
Plant genetic engineering and genetically modified crop breeding: history and current status
Xingchun WANG, Shujun CHANG, Jie LU, Rupert FRAY, Don GRIERSON, Yuanhuai HAN
Front. Agr. Sci. Eng. ›› 2017, Vol. 4 ›› Issue (1) : 5-27.
Plant genetic engineering and genetically modified crop breeding: history and current status
This review charts the major developments in the genetic manipulation of plant cells that have taken place since the first gene transfer experiments using Ti plasmids in 1983. Tremendous progress has been made in both our scientific understanding and technological capabilities since the first genetically modified (GM) crops were developed with single gene resistances to herbicides, insects, viruses, and the silencing of unde-sirable genes. Despite opposition in some parts of the world, the area planted with first generation GM crops has grown from 1.7 Mhm2 in 1996 to 179.7 Mhm2 hectares in 2015. The toolkit available for genetic modification has expanded greatly since 1996 and recently Nobel Laureates have called on Greenpeace to end their blanket opposition, and plant scientists have urged that consideration be given to the benefits of GM crops based on actual evidence. It is now possible to use GM to breed new crop cultivars resistant to a much wider range of pests and diseases, and to produce crops better able to adapt to climate change. The advent of new CRISPR-based technologies makes it possible to contemplate a much wider range of improvements based on transfer of new metabolic pathways and traits to improve nutritional quality, with a much greater degree of precision. Use of GM, sometimes in conjunction with other approaches, offers great opportunities for improving food quality, safety, and security in a changing world.
plant transformation / transgene / genetic modification
Tab.1 Primer sequences used for quantitative real-time PCR |
Gene | Accession number | Primer sequences 5′ - 3′ |
---|---|---|
GAPDH | NM_204305 | Upper: AAAGTCCAAGTGGTGGCCATC Down: TTTCCCGTTCTCAGCCTTGAC |
Edn3 | AB235921 | Upper: CAGCCTTCATTTCGGTGCTCT Down: TGCATCGGTCCTTCTCTGTTG |
Ednrb2 | NM_204120 | Upper: TCCCCTTAGTATGCACTGGCA Down: ACGCCGTTTCATGTGGTCA |
Scf | NM_205130 | Upper: GCGCTGCCATTCCTTATGAAG Down: TGGATTCCCGCAGGAACTCT |
Mc1r | NM_001031462 | Upper: TCCGCCACATGGACAATGT Down: GCAGCGCATAGAAGATGGTGA |
Pomc | NM_001031098 | Upper: GAAAAGAAGGATGGAGGCTCG Down: CGATGGCGTTTTTGAACAGAG |
Fig.1 Numbers of differentially expressed genes between Silky Fowl and White Leghorn during critical times of melanocyte migration. Black bars: number of up-regulated genes in Silky Fowl; open bars: Numbers of down- regulated genes in Silky Fowl. Expression data were filtered by GeneSpring 10 using t-test (P<0.01, Fold change>2). |
Tab.2 Overrepresented GO categories of differentially expressed genes between SF and WL |
GO Id | Gene category | Hit | Enrichment test P-value |
---|---|---|---|
GO:0051707 | Response to other organism | 9 | 0.0013 |
GO:0048066 | Pigmentation during development | 4 | 0.0047 |
GO:0009607 | Response to biotic stimulus | 9 | 0.0071 |
GO:0007622 | Rhythmic behavior | 2 | 0.0099 |
GO:0002684 | Positive regulation of immune system process | 7 | 0.0185 |
GO:0042440 | Pigment metabolic process | 3 | 0.0491 |
Tab.3 Significantly enriched pathways of differentially expressed genes between SF and WL |
Pathway DB | Gene Category | Hit | Enrichment test P-value |
---|---|---|---|
Kegg | Melanogenesis | 7 | 0.0015 |
Neuroactive ligand-receptor interaction | 12 | 0.0059 | |
Cytokine-cytokine receptor interaction | 8 | 0.0151 | |
Retinol metabolism | 3 | 0.0161 | |
ABC transporters | 3 | 0.0251 | |
Purine metabolism | 6 | 0.0288 | |
NOD-like receptor signaling pathway | 3 | 0.0407 |
Fig.2 Expression patterns of differentially expressed genes related to pigment development. Data are represented as mean±SD of replicates. The statistical variation between two chicken breeds was assessed by t-test (* means P<0.05, ** means P<0.01). Dark bars: gene expression level in Silky Fowl (SF); light bars: gene expression level in White Leghorn (WL). |
Tab.4 Detection of expression of six genes by microarray and quantitative real-time PCR |
Gene | D3 SF/WL | D3.5 SF/WL | D4 SF/WL | D4.5 SF/WL | ||||
---|---|---|---|---|---|---|---|---|
Microarray | q-PCR | Microarray | q-PCR | Microarray | q-PCR | Microarray | q-PCR | |
Kitlg | 2.2944 | – | 2.39404 | 1.6410 | 2.0823 | – | 1.9673 | 1.3421 |
Edn3 | 2.1170 | 2.1744 | 2.5549 | 2.7336 | 2.2183 | 5.6704 | 2.1193 | 3.6986 |
Ednrb2 | – | – | – | – | 2.4260 | 7.3574 | 1.7654 | 2.4993 |
Pomc | – | – | 3.2155 | 1.4718 | 3.0032 | 2.2160 | – | – |
Mc1r | – | – | – | – | 1.7667 | 6.9335 | 2.0253 | 3.7251 |
Note: D3, day 3; D3.5, day 3.5; D4, day 4; D4.5, day 4.5. |
[1] |
Griffith F. The significance of pneumococcal types. Journal of Hygiene, 1928, 27(2): 113–159
CrossRef
Google scholar
|
[2] |
Avery O T, Macleod C M, McCarty M. Studies on the chemical nature of the substance inducing transformation of pneumococcal types: induction of transformation by a desoxyribonucleic acid fraction isolated from pneumococcus type III. Journal of Experimental Medicine, 1944, 79(2): 137–158
CrossRef
Google scholar
|
[3] |
Jackson D A, Symons R H, Berg P. Biochemical method for inserting new genetic information into dna of simian virus 40: circular SV40 DNA molecules containing lambda phage genes and the galactose operon of Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America, 1972, 69(10): 2904–2909
CrossRef
Google scholar
|
[4] |
Cohen S N, Chang A C, Boyer H W, Helling R B. Construction of biologically functional bacterial plasmids in vitro. Proceedings of the National Academy of Sciences of the United States of America, 1973, 70(11): 3240–3244
CrossRef
Google scholar
|
[5] |
Gilbert W, Maxam A. The nucleotide sequence of the lac operator. Proceedings of the National Academy of Sciences of the United States of America, 1973, 70(12): 3581–3584
CrossRef
Google scholar
|
[6] |
Sanger F, Nicklen S, Coulson A R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America, 1977, 74(12): 5463–5467
CrossRef
Google scholar
|
[7] |
ISAAA. Biotech/GM crops planted on two billion hectares from 1996 to 2015. http://www.isaaa.org/kc/cropbiotechupdate/specialedition/2016/2016-04-13-cbu.html, 2016–10–12
|
[8] |
Sussex I M. The scientific roots of modern plant biotechnology. Plant Cell, 2008, 20(5): 1189–1198
CrossRef
Google scholar
|
[9] |
Miki B, McHugh S. Selectable marker genes in transgenic plants: applications, alternatives and biosafety. Journal of Biotechnology, 2004, 107(3): 193–232
CrossRef
Google scholar
|
[10] |
Gilissen L J, Metz P L, Stiekema W J, Nap J P. Biosafety of E. coli β-glucuronidase (GUS) in plants. Transgenic Research, 1998, 7(3): 157–163
CrossRef
Google scholar
|
[11] |
Shimomura O, Johnson F H, Saiga Y. Extraction, purification and properties of aequorin, a bioluminescent protein from the luminous hydromedusan, Aequorea. Journal of Cellular and Comparative Physiology, 1962, 59(3): 223–239
CrossRef
Google scholar
|
[12] |
Cubitt A B, Heim R, Adams S R, Boyd A E, Gross L A, Tsien R Y. Understanding, improving and using green fluorescent proteins. Trends in Biochemical Sciences, 1995, 20(11): 448–455
CrossRef
Google scholar
|
[13] |
Siemering K R, Golbik R, Sever R, Haseloff J. Mutations that suppress the thermosensitivity of green fluorescent protein. Current Biology, 1996, 6(12): 1653–1663
CrossRef
Google scholar
|
[14] |
Stewart C N Jr. The utility of green fluorescent protein in transgenic plants. Plant Cell Reports, 2001, 20(5): 376–382
CrossRef
Google scholar
|
[15] |
Tsien R Y. The green fluorescent protein. Annual Review of Biochemistry, 1998, 67(1): 509–544
CrossRef
Google scholar
|
[16] |
Chalfie M, Tu Y, Euskirchen G, Ward W W, Prasher D C. Green fluorescent protein as a marker for gene expression. Science, 1994, 263(5148): 802–805
CrossRef
Google scholar
|
[17] |
Wang X, Xue L, Sun J, Zuo J. The Arabidopsis BE1 gene, encoding a putative glycoside hydrolase localized in plastids, plays crucial roles during embryogenesis and carbohydrate metabolism. Journal of Integrative Plant Biology, 2010, 52(3): 273–288
CrossRef
Google scholar
|
[18] |
Chiu W, Niwa Y, Zeng W, Hirano T, Kobayashi H, Sheen J. Engineered GFP as a vital reporter in plants. Current Biology, 1996, 6(3): 325–330
CrossRef
Google scholar
|
[19] |
Aflalo C. Biologically localized firefly luciferase: a tool to study cellular processes. International Review of Cytology, 1991, 130: 269–323
CrossRef
Google scholar
|
[20] |
Ow D W, De Wet J R, Helinski D R, Howell S H, Wood K V, Deluca M. Transient and stable expression of the firefly luciferase gene in plant cells and transgenic plants. Science, 1986, 234(4778): 856–859
CrossRef
Google scholar
|
[21] |
Millar A, Short S, Hiratsuka K, Chua N H, Kay S. Firefly luciferase as a reporter of regulated gene expression in higher plants. Plant Molecular Biology Reporter, 1992, 10(4): 324–337
CrossRef
Google scholar
|
[22] |
McNabb D S, Reed R, Marciniak R A. Dual luciferase assay system for rapid assessment of gene expression in Saccharomyces cerevisiae. Eukaryotic Cell, 2005, 4(9): 1539–1549
CrossRef
Google scholar
|
[23] |
Bevan M W, Flavell R B, Chilton M D. A chimaeric antibiotic resistance gene as a selectable marker for plant cell transformation. Nature, 1983, 304(5922): 184–187
CrossRef
Google scholar
|
[24] |
Waldron C, Murphy E B, Roberts J L, Gustafson G D, Armour S L, Malcolm S K. Resistance to hygromycin B: a new marker for plant transformation studies. Plant Molecular Biology, 1985, 5(2): 103–108
CrossRef
Google scholar
|
[25] |
Block M D, Botterman J, Vandewiele M, Dockx J, Thoen C, Gossele V, Movva N R, Thompson C, Montagu M V, Leemans J. Engineering herbicide resistance in plants by expression of a detoxifying enzyme. EMBO Journal, 1987, 6(9): 2513–2518
|
[26] |
Sawasaki T, Seki M, Anzai H, Irifune K, Morikawa H. Stable transformation of Arabidopsis with the bar gene using particle bombardment. Transgenic Research, 1994, 3(5): 279–286
CrossRef
Google scholar
|
[27] |
Cao J, Duan X, McEiroy D, Wu R. Regeneration of herbicide resistant transgenic rice plants following microprojectile-mediated transformation of suspension culture cells. Plant Cell Reports, 1992, 11(11): 586–591
CrossRef
Google scholar
|
[28] |
Zuo J, Niu Q W, Ikeda Y, Chua N H. Marker-free transformation: increasing transformation frequency by the use of regeneration-promoting genes. Current Opinion in Biotechnology, 2002, 13(2): 173–180
CrossRef
Google scholar
|
[29] |
Kunkel T, Niu Q W, Chan Y S, Chua N H. Inducible isopentenyl transferase as a high-efficiency marker for plant transformation. Nature Biotechnology, 1999, 17(9): 916–919
CrossRef
Google scholar
|
[30] |
Covey S N, Lomonossoff G P, Hull R. Characterisation of cauliflower mosaic virus DNA sequences which encode major polyadenylated transcripts. Nucleic Acids Research, 1981, 9(24): 6735–6748
CrossRef
Google scholar
|
[31] |
Odell J T, Nagy F, Chua N H. Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature, 1985, 313(6005): 810–812
CrossRef
Google scholar
|
[32] |
Guilley H, Dudley R K, Jonard G, Balazs E, Richards K E. Transcription of cauliflower mosaic virus DNA: detection of promoter sequences, and characterization of transcripts. Cell, 1982, 30(3): 763–773
CrossRef
Google scholar
|
[33] |
Fang R X, Nagy F, Sivasubramaniam S, Chua N H. Multiple cis regulatory elements for maximal expression of the cauliflower mosaic virus 35S promoter in transgenic plants. Plant Cell, 1989, 1(1): 141–150
CrossRef
Google scholar
|
[34] |
Kay R, Chan A, Daly M, McPherson J. Duplication of CaMV 35S promoter sequences creates a strong enhancer for plant genes. Science, 1987, 236(4806): 1299–1302
CrossRef
Google scholar
|
[35] |
Yan L, Wei S, Wu Y, Hu R, Li H, Yang W, Xie Q. High-efficiency genome editing in Arabidopsis using YAO promoter-driven CRISPR/Cas9 system. Molecular Plant, 2015, 8(12): 1820–1823
CrossRef
Google scholar
|
[36] |
Wilkinson J E, Twell D, Lindsey K. Activities of CaMV 35S and nos promoters in pollen: implications for field release of transgenic plants. Journal of Experimental Botany, 1997, 48(2): 265–275
CrossRef
Google scholar
|
[37] |
McElroy D, Zhang W, Cao J, Wu R. Isolation of an efficient actin promoter for use in rice transformation. Plant Cell, 1990, 2(2): 163–171
CrossRef
Google scholar
|
[38] |
He C, Lin Z, McElroy D, Wu R. Identification of a rice actin2 gene regulatory region for high-level expression of transgenes in monocots. Plant Biotechnology Journal, 2009, 7(3): 227–239
CrossRef
Google scholar
|
[39] |
Jang I C, Choi W B, Lee K H, Song S I, Nahm B H, Kim J K. High-level and ubiquitous expression of the rice cytochrome c gene OsCc1 and its promoter activity in transgenic plants provides a useful promoter for transgenesis of monocots. Plant Physiology, 2002, 129(4): 1473–1481
CrossRef
Google scholar
|
[40] |
Jeon J S, Lee S, Jung K H, Jun S H, Kim C, An G. Tissue-preferential expression of a rice α-tubulin gene, OsTubA1, mediated by the first intron. Plant Physiology, 2000, 123(3): 1005–1014
CrossRef
Google scholar
|
[41] |
Lu J, Sivamani E, Li X, Qu R. Activity of the 5′ regulatory regions of the rice polyubiquitin rubi3 gene in transgenic rice plants as analyzed by both GUS and GFP reporter genes. Plant Cell Reports, 2008, 27(10): 1587–1600
CrossRef
Google scholar
|
[42] |
Wang J, Oard J H. Rice ubiquitin promoters: deletion analysis and potential usefulness in plant transformation systems. Plant Cell Reports, 2003, 22(2): 129–134
CrossRef
Google scholar
|
[43] |
Christensen A H, Sharrock R A, Quail P H. Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Molecular Biology, 1992, 18(4): 675–689
CrossRef
Google scholar
|
[44] |
Schledzewski K, Mendel R. Quantitative transient gene expression: comparison of the promoters for maize polyubiquitin1, rice actin1, maize-derived Emu and CaMV 35S in cells of barley, maize and tobacco. Transgenic Research, 1994, 3(4): 249–255
CrossRef
Google scholar
|
[45] |
An G. Development of plant promoter expression vectors and their use for analysis of differential activity of nopaline synthase promoter in transformed tobacco cells. Plant Physiology, 1986, 81(1): 86–91
CrossRef
Google scholar
|
[46] |
Ebert P R, Ha S B, An G. Identification of an essential upstream element in the nopaline synthase promoter by stable and transient assays. Proceedings of the National Academy of Sciences of the United States of America, 1987, 84(16): 5745–5749
CrossRef
Google scholar
|
[47] |
Jeong H J, Jung K H. Rice tissue-specific promoters and condition-dependent promoters for effective translational application. Journal of Integrative Plant Biology, 2015, 57(11): 913–924
CrossRef
Google scholar
|
[48] |
Potenza C, Aleman L, Sengupta-Gopalan C. Targeting transgene expression in research, agricultural, and environmental applications: promoters used in plant transformation. In Vitro Cellular & Developmental Biology-Plant, 2004, 40(1): 1–22
CrossRef
Google scholar
|
[49] |
Saijo T, Nagasawa A. Development of a tightly regulated and highly responsive copper-inducible gene expression system and its application to control of flowering time. Plant Cell Reports, 2014, 33(1): 47–59
CrossRef
Google scholar
|
[50] |
Aoyama T, Chua N H. A glucocorticoid-mediated transcriptional induction system in transgenic plants. Plant Journal, 1997, 11(3): 605–612
CrossRef
Google scholar
|
[51] |
Zuo J, Niu Q W, Chua N H. An estrogen receptor-based transactivator XVE mediates highly inducible gene expression in transgenic plants. Plant Journal, 2000, 24(2): 265–273
CrossRef
Google scholar
|
[52] |
Deveaux Y, Peaucelle A, Roberts G R, Coen E, Simon R, Mizukami Y, Traas J, Murray J A, Doonan J H, Laufs P. The ethanol switch: a tool for tissue-specific gene induction during plant development. Plant Journal, 2003, 36(6): 918–930
CrossRef
Google scholar
|
[53] |
Wang X, Niu Q W, Teng C, Li C, Mu J, Chua N H, Zuo J. Overexpression of PGA37/MYB118 and MYB115 promotes vegetative-to-embryonic transition in Arabidopsis. Cell Research, 2009, 19(2): 224–235
CrossRef
Google scholar
|
[54] |
Okuzaki A, Konagaya K, Nanasato Y, Tsuda M, Tabei Y. Estrogen-inducible GFP expression patterns in rice (Oryza sativa L.). Plant Cell Reports, 2011, 30(4): 529–538
CrossRef
Google scholar
|
[55] |
Ambavaram M M, Basu S, Krishnan A, Ramegowda V, Batlang U, Rahman L, Baisakh N, Pereira A. Coordinated regulation of photosynthesis in rice increases yield and tolerance to environmental stress. Nature Communications, 2014, 5: 5302
CrossRef
Google scholar
|
[56] |
Caddick M X, Greenland A J, Jepson, Krause K P, Qu N, Riddell K V, Salter M G, Schuch W, Sonnewald U, Tomsett A B. An ethanol inducible gene switch for plants used to manipulate carbon metabolism. Nature Biotechnology, 1998, 16(2): 177–180
CrossRef
Google scholar
|
[57] |
Gatz C, Frohberg C, Wendenburg R. Stringent repression and homogeneous de-repression by tetracycline of a modified CaMV 35S promoter in intact transgenic tobacco plants. Plant Journal, 1992, 2(3): 397–404
|
[58] |
Cocking E C. Turning point article plant protoplasts. In Vitro Cellular & Developmental Biology-Plant, 2000, 36(2): 77–82
CrossRef
Google scholar
|
[59] |
Johnson C M, Carswell G K, Shillito R D. Direct gene transfer via polyethylene glycol. Journal of Tissue Culture Methods, 1989, 12(4): 127–133
CrossRef
Google scholar
|
[60] |
Davey M R, Anthony P, Power J B, Lowe K C. Plant protoplasts: status and biotechnological perspectives. Biotechnology Advances, 2005, 23(2): 131–171
CrossRef
Google scholar
|
[61] |
Klein T M, Wolf E D, Wu R, Sanford J C. High-velocity microprojectiles for delivering nucleic acids into living cells. Nature, 1987, 327(6117): 70–73
CrossRef
Google scholar
|
[62] |
Wang K, Drayton P, Frame B, Dunwell J, Thompson J. Whisker-mediated plant transformation: an alternative technology. In Vitro Cellular & Developmental Biology-Plant, 1995, 31(2): 101–104
CrossRef
Google scholar
|
[63] |
Potrykus I. Gene transfer to plants: assessment and perspectives. Physiologia Plantarum, 1990, 79(1): 125–134
CrossRef
Google scholar
|
[64] |
Bock R. Engineering plastid genomes: methods, tools, and applications in basic research and biotechnology. Annual Review of Plant Biology, 2015, 66(1): 211–241
CrossRef
Google scholar
|
[65] |
Fraley R T, Rogers S G, Horsch R B, Sanders P R, Flick J S, Adams S P, Bittner M L, Brand L A, Fink C L, Fry J S, Galluppi G R, Goldberg S B, Hoffmann N L, Woo S C. Expression of bacterial genes in plant cells. Proceedings of the National Academy of Sciences of the United States of America, 1983, 80(15): 4803–4807
CrossRef
Google scholar
|
[66] |
Herrera-Estrella L, Depicker A, Van Montagu M, Schell J. Expression of chimaeric genes transferred into plant cells using a Ti-plasmid-derived vector. Nature, 1983, 303(5914): 209–213
CrossRef
Google scholar
|
[67] |
Hoekema A, Hirsch P R, Hooykaas P J J, Schilperoort R A. A binary plant vector strategy based on separation of vir- and T-region of the Agrobacterium tumefaciens Ti-plasmid. Nature, 1983, 303(5913): 179–180
CrossRef
Google scholar
|
[68] |
Bevan M. Binary Agrobacterium vectors for plant transformation. Nucleic Acids Research, 1984, 12(22): 8711–8721
CrossRef
Google scholar
|
[69] |
Lee L Y, Gelvin S B. T-DNA binary vectors and systems. Plant Physiology, 2008, 146(2): 325–332
CrossRef
Google scholar
|
[70] |
Clough S J, Bent A F. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal, 1998, 16(6): 735–743
CrossRef
Google scholar
|
[71] |
Saha P, Blumwald E. Spike-dip transformation of Setaria viridis. Plant Journal, 2016, 86(1): 89–101
CrossRef
Google scholar
|
[72] |
Nguyen T, Liu X, Derocher J. Floral dip method for transformation of camelina. United States of America, 2014, 8779238
|
[73] |
Ow D W. The long road to recombinase-mediated plant transformation. Plant Biotechnology Journal, 2016, 14(2): 441–447
CrossRef
Google scholar
|
[74] |
Zuo J, Niu Q W, Moller S G, Chua N H. Chemical-regulated, site-specific DNA excision in transgenic plants. Nature Biotechnology, 2001, 19(2): 157–161
CrossRef
Google scholar
|
[75] |
Terada R, Urawa H, Inagaki Y, Tsugane K, Iida S. Efficient gene targeting by homologous recombination in rice. Nature Biotechnology, 2002, 20(10): 1030–1034
CrossRef
Google scholar
|
[76] |
Steinert J, Schiml S, Puchta H. Homology-based double-strand break-induced genome engineering in plants. Plant Cell Reports, 2016, 35(7): 1429–1438
CrossRef
Google scholar
|
[77] |
Townsend J A, Wright D A, Winfrey R J, Fu F, Maeder M L, Joung J K, Voytas D F. High-frequency modification of plant genes using engineered zinc-finger nucleases. Nature, 2009, 459(7245): 442–445
CrossRef
Google scholar
|
[78] |
Funke T, Han H, Healy-Fried M L, Fischer M, Schonbrunn E. Molecular basis for the herbicide resistance of Roundup Ready crops. Proceedings of the National Academy of Sciences of the United States of America, 2006, 103(35): 13010–13015
CrossRef
Google scholar
|
[79] |
Temple W. Review of the evidence relating to glyphosate and carcinogenicity. http://www.epa.govt.nz/Publications/EPA_glyphosate_review.pdf, 2016–10–12
|
[80] |
Perlak F J, Fuchs R L, Dean D A, McPherson S L, Fischhoff D A. Modification of the coding sequence enhances plant expression of insect control protein genes. Proceedings of the National Academy of Sciences of the United States of America, 1991, 88(8): 3324–3328
CrossRef
Google scholar
|
[81] |
Höfte H, Whiteley H R. Insecticidal crystal proteins of Bacillus thuringiensis. Microbiological Reviews, 1989, 53(2): 242–255
|
[82] |
Cao J, Zhao J Z, Tang D, Shelton M, Earle D. Broccoli plants with pyramided cry1Ac and cry1C Bt genes control diamondback moths resistant to Cry1A and Cry1C proteins. Theoretical and Applied Genetics, 2002, 105(2–3): 258–264
|
[83] |
McGaughey W H, Whalon M E. Managing insect resistance to Bacillus thuringiensis toxins. Science, 1992, 258(5087): 1451–1455
CrossRef
Google scholar
|
[84] |
Ricroch A E, Hénard-Damave M C. Next biotech plants: new traits, crops, developers and technologies for addressing global challenges. Critical Reviews in Biotechnology, 2016, 36(4): 675–690
|
[85] |
Fitch M M M, Manshardt R M, Gonsalves D, Slightom J L, Sanford J C. Virus resistance papaya derived from tissue bombarded with the coat protein gene of papaya ringspot virus. Nature Biotechnology, 1992, 10(11): 1466–1472
CrossRef
Google scholar
|
[86] |
Geo Pie Project #8. Genetically engineered foods: plant virus resistance. https://scholarworks.iupui.edu/bitstream/handle/1805/813/GE%20plant%20virus%20resistance.pdf, 2016–10–12
|
[87] |
Scorza R, Kriss A B, Callahan A M, Webb K, Demuth M, Gottwald T. Spatial and temporal assessment of pollen- and seed-mediated gene flow from genetically engineered plum Prunus domestica. PLoS One, 2013, 8(10): e75291
CrossRef
Google scholar
|
[88] |
Baulcombe D. Viruses and gene silencing in plants. in Calisher C H, Horzinek M C, eds. 100 years of virology: The birth and growth of a discipline. Vienna: Springer Vienna, 1999, 189–201
|
[89] |
Sudarshana M R, Roy G, Falk B W. Methods for engineering resistance to plant viruses. in Ronald P C, eds. Plant-pathogen interactions: methods and protocols. 1nd. Totowa NJ: Humana Press, 2007, 183–195
|
[90] |
Halpin C. Gene stacking in transgenic plants—the challenge for 21st century plant biotechnology. Plant Biotechnology Journal, 2005, 3(2): 141–155
CrossRef
Google scholar
|
[91] |
James C. Global status of commercialized biotech/GM crops. ISAAA Brief No. 49. New York: The International Service for the Acquisition of Agri-biotech Applications (ISAAA), 2014
|
[92] |
James C. Preview: global status of commercialized transgenic crops. ISAAA Briefs No. 30. New York: The International Service for the Acquisition of Agri-biotech Applications (ISAAA), 2003
|
[93] |
Casini A, Storch M, Baldwin G S, Ellis T. Bricks and blueprints: methods and standards for DNA assembly. Nature Reviews Molecular Cell Biology, 2015, 16(9): 568–576
CrossRef
Google scholar
|
[94] |
Ow D W. Recombinase-directed plant transformation for the post-genomic era. in Town C, eds. Functional genomics. Dordrecht: Springer Netherlands, 2002, 183–200
|
[95] |
Li Z, Xing A, Moon B P, McCardell R P, Mills K, Falco S C. Site-specific integration of transgenes in soybean via recombinase-mediated DNA cassette exchange. Plant Physiology, 2009, 151(3): 1087–1095
CrossRef
Google scholar
|
[96] |
Li Z, Moon B P, Xing A, Liu Z B, McCardell R P, Damude H G, Falco S C. Stacking multiple transgenes at a selected genomic site via repeated recombinase-mediated DNA cassette exchanges. Plant Physiology, 2010, 154(2): 622–631
CrossRef
Google scholar
|
[97] |
Depicker A, Herman L, Jacobs A, Schell J, Van Montagu M. Frequencies of simultaneous transformation with different T-DNAs and their relevance to the Agrobacterium/plant cell interaction. Molecular & General Genetics, 1985, 201(3): 477–484
CrossRef
Google scholar
|
[98] |
De Block M, Debrouwer D. Two T-DNA’s co-transformed into Brassica napus by a double Agrobacterium tumefaciens infection are mainly integrated at the same locus. Theoretical and Applied Genetics, 1991, 82(3): 257–263
CrossRef
Google scholar
|
[99] |
McCormac A C, Fowler M R, Chen D F, Elliott M C. Efficient co-transformation of Nicotiana tabacum by two independent T-DNAs, the effect of T-DNA size and implications for genetic separation. Transgenic Research, 2001, 10(2): 143–155
CrossRef
Google scholar
|
[100] |
Li L, Zhou Y, Cheng X, Sun J, Marita J M, Ralph J, Chiang V L. Combinatorial modification of multiple lignin traits in trees through multigene cotransformation. Proceedings of the National Academy of Sciences of the United States of America, 2003, 100(8): 4939–4944
CrossRef
Google scholar
|
[101] |
Hu W J, Harding S A, Lung J, Popko J L, Ralph J, Stokke D D, Tsai C J, Chiang V L. Repression of lignin biosynthesis promotes cellulose accumulation and growth in transgenic trees. Nature Biotechnology, 1999, 17(8): 808–812
CrossRef
Google scholar
|
[102] |
Ye X, Al-Babili S, Kloti A, Zhang J, Lucca P, Beyer P, Potrykus I. Engineering the provitamin A (β-carotene) biosynthetic pathway into (carotenoid-free) rice endosperm. Science, 2000, 287(5451): 303–305
CrossRef
Google scholar
|
[103] |
Datta K, Baisakh N, Oliva N, Torrizo L, Abrigo E, Tan J, Rai M, Rehana S, Al-Babili S, Beyer P, Potrykus I, Datta S K. Bioengineered ‘golden’ indica rice cultivars with β-carotene metabolism in the endosperm with hygromycin and mannose selection systems. Plant Biotechnology Journal, 2003, 1(2): 81–90
CrossRef
Google scholar
|
[104] |
Paine J A, Shipton C A, Chaggar S, Howells R M, Kennedy M J, Vernon G, Wright S Y, Hinchliffe E, Adams J L, Silverstone A L, Drake R. Improving the nutritional value of Golden Rice through increased pro-vitamin A content. Nature Biotechnology, 2005, 23(4): 482–487
CrossRef
Google scholar
|
[105] |
Zhu C, Naqvi S, Breitenbach J, Sandmann G, Christou P, Capell T. Combinatorial genetic transformation generates a library of metabolic phenotypes for the carotenoid pathway in maize. Proceedings of the National Academy of Sciences of the United States of America, 2008, 105(47): 18232–18237
CrossRef
Google scholar
|
[106] |
Joel A. 107 Nobel laureates sign letter blasting Greenpeace over GMOs. https://www.washingtonpost.com/news/speaking-of-science/wp/2016/06/29/more-than-100-nobel-laureates-take-on-greenpeace-over-gmo-stance/, 2016–06–30
|
[107] |
Westhoff P, Herrmann R G. Complex RNA maturation in chloroplasts. The psbB operon from spinach. European Journal of Biochemistry, 1988, 171(3): 551–564
CrossRef
Google scholar
|
[108] |
Zhou F, Karcher D, Bock R. Identification of a plastid intercistronic expression element (IEE) facilitating the expression of stable translatable monocistronic mRNAs from operons. Plant Journal, 2007, 52(5): 961–972
CrossRef
Google scholar
|
[109] |
Nakashita H, Arai Y, Shikanai T, Doi Y, Yamaguchi I. Introduction of bacterial metabolism into higher plants by polycistronic transgene expression. Bioscience, Biotechnology, and Biochemistry, 2001, 65(7): 1688–1691
CrossRef
Google scholar
|
[110] |
Magee A M, Horvath E M, Kavanagh T A. Pre-screening plastid transgene expression cassettes in Escherichia coli may be unreliable as a predictor of expression levels in chloroplast-transformed plants. Plant Science, 2004, 166(6): 1605–1611
CrossRef
Google scholar
|
[111] |
Lu Y, Rijzaani H, Karcher D, Ruf S, Bock R. Efficient metabolic pathway engineering in transgenic tobacco and tomato plastids with synthetic multigene operons. Proceedings of the National Academy of Sciences of the United States of America, 2013, 110(8): E623–E632
CrossRef
Google scholar
|
[112] |
de Felipe P. Skipping the co-expression problem: the new 2A “CHYSEL” technology. Genetic Vaccines and Therapy, 2004, 2(1): 13
CrossRef
Google scholar
|
[113] |
Zhao Q, Liu M, Tan M, Gao J, Shen Z. Expression of Cry1Ab and Cry2Ab by a polycistronic transgene with a self-cleavage peptide in rice. PLoS One, 2014, 9(10): e110006
CrossRef
Google scholar
|
[114] |
Belhaj K, Chaparro Garcia A, Kamoun S, Patron N J, Nekrasov V. Editing plant genomes with CRISPR/Cas9. Current Opinion in Biotechnology, 2015, 32: 76–84
CrossRef
Google scholar
|
[115] |
Auer T O, Duroure K, De Cian A, Concordet J P, Del Bene F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research, 2014, 24(1): 142–153
CrossRef
Google scholar
|
[116] |
Wang Y, Cheng X, Shan Q, Zhang Y, Liu J, Gao C, Qiu J L. Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nature Biotechnology, 2014, 32(9): 947–951
CrossRef
Google scholar
|
[117] |
Ecker J R, Davis R W. Inhibition of gene expression in plant cells by expression of antisense RNA. Proceedings of the National Academy of Sciences of the United States of America, 1986, 83(15): 5372–5376
CrossRef
Google scholar
|
[118] |
Smith C J S, Watson C F, Ray J, Bird C R, Morris P C, Schuch W, Grierson D. Antisense RNA inhibition of polygalacturonase gene expression in transgenic tomatoes. Nature, 1988, 334(6184): 724–726
CrossRef
Google scholar
|
[119] |
Sheehy R E, Pearson J, Brady C J, Hiatt W R. Molecular characterization of tomato fruit polygalacturonase. Molecular & General Genetics, 1987, 208(1): 30–36
CrossRef
Google scholar
|
[120] |
van der Krol A R, Lenting P E, Veenstra J, van der Meer I M, Koes R E, Gerats A G M, Mol J N M, Stuitje A R. An anti-sense chalcone synthase gene in transgenic plants inhibits flower pigmentation. Nature, 1988, 333(6176): 866–869
CrossRef
Google scholar
|
[121] |
Smith C J, Watson C F, Bird C R, Ray J, Schuch W, Grierson D. Expression of a truncated tomato polygalacturonase gene inhibits expression of the endogenous gene in transgenic plants. Molecular & General Genetics, 1990, 224(3): 477–481
CrossRef
Google scholar
|
[122] |
Smith C J S, Watson C F, Morris P C, Bird C R, Seymour G B, Gray J E, Arnold C, Tucker G A, Schuch W, Harding S, Grierson D. Inheritance and effect on ripening of antisense polygalacturonase genes in transgenic tomatoes. Plant Molecular Biology, 1990, 14(3): 369–379
CrossRef
Google scholar
|
[123] |
van der Krol A R, Mur L A, Beld M, Mol J N, Stuitje A R. Flavonoid genes in petunia: addition of a limited number of gene copies may lead to a suppression of gene expression. Plant Cell, 1990, 2(4): 291–299
CrossRef
Google scholar
|
[124] |
Jorgensen R. Altered gene expression in plants due totrans interactions between homologous genes. Trends in Biotechnology, 1990, 8: 340–344
CrossRef
Google scholar
|
[125] |
Grierson D, Fray R G, Hamilton A J, Smith C J S, Watson C F. Does co-suppression of sense genes in transgenic plants involve antisense RNA? Trends in Biotechnology, 1991, 9(1): 122–123
CrossRef
Google scholar
|
[126] |
Sijen T, Wellink J, Hiriart J B, Van Kammen A. RNA-mediated virus resistance: role of repeated transgenes and delineation of targeted regions. Plant Cell, 1996, 8(12): 2277–2294
CrossRef
Google scholar
|
[127] |
Gazzani S, Lawrenson T, Woodward C, Headon D, Sablowski R. A link between mRNA turnover and RNA interference in Arabidopsis. Science, 2004, 306(5698): 1046–1048
CrossRef
Google scholar
|
[128] |
Thran M, Link K, Sonnewald U. The Arabidopsis DCP2 gene is required for proper mRNA turnover and prevents transgene silencing in Arabidopsis. Plant Journal, 2012, 72(3): 368–377
CrossRef
Google scholar
|
[129] |
Herr A J, Molnar A, Jones A, Baulcombe D C. Defective RNA processing enhances RNA silencing and influences flowering of Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America, 2006, 103(41): 14994–15001
CrossRef
Google scholar
|
[130] |
Cluster P D, O’Dell M, Metzlaff M, Flavell R B. Details of T-DNA structural organization from a transgenic Petunia population exhibiting co-suppression. Plant Molecular Biology, 1996, 32(6): 1197–1203
CrossRef
Google scholar
|
[131] |
Flavell R B. Inactivation of gene expression in plants as a consequence of specific sequence duplication. Proceedings of the National Academy of Sciences of the United States of America, 1994, 91(9): 3490–3496
CrossRef
Google scholar
|
[132] |
Que Q, Wang H Y, English J J, Jorgensen R A. The frequency and degree of cosuppression by sense chalcone synthase transgenes are dependent on transgene promoter strength and are reduced by premature nonsense codons in the transgene coding sequence. Plant Cell, 1997, 9(8): 1357–1368
CrossRef
Google scholar
|
[133] |
Han Y, Griffiths A, Li H, Grierson D. The effect of endogenous mRNA levels on co-suppression in tomato. FEBS Letters, 2004, 563(1–3): 123–128
CrossRef
Google scholar
|
[134] |
Baulcombe D C. RNA as a target and an initiator of post-transcriptional gene silencing in trangenic plants. Plant Molecular Biology, 1996, 32(1): 79–88
CrossRef
Google scholar
|
[135] |
Ratcliff F, Martin-Hernandez A M, Baulcombe D C. Tobacco rattle virus as a vector for analysis of gene function by silencing. Plant Journal, 2001, 25(2): 237–245
CrossRef
Google scholar
|
[136] |
Mei Y, Zhang C, Kernodle B M, Hill J H, Whitham S A. A foxtail mosaic virus vector for virus-induced gene silencing in maize. Plant Physiology, 2016, 171(2): 760–772
|
[137] |
Liu N, Xie K, Jia Q, Zhao J, Chen T, Li H, Wei X, Diao X, Hong Y, Liu Y. Foxtail mosaic virus-induced gene silencing in monocot plants. Plant Physiology, 2016, 171(3): 1801–1807
CrossRef
Google scholar
|
[138] |
Hamilton A J, Brown S, Yuanhai H, Ishizuka M, Lowe A, Solis A G A, Grierson D. A transgene with repeated DNA causes high frequency, post-transcriptional suppression of ACC-oxidase gene expression in tomato. Plant Journal, 1998, 15(6): 737–746
CrossRef
Google scholar
|
[139] |
Hamilton A J, Baulcombe D C. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science, 1999, 286(5441): 950–952
CrossRef
Google scholar
|
[140] |
Fire A, Xu S, Montgomery M K, Kostas S A, Driver S E, Mello C C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature, 1998, 391(6669): 806–811
CrossRef
Google scholar
|
[141] |
Baulcombe D. RNA silencing. Trends in Biochemical Sciences, 2005, 30(6): 290–293
CrossRef
Google scholar
|
[142] |
Wesley S V, Helliwell C A, Smith N A, Wang M B, Rouse D T, Liu Q, Gooding P S, Singh S P, Abbott D, Stoutjesdijk P A, Robinson S P, Gleave A P, Green A G, Waterhouse P M. Construct design for efficient, effective and high-throughput gene silencing in plants. Plant Journal, 2001, 27(6): 581–590
CrossRef
Google scholar
|
[143] |
Yin Y, Chory J, Baulcombe D. RNAi in transgenic plants. Current Protocols in Molecular Biology, 2005, Unit 26.6
|
[144] |
Grierson D. Identifying and silencing tomato ripening genes with antisense genes. Plant Biotechnology Journal, 2016, 14(3): 835–838
CrossRef
Google scholar
|
[145] |
Grierson D. Ethylene and the control of fruit ripening. in Seymour G, Poole M, Giovannoni J, Tucker G, eds. Molecular Biology and Biochemistry of Fruit Ripening. John Wiley & Sons, Inc, 2013, 43–73
|
[146] |
Grierson D, Hamilton A J, Lycett G W. The life and times of ACC oxidase, alias TOM13. Molecular Biology Reports, 2013, 40(4): 3021–3022
CrossRef
Google scholar
|
[147] |
Prins M, Laimer M, Noris E, Schubert J, Wassenegger M, Tepfer M. Strategies for antiviral resistance in transgenic plants. Molecular Plant Pathology, 2008, 9(1): 73–83
|
[148] |
Koch A, Kogel K H. New wind in the sails: improving the agronomic value of crop plants through RNAi-mediated gene silencing. Plant Biotechnology Journal, 2014, 12(7): 821–831
CrossRef
Google scholar
|
[149] |
Baum J A, Bogaert T, Clinton W, Heck G R, Feldmann P, Ilagan O, Johnson S, Plaetinck G, Munyikwa T, Pleau M, Vaughn T, Roberts J. Control of coleopteran insect pests through RNA interference. Nature Biotechnology, 2007, 25(11): 1322–1326
CrossRef
Google scholar
|
[150] |
Nawaz-ul-Rehman M S, Mansoor S, Khan A A, Zafar Y, Briddon R W. RNAi-mediated male sterility of tobacco by silencing TA29. Molecular Biotechnology, 2007, 36(2): 159–165
CrossRef
Google scholar
|
[151] |
Wang X, Singer S D, Liu Z. Silencing of meiosis-critical genes for engineering male sterility in plants. Plant Cell Reports, 2012, 31(4): 747–756
CrossRef
Google scholar
|
[152] |
Coleman H D, Park J Y, Nair R, Chapple C, Mansfield S D. RNAi-mediated suppression of p-coumaroyl-CoA 3′-hydroxylase in hybrid poplar impacts lignin deposition and soluble secondary metabolism. Proceedings of the National Academy of Sciences of the United States of America, 2008, 105(11): 4501–4506
CrossRef
Google scholar
|
[153] |
Xu B, Escamilla-Trevino L L, Sathitsuksanoh N, Shen Z, Shen H, Zhang Y H, Dixon R A, Zhao B. Silencing of 4-coumarate: coenzyme A ligase in switchgrass leads to reduced lignin content and improved fermentable sugar yields for biofuel production. New Phytologist, 2011, 192(3): 611–625
CrossRef
Google scholar
|
[154] |
Jung J H, Fouad W M, Vermerris W, Gallo M, Altpeter F. RNAi suppression of lignin biosynthesis in sugarcane reduces recalcitrance for biofuel production from lignocellulosic biomass. Plant Biotechnology Journal, 2012, 10(9): 1067–1076
CrossRef
Google scholar
|
[155] |
Fornalé S, Capellades M, Encina A, Wang K, Irar S, Lapierre C, Ruel K, Joseleau J P, Berenguer J, Puigdomenech P, Rigau J, Caparros-Ruiz D. Altered lignin biosynthesis improves cellulosic bioethanol production in transgenic maize plants down-regulated for cinnamyl alcohol dehydrogenase. Molecular Plant, 2012, 5(4): 817–830
CrossRef
Google scholar
|
[156] |
Lee C, Teng Q, Huang W, Zhong R, Ye Z H. Down-regulation of PoGT47C expression in poplar results in a reduced glucuronoxylan content and an increased wood digestibility by cellulase. Plant & Cell Physiology, 2009, 50(6): 1075–1089
CrossRef
Google scholar
|
[157] |
Biswal A K, Hao Z, Pattathil S, Yang X, Winkeler K, Collins C, Mohanty S S, Richardson E A, Gelineo-Albersheim I, Hunt K, Ryno D, Sykes R W, Turner G B, Ziebell A, Gjersing E, Lukowitz W, Davis M F, Decker S R, Hahn M G, Mohnen D. Downregulation of GAUT12 in Populus deltoides by RNA silencing results in reduced recalcitrance, increased growth and reduced xylan and pectin in a woody biofuel feedstock. Biotechnology for Biofuels, 2015, 8(1): 41
CrossRef
Google scholar
|
[158] |
Kim M J, Yang S W, Mao H Z, Veena S P, Yin J L, Chua N H. Gene silencing of Sugar-dependent 1 (JcSDP1), encoding a patatin-domain triacylglycerol lipase, enhances seed oil accumulation in Jatropha curcas. Biotechnology for Biofuels, 2014, 7(1): 36
CrossRef
Google scholar
|
[159] |
Trentacoste E M, Shrestha R P, Smith S R, Gle C, Hartmann A C, Hildebrand M, Gerwick W H. Metabolic engineering of lipid catabolism increases microalgal lipid accumulation without compromising growth. Proceedings of the National Academy of Sciences of the United States of America, 2013, 110(49): 19748–19753
CrossRef
Google scholar
|
[160] |
Price D R, Gatehouse J A. RNAi-mediated crop protection against insects. Trends in Biotechnology, 2008, 26(7): 393–400
CrossRef
Google scholar
|
[161] |
Whyard S, Singh A D, Wong S. Ingested double-stranded RNAs can act as species-specific insecticides. Insect Biochemistry and Molecular Biology, 2009, 39(11): 824–832
CrossRef
Google scholar
|
[162] |
Wang J, Wu M, Wang B, Han Z. Comparison of the RNA interference effects triggered by dsRNA and siRNA in Tribolium castaneum. Pest Management Science, 2013, 69(7): 781–786
CrossRef
Google scholar
|
[163] |
Zhang J, Khan S A, Hasse C, Ruf S, Heckel D G, Bock R. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science, 2015, 347(6225): 991–994
CrossRef
Google scholar
|
[164] |
Yoder J I, Scholes J D. Host plant resistance to parasitic weeds; recent progress and bottlenecks. Current Opinion in Plant Biology, 2010, 13(4): 478–484
CrossRef
Google scholar
|
[165] |
Aly R, Cholakh H, Joel D M, Leibman D, Steinitz B, Zelcer A, Naglis A, Yarden O, Gal-On A. Gene silencing of mannose 6-phosphate reductase in the parasitic weed Orobanche aegyptiaca through the production of homologous dsRNA sequences in the host plant. Plant Biotechnology Journal, 2009, 7(6): 487–498
CrossRef
Google scholar
|
[166] |
Bandaranayake P C, Yoder J I. Trans-specific gene silencing of acetyl-CoA carboxylase in a root-parasitic plant. Molecular Plant-Microbe Interactions, 2013, 26(5): 575–584
CrossRef
Google scholar
|
[167] |
de Framond A, Rich P, McMillan J, Ejeta G. Effects of Striga parasitism of transgenic maize armed with RNAi constructs targeting essential S. asiatica genes. in Ejeta G, Gressel J, eds. Integrating new technologies for Striga control. 1nd. Singapore: World Scientific Publishing Company, 2007, 185–196
|
[168] |
Kirigia D, Runo S, Alakonya A. A virus-induced gene silencing (VIGS) system for functional genomics in the parasitic plant Striga hermonthica. Plant Methods, 2014, 10(1): 16
CrossRef
Google scholar
|
[169] |
Huang G, Allen R, Davis E L, Baum T J, Hussey R S. Engineering broad root-knot resistance in transgenic plants by RNAi silencing of a conserved and essential root-knot nematode parasitism gene. Proceedings of the National Academy of Sciences of the United States of America, 2006, 103(39): 14302–14306
CrossRef
Google scholar
|
[170] |
Sindhu A S, Maier T R, Mitchum M G, Hussey R S, Davis E L, Baum T J. Effective and specific in planta RNAi in cyst nematodes: expression interference of four parasitism genes reduces parasitic success. Journal of Experimental Botany, 2009, 60(1): 315–324
CrossRef
Google scholar
|
[171] |
Xue B, Hamamouch N, Li C, Huang G, Hussey R S, Baum T J, Davis E L. The 8D05 parasitism gene of Meloidogyne incognita is required for successful infection of host roots. Phytopathology, 2013, 103(2): 175–181
CrossRef
Google scholar
|
[172] |
Niu J, Liu P, Liu Q, Chen C, Guo Q, Yin J, Yang G, Jian H. Msp40 effector of root-knot nematode manipulates plant immunity to facilitate parasitism. Scientific Reports, 2016, 6: 19443
CrossRef
Google scholar
|
[173] |
Yadav B C, Veluthambi K, Subramaniam K. Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection. Molecular and Biochemical Parasitology, 2006, 148(2): 219–222
CrossRef
Google scholar
|
[174] |
Lourenco-Tessutti I T, Souza J D Junior, Martins-de-Sa D, Viana A A, Carneiro R M, Togawa R C, de Almeida-Engler J, Batista J A, Silva M C, Fragoso R R, Grossi-de-Sa M F. Knock-down of heat-shock protein 90 and isocitrate lyase gene expression reduced root-knot nematode reproduction. Phytopathology, 2015, 105(5): 628–637
CrossRef
Google scholar
|
[175] |
Dinh P T, Zhang L, Mojtahedi H, Brown C R, Elling A A. Broad meloidogyne resistance in potato based on RNA interference of effector gene 16D10. Journal of Nematology, 2015, 47(1): 71–78
|
[176] |
Dutta T K, Banakar P, Rao U. The status of RNAi-based transgenic research in plant nematology. Frontiers in Microbiology, 2014, 5: 760
|
[177] |
Waltz E. USDA approves next-generation GM potato. Nature Biotechnology, 2015, 33(1): 12–13
CrossRef
Google scholar
|
[178] |
Waltz E. Nonbrowning GM apple cleared for market. Nature Biotechnology, 2015, 33(4): 326–327
CrossRef
Google scholar
|
[179] |
Nathans D, Smith H O. Restriction endonucleases in the analysis and restructuring of DNA molecules. Annual Review of Biochemistry, 1975, 44(1): 273–293
CrossRef
Google scholar
|
[180] |
Davis D, Stokoe D. Zinc finger nucleases as tools to understand and treat human diseases. BMC Medicine, 2010, 8(1): 42
CrossRef
Google scholar
|
[181] |
Sander J D, Dahlborg E J, Goodwin M J, Cade L, Zhang F, Cifuentes D, Curtin S J, Blackburn J S, Thibodeau-Beganny S, Qi Y, Pierick C J, Hoffman E, Maeder M L, Khayter C, Reyon D, Dobbs D, Langenau D M, Stupar R M, Giraldez A J, Voytas D F, Peterson R T, Yeh J R, Joung J K. Selection-free zinc-finger-nuclease engineering by context-dependent assembly (CoDA). Nature Methods, 2011, 8(1): 67–69
CrossRef
Google scholar
|
[182] |
Li T, Liu B, Spalding M H, Weeks D P, Yang B. High-efficiency TALEN-based gene editing produces disease-resistant rice. Nature Biotechnology, 2012, 30(5): 390–392
CrossRef
Google scholar
|
[183] |
Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna J A, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 2012, 337(6096): 816–821
CrossRef
Google scholar
|
[184] |
Whitworth K M, Lee K, Benne J A, Beaton B P, Spate L D, Murphy S L, Samuel M S, Mao J, O’Gorman C, Walters E M, Murphy C N, Driver J, Mileham A, McLaren D, Wells K D, Prather R S. Use of the CRISPR/Cas9 system to produce genetically engineered pigs from in vitro-derived oocytes and embryos. Biology of Reproduction, 2014, 91(3): 78
CrossRef
Google scholar
|
[185] |
Pul U, Wurm R, Arslan Z, Geissen R, Hofmann N, Wagner R. Identification and characterization of E. coli CRISPR-cas promoters and their silencing by H-NS. Molecular Microbiology, 2010, 75(6): 1495–1512
CrossRef
Google scholar
|
[186] |
Silas S, Mohr G, Sidote D J, Markham L M, Sanchez-Amat A, Bhaya D, Lambowitz A M, Fire A Z. Direct CRISPR spacer acquisition from RNA by a natural reverse transcriptase-Cas1 fusion protein. Science, 2016, 351(6276): aad4234
CrossRef
Google scholar
|
[187] |
Bortesi L, Fischer R. The CRISPR/Cas9 system for plant genome editing and beyond. Biotechnology Advances, 2015, 33(1): 41–52
CrossRef
Google scholar
|
[188] |
Shalem O, Sanjana N E, Zhang F. High-throughput functional genomics using CRISPR-Cas9. Nature Reviews Genetics, 2015, 16(5): 299–311
CrossRef
Google scholar
|
[189] |
Sanchez-Rivera F J, Jacks T. Applications of the CRISPR-Cas9 system in cancer biology. Nature Reviews Cancer, 2015, 15(7): 387–395
CrossRef
Google scholar
|
[190] |
Nekrasov V, Staskawicz B, Weigel D, Jones J D, Kamoun S. Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nature Biotechnology, 2013, 31(8): 691–693
CrossRef
Google scholar
|
[191] |
Li J F, Norville J E, Aach J, McCormack M, Zhang D, Bush J, Church G M, Sheen J. Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nature Biotechnology, 2013, 31(8): 688–691
CrossRef
Google scholar
|
[192] |
Shan Q, Wang Y, Li J, Zhang Y, Chen K, Liang Z, Zhang K, Liu J, Xi J J, Qiu J L, Gao C. Targeted genome modification of crop plants using a CRISPR-Cas system. Nature Biotechnology, 2013, 31(8): 686–688
CrossRef
Google scholar
|
[193] |
Brooks C, Nekrasov V, Lippman Z B, Van Eck J. Efficient gene editing in tomato in the first generation using the clustered regularly interspaced short palindromic repeats/CRISPR-associated9 system. Plant Physiology, 2014, 166(3): 1292–1297
CrossRef
Google scholar
|
[194] |
Zhou H, Liu B, Weeks D P, Spalding M H, Yang B. Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice. Nucleic Acids Research, 2014, 42(17): 10903–10914
CrossRef
Google scholar
|
[195] |
Fauser F, Schiml S, Puchta H. Both CRISPR/Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana. Plant Journal, 2014, 79(2): 348–359
CrossRef
Google scholar
|
[196] |
Xing H L, Dong L, Wang Z P, Zhang H Y, Han C Y, Liu B, Wang X C, Chen Q J A. CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biology, 2014, 14(1): 327
CrossRef
Google scholar
|
[197] |
O’Geen H, Yu A S, Segal D J. How specific is CRISPR/Cas9 really? Current Opinion in Chemical Biology, 2015, 29: 72–78
CrossRef
Google scholar
|
[198] |
Schiml S, Puchta H. Revolutionizing plant biology: multiple ways of genome engineering by CRISPR/Cas. Plant Methods, 2016, 12(1): 8
CrossRef
Google scholar
|
[199] |
Lowder L G, Zhang D, Baltes N J, Paul III J W, Tang X, Zheng X, Voytas D F, Hsieh T F, Zhang Y, Qi Y A. CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiology, 2015, 169(2): 971–985
CrossRef
Google scholar
|
[200] |
Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu Y G. A Robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Molecular Plant, 2015, 8(8): 1274–1284
CrossRef
Google scholar
|
[201] |
Xie K, Minkenberg B, Yang Y. Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proceedings of the National Academy of Sciences of the United States of America, 2015, 112(11): 3570–3575
CrossRef
Google scholar
|
[202] |
Zhang Z, Mao Y, Ha S, Liu W, Botella J R, Zhu J K. A multiplex CRISPR/Cas9 platform for fast and efficient editing of multiple genes in Arabidopsis. Plant Cell Reports, 2016, 35(7): 1519–1533
CrossRef
Google scholar
|
[203] |
Vazquez-Vilar M, Bernabe-Orts J M, Fernandez-Del-Carmen A, Ziarsolo P, Blanca J, Granell A, Orzaez D. A modular toolbox for gRNA-Cas9 genome engineering in plants based on the GoldenBraid standard. Plant Methods, 2016, 12(1): 10
CrossRef
Google scholar
|
[204] |
Cermák T, Baltes N J, Cegan R, Zhang Y, Voytas D F. High-frequency, precise modification of the tomato genome. Genome Biology, 2015, 16(1): 232
CrossRef
Google scholar
|
[205] |
Li Z, Liu Z B, Xing A, Moon B P, Koellhoffer J P, Huang L, Ward R T, Clifton E, Falco S C, Cigan A M. Cas9-guide RNA directed genome editing in soybean. Plant Physiology, 2015, 169(2): 960–970
CrossRef
Google scholar
|
[206] |
Sun Y, Zhang X, Wu C, He Y, Ma Y, Hou H, Guo X, Du W, Zhao Y, Xia L. Engineering herbicide-resistant rice plants through CRISPR/Cas9-mediated homologous recombination of acetolactate synthase. Molecular Plant, 2016, 9(4): 628–631
CrossRef
Google scholar
|
[207] |
Liu L, Fan X D. CRISPR-Cas system: a powerful tool for genome engineering. Plant Molecular Biology, 2014, 85(3): 209–218
CrossRef
Google scholar
|
[208] |
Baltes N J, Voytas D F. Enabling plant synthetic biology through genome engineering. Trends in Biotechnology, 2015, 33(2): 120–131
CrossRef
Google scholar
|
[209] |
Nejat N, Rookes J, Mantri N L, Cahill D M. Plant-pathogen interactions: toward development of next-generation disease-resistant plants. Critical Reviews in Biotechnology, 2016, 22: 1–9
|
[210] |
Xu R F, Li H, Qin R Y, Li J, Qiu C H, Yang Y C, Ma H, Li L, Wei P C, Yang J B. Generation of inheritable and “transgene clean” targeted genome-modified rice in later generations using the CRISPR/Cas9 system. Scientific Reports, 2015, 5: 11491
CrossRef
Google scholar
|
[211] |
Kanchiswamy C N, Malnoy M, Velasco R, Kim J S, Viola R. Non-GMO genetically edited crop plants. Trends in Biotechnology, 2015, 33(9): 489–491
CrossRef
Google scholar
|
[212] |
Abbott A. Europe’s genetically edited plants stuck in legal limbo. Nature, 2015, 528(7582): 319–320
CrossRef
Google scholar
|
[213] |
Huang S, Weigel D, Beachy R N, Li J. A proposed regulatory framework for genome-edited crops. Nature Genetics, 2016, 48(2): 109–111
CrossRef
Google scholar
|
[214] |
Streatfield S J, Kushnir N, Yusibov V. Plant-produced candidate countermeasures against emerging and reemerging infections and bioterror agents. Plant Biotechnology Journal, 2015, 13(8): 1136–1159
CrossRef
Google scholar
|
[215] |
Chan H T, Daniell H. Plant-made oral vaccines against human infectious diseases—Are we there yet? Plant Biotechnology Journal, 2015, 13(8): 1056–1070
CrossRef
Google scholar
|
[216] |
Shahid N, Daniell H. Plant-based oral vaccines against zoonotic and non-zoonotic diseases. Plant Biotechnology Journal, 2016, 14(11): 2079–2099
CrossRef
Google scholar
|
[217] |
Fahlgren N, Bart R, Herrera-Estrella L, Rellán-Álvarez R, Chitwood D H, Dinneny J R. Plant scientists: GM technology is safe. Science, 2016, 351(6275): 824
CrossRef
Google scholar
|
/
〈 |
|
〉 |