1) at 10-fold serial dilutions from OD600 = 0.6 to 0.6 × 10−3. AP medium without Na+ was used as a control, and G19 expressing AtHKT1;1, AtAKT1 and p416 GPD were used as positive and negative controls, respectively. The triangles indicate that the cell concentration was diluted 10-fold from left to right.

Full size|PPT slide

4 Discussion

4.1 PtHAK5 encodes a high-affinity K⁺ transporter in Puccinellia tenuiflora

The KT/KUP/HAK family includes 27 transporters from O. sativa and 13 transporters from A. thaliana^[7,19]. In this study, the phylogenetic analysis of PtHAK5 and 40 proteins of the KT/KUP/HAK family from A. thaliana and O. sativa showed that PtHAK5 and OsHAK5 fall within the same clade, suggesting that PtHAK5 may have a similar function to OsHAK5. Su et al.^[30] reported that the proteins from A. thaliana and O. sativa in this family have 10–14 transmembrane domains and a longer cytoplasmic loop structure between the second and third transmembrane domains. In this study, we found that PtHAK5 also contains 11 transmembrane regions (Fig. 2). This result is consistent with the report of Su et al.^[31]. Currently it is thought that the sequences of the genes in the KT/KUP/HAK family do not have a completely consistent conserved domains, but overall they have relatively conservative amino acid sequences. The characteristic feature of HAK transporters has been the presence of the consensus motif, GVVYGDLGTSPLY, found in all members of this family^[32]. In present study, the results showed that PtHAK5 also contains the very similar amino acid sequence, GVVYGDMGTSPLY (Fig. 3). This evidence indicates that PtHAK5 is a member of the KT/KUP/HAK family, and thus might encode a high-affinity K⁺ transporter.

4.2 PtHAK5 has a potential role in mediating K⁺ uptake in Puccinellia tenuiflora

The function of proteins in the KT/KUP/HAK family has in most cases been identified by heterologous expression. Some transporters in cluster I, such as AtHAK5, HvHAK1, OsHAK1 and OsHAK5, mediate high-affinity K⁺ uptake in yeast as well as E. coli^[3,33]. The members of the HAK family are all crucial in absorption of K⁺ in plants. In A. thaliana, the expression of AtHAK5 was upregulated by K⁺ starvation. Under low levels of K⁺ supply, the biomass accumulation of wild type yeast is much higher than the athak5 mutant, which implies that AtHAK5 is a major contributor to K acquisition in roots growing under low external K^+[34]. HAK also responds to salinity and expression of OsHAK5 in Nicotiana tabacum (tobacco) BY2 cells improved salt tolerance. Furthermore, the concentration of Na⁺ remained steady while the cells accumulated a large amount of K^+[12]. In ice plant (Mesembryanthemum crystallinum), HAK gene expression increased transiently under high salt conditions^[31]. Yang et al.^[8] also found that under normal K⁺ conditions, the expression of OsHAK5 in rice was markedly upregulated by high concentrations of NaCl in the rhizosphere, and OsHAK5 mediates accumulation of K⁺ in E. coli and BY2 cells under salt treatment^[12]. Thus, PtHAK5 could be of great significance in salt tolerance by participating in the maintenance of K⁺ nutrition in P. tenuiflora under salinity. This suggestion is supported by the fact that expression of PtHAK5 rescued the K⁺-uptake-defective phenotype of yeast strain CY162 under low-K⁺ medium (Fig. 6). Therefore, PtHAK5 is a potential candidate for mediating high-affinity K⁺ uptake.

5 Conclusions

The PtHAK5 gene of P. tenuiflora was grouped in cluster I of the KT/KUP/HAK family, which encodes high-affinity K⁺ transporters, and is a potential candidate for mediating high-affinity K⁺ uptake under low K⁺ concentrations. It is concluded that it is likely to be crucial for salt tolerance of P. tenuiflora by facilitating efficient K⁺ uptake under saline conditions.

References

[1] Anschütz U, Becker D, Shabala S. Going beyond nutrition: regulation of potassium homoeostasis as a common denominator of plant adaptive responses to environment. Journal of Plant Physiology, 2014, 171(9): 670–687

[2] Bañuelos M A, Klein R D, Alexander-Bowman S J, Rodríguez-Navarro A. A potassium transporter of the yeast Schwanniomyces occidentalis homologous to the Kup system of Escherichia coli has a high concentrative capacity. EMBO Journal, 1995, 14(13): 3021–3027

[3] Rubio F, Santa-María G E, Rodríguez-Navarro A. Cloning of Arabidopsis and barley cDNAs encoding HAK potassium transporters in root and shoot cells. Physiologia Plantarum, 2000, 109(1): 34–43

[4] Evans H J, Sorger G J. Role of mineral elements with emphasis on the univalent cations. Annual Review of Plant Physiology, 1966, 17(1): 47–76

[5] Ashley M K, Grant M, Grabov A. Plant responses to potassium deficiencies: a role for potassium transport proteins. Journal of Experimental Botany, 2006, 57(2): 425–436

[6] Gierth M, Mäser P. Potassium transporters in plants—involvement in K⁺ acquisition, redistribution and homeostasis. FEBS Letters, 2007, 581(12): 2348–2356

[7] Gupta M, Qiu X, Wang L, Xie W, Zhang C, Xiong L, Lian X, Zhang Q. KT/HAK/KUP potassium transporters gene family and their whole-life cycle expression profile in rice (Oryza sativa). Molecular Genetics and Genomics, 2008, 280(5): 437–452

[8] Yang T, Zhang S, Hu Y, Wu F, Hu Q, Chen G, Cai J, Wu T, Moran N, Yu L, Xu G. The role of a potassium transporter OsHAK5 in potassium acquisition and transport from roots to shoots in rice at low potassium supply levels. Plant Physiology, 2014, 166(2): 945–959

[9] Kim E J, Kwak J M, Uozumi N, Schroeder J I. AtKUP1: an Arabidopsis gene encoding high-affinity potassium transport activity. Plant Cell, 1998, 10(1): 51–62

[10] Senn M E, Rubio F, Bañuelos M A, Rodríguez-Navarro A. Comparative functional features of plant potassium HvHAK1 and HvHAK2 transporters. Journal of Biological Chemistry, 2001, 276(48): 44563–44569

[11] Garciadeblas B, Benito B, Rodríguez-Navarro A. Molecular cloning and functional expression in bacteria of the potassium transporters CnHAK1 and CnHAK2 of the seagrass Cymodocea nodosa. Plant Molecular Biology, 2002, 50(4-5): 623–633

[12] Horie T, Brodsky D E, Costa A, Kaneko T, Lo Schiavo F, Katsuhara M, Schroeder J I K. K⁺ transport by the OsHKT2;4 transporter from rice with atypical Na⁺ transport properties and competition in permeation of K⁺ over Mg²⁺ and Ca²⁺ ions. Plant Physiology, 2011, 156(3): 1493–1507

[13] Grabov A. Plant KT/KUP/HAK potassium transporters: single family-multiple functions. Annals of Botany, 2007, 99(6): 1035–1041

[14] Nieves-Cordones M, Alemán F, Martínez V, Rubio F. K⁺ uptake in plant roots. The systems involved, their regulation and parallels in other organisms. Journal of Plant Physiology, 2014, 171(9): 688–695

[15] Wang S, Zhao G, Gao Y, Tang Z, Zhang C. Puccinellia tenuiflora exhibits stronger selectivity for K⁺ over Na⁺ than wheat. Journal of Plant Nutrition, 2004, 27(10): 1841–1857

[16] Wang C M, Zhang J L, Liu X S, Li Z, Wu G Q, Cai J Y, Flowers T J, Wang S M. Puccinellia tenuiflora maintains a low Na⁺ level under salinity by limiting unidirectional Na⁺ influx resulting in a high selectivity for K⁺ over Na⁺. Plant, Cell & Environment, 2009, 32(5): 486–496

[17] Zhu J K. Regulation of ion homeostasis under salt stress. Current Opinion in Plant Biology, 2003, 6(5): 441–445

[18] Anderson J A, Huprikar S S, Kochian L V, Lucas W J, Gaber R F. Functional expression of a probable Arabidopsis thaliana potassium channel in Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America, 1992, 89(9): 3736–3740

[19] Mäser P, Thomine S, Schroeder J I, Ward J M, Hirschi K, Sze H, Talke I N, Amtmann A, Maathuis F J M, Sanders D, Harper J F, Tchieu J, Gribskov M, Persans M W, Salt D E, Kim S A, Guerinot M L. Phylogenetic relationships within cation transporter families of Arabidopsis. Plant Physiology, 2001, 126(4): 1646–1667

[20] Quintero F J, Garciadeblás B, Rodríguez-Navarro A. The SAL1 gene of Arabidopsis, encoding an enzyme with 3′(2′),5′-bisphosphate nucleotidase and inositol polyphosphate 1-phosphatase activities, increases salt tolerance in yeast. Plant Cell, 1996, 8(3): 529–537

[21] BLAST—a gene sequence alignment tool of NCBI platform. NCBI-BLAST service, available on January 2, 2016

[22] GeneBank, the NIH genetic sequence database. NCBI-GeneBank service, available on January 6, 2016

[23] TMHMM—a software used to predict transmembrane helices of integral membrane proteins. CBS-TMHMM service, available on January 14, 2016

[24] Tamura K, Dudley J, Nei M, Kumar S. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution, 2007, 24(8): 1596–1599

[25] ORF finder searches for open reading frames (ORFs) in the DNA sequence. NCBI-ORFfinder service, available on January 10, 2016

[26] Mumberg D, Müller R, Funk M. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene, 1995, 156(1): 119–122

[27] Chen D C, Yang B C, Kuo T T. One-step transformation of yeast in stationary phase. Current Genetics, 1992, 21(1): 83–84

[28] Rodríguez-Navarro A, Ramos J. Dual system for potassium transport in Saccharomyces cerevisiae. Journal of Bacteriology, 1984, 159(3): 940–945

[29] Sentenac H, Bonneaud N, Minet M, Lacroute F, Salmon J M, Gaymard F, Grignon C. Cloning and expression in yeast of a plant potassium ion transport system. Science, 1992, 256(5057): 663–665

[30] Uozumi N, Kim E J, Rubio F, Yamaguchi T, Muto S, Tsuboi A, Bakker E P, Nakamura T, Schroeder J I. The Arabidopsis HKT1 gene homolog mediates inward Na⁺ currents in xenopus laevis oocytes and Na⁺ uptake in Saccharomyces cerevisiae. Plant Physiology, 2000, 122(4): 1249–1259

[31] Su H, Golldack D, Zhao C, Bohnert H J. The expression of HAK-type K⁺ transporters is regulated in response to salinity stress in common ice plant. Plant Physiology, 2002, 129(4): 1482–1493

[32] Rodríguez-Navarro A. Potassium transport in fungi and plants. Biochimica et Biophysica Acta, 2000, 1469(1): 1–30

[33] Santa-María G E, Rubio F, Dubcovsky J, Rodríguez-Navarro A. The HAK1 gene of barley is a member of a large gene family and encodes a high-affinity potassium transporter. Plant Cell, 1997, 9(12): 2281–2289

[34] Nieves-Cordones M, Alemán F, Martínez V, Rubio F. The Arabidopsis thaliana HAK5 K⁺ transporter is required for plant growth and K⁺ acquisition from low K⁺ solutions under saline conditions. Molecular Plant, 2010, 3(2): 326–333

Acknowledgements

This work was supported by the National Natural Science Foundation of China (31730093, 31470503).

Compliance with ethics guidelines

Haili Yang, Weidan Zhang, Weiwei Chai, Wenying Wang, Li Gao, Jing Zhang, Yongping Wang, and Suo-Min Wang declare they have no conflicts of interest or financial conflicts to disclose.

This article does not contain any studies with human or animal subjects performed by any of the authors.

RIGHTS & PERMISSIONS

The Author(s) 2018. Published by Higher Education Press. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0)