Plant genetic engineering and genetically modified crop breeding: history and current status

Abstract

This review charts the major developments in the genetic manipulation of plant cells that have taken place since the first gene transfer experiments using Ti plasmids in 1983. Tremendous progress has been made in both our scientific understanding and technological capabilities since the first genetically modified (GM) crops were developed with single gene resistances to herbicides, insects, viruses, and the silencing of unde-sirable genes. Despite opposition in some parts of the world, the area planted with first generation GM crops has grown from 1.7 Mhm² in 1996 to 179.7 Mhm² hectares in 2015. The toolkit available for genetic modification has expanded greatly since 1996 and recently Nobel Laureates have called on Greenpeace to end their blanket opposition, and plant scientists have urged that consideration be given to the benefits of GM crops based on actual evidence. It is now possible to use GM to breed new crop cultivars resistant to a much wider range of pests and diseases, and to produce crops better able to adapt to climate change. The advent of new CRISPR-based technologies makes it possible to contemplate a much wider range of improvements based on transfer of new metabolic pathways and traits to improve nutritional quality, with a much greater degree of precision. Use of GM, sometimes in conjunction with other approaches, offers great opportunities for improving food quality, safety, and security in a changing world.

Keywords

plant transformation / transgene / genetic modification

1 Introduction

As a population of cells derived from neural crest cells, melanoblasts can normally migrate through the mesenchyme giving rise to melanocytes which are mainly distributed in the epidermis, hair-follicle and optic dermis shielding the skin from sunburn and maintaining hair color. When they arrive at the space between the neural tube and somites at the thoracic level, the neural crest cells first begin to migrate, differentiating into neurons and glial cells [ 1]. Twenty four hours later, the neural crest cells begin to migrate through the neural tube to form melanocyte precursors or melanoblasts, and at stage 20, melanoblasts pause at the “staging area” [ 2, 3]. Then the melanoblasts migrate to the dorsolateral space by the dorsolateral pathway under the complex regulation of developmental and migratory signals [ 4]. By stage 28, the distribution of melanoblasts in embryos resembles that in adults [ 5]. Recently, a few signal molecules that can enhance or constrain melanoblast migration have been identified [ 6– 10], but the molecular mechanisms responsible for the migration of melanoblasts requires further investigation.

Silky Fowl (SF) is famous in China for their special medical and health-promoting potentials, by virtue of the hyperpigmentation in their inner organs. As a natural mutant breed, SF shows extensive pigmentation, including periosteum, gonads, trachea, heart, liver, gizzard, cecum, perimysium and many other organs [ 11]. This rare and extensive hyperpigmentation in SF compared to the other higher vertebrates, provides us a very appropriate natural mutant model to investigate the mechanism of gene regulation during melanocyte development.

Previous studies have realized that the ectopic pattern of pigmentation in SF results from an abnormal migration of melanoblasts. Whereas in White Leghorn (WL) the melanoblast migration only takes the dorsolateral pathway between the ectoderm and somites, the melanoblasts in SF can migrate ventrally between the neural tube and somites in addition to dorsolateral migration [ 12]. At stage 20, melanoblasts have invaded the dorsolateral pathway in both SF and WL. By stage 22, melanoblasts in SF begin to invade the ventral path, whereas the melanoblasts in WL will have migrated only half-way along the dorsolateral path. By stage 24, melanoblasts already occupy the ventral path in SF, but not in WL. From stage 26, melanoblasts are dramatically increased in ventromedial positions in SF [ 5]. The abnormal migration of melanoblasts in SF is substantially correlated with the absence of some environmental barrier molecules which prohibit melanoblasts migration and can be identified by peanut agglutinin [ 13]. Some studies have shown that hyperpigmentation is regulated by Id and Fm genes [ 14] and Edn3 plays the role of Fm in controlling the hyperpigmentation [ 15], but the precise mechanism of gene regulation of hyperpigmentation in SF is still elusive.

In this study, global gene expression at the early embryo stages of the WL and SF were investigated using microarrays and the differentially expressed genes were identified. To the best of our knowledge, this is the first comparison of transcriptional expression during melanoblast development between WL and hyperpigmented SF. This report can help us to better understand the complex mechanism of melanoblast migration at the transcriptional level between these two chicken breeds.

2 Materials and methods

2.1 Ethics statement

Animal use and animal trials in this study have been approved by the Beijing Municipal Committee of Animal Management and the Ethics Committee of China Agricultural University.

2.2 Animals

The WL and SF eggs in this study were obtained from the chicken farm in China Agricultural University and incubated under humid conditions at 38°C. The embryos were collected and sampled at hatching day 3 (stage 20), day 3.5 (stage 22), day 4 (stage 24), and day 4.5 (stage 26). The body trunks from three embryos were sampled at the fore-limb bud and pooled together as a biological replicate. Three replicates were designed at each point. All samples were immersed in RNA fixer liquid (Tiangen Biotech Co., Ltd., China) and store at - 80°C.

2.3 RNA extraction

Total RNA from samples was isolated using Trizol according to the manufacturer’s protocol (Invitrogen, USA). The RNA was purified using the RNAeasy mini kit (Qiagen, USA) and RNA quality and purity were determined by NanoDrop ND-1000 spectrophotometer at 260/280 nm (NanoDrop Technologies, USA). The integrity of total RNA was detected using Agilent BioAnalyzer 2100 (Agilent Technologies, USA). Only the RNA samples with RNA Integrity Number (RIN) above 7 were used for the subsequent experiments.

2.4 cRNA synthesis

Two micrograms of purified total RNA was transcribed into cDNA using the Low RNA Input Linear Amplication kit (Agilent Technologies, USA). Then cDNA was transcribed into cRNA (complementary Ribonucleic Acid, in vitro transcription product with cDNA as a template) which was labeled with Cy3 NHS ester (GE healthcare, USA) using T7 RNA polymerase (Agilent Technologies). The labeled probes were purified with RNAeasy mini kit (Qiagen, USA) and the quality and quantity were determined by NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, USA).

2.5 Microarray hybridization and data analysis

The Cy3 labeled RNA samples were hybridized with the 44K Agilent chicken genome oligo microarray in triplicate [ 16]. The microarrays were incubated at 65°C for 17 h in Agilent’s hybridization chambers and rotated at 10 revolutions per minute. After washing with Expression Wash Buffer Kit (Agilent Technologies, USA), all the microarrays were scanned at 5 µm resolution using an Agilent G2565BA Microarray Scanner System (Agilent Technologies, USA) with an extended dynamic range (PMT 10/100). The expression data from all arrays were normalized and filtered using GeneSpring 7.3 and the significant difference was analyzed at a cut-off with P value less than 0.01 and fold change greater than 2. Gene Ontology (GO) and pathway analysis of significantly differentially expressed genes were performed using SBC Analysis System (http://sas.ebioservice.com/). Results are marked as significantly different at the P<0.05 level.

2.6 Quantitative analysis

Six genes were quantified and verified by q-PCR using SYBR Green Real-time PCR Master Mix (Takara, Japan). 0.5 µg of total RNA was transcribed into cDNA with the PrimerScript RT reagent Kit (Takara, Japan) according to the manufacturer’s instruction. Primers were designed by primer express 2.0 (Applied Biosystems, USA) and synthesized (Invitrogen USA). The primer sequences and product sizes were listed in Table 1. The cycling parameters of quantitative PCR amplification were as follows: initial heat-denature at 95°C for 15 min, 33 cycles at 95°C for 20 s, 62°C for 20 s, and 72°C for 20 s, and finally extension for 7 min at 72°C. A melting curve was preformed to exclude genomic DNA contamination and confirm the primer specificities. GAPDH was used as house-keeping gene in this assay. Data were collected from three biological replicates, and each biological replicate had three technical replicates. Statistical significance was set at P<0.05.

Tab.1 Primer sequences used for quantitative real-time PCR

Gene	Accession number	Primer sequences 5′ - 3′
GAPDH	NM_204305	Upper: AAAGTCCAAGTGGTGGCCATC Down: TTTCCCGTTCTCAGCCTTGAC
Edn3	AB235921	Upper: CAGCCTTCATTTCGGTGCTCT Down: TGCATCGGTCCTTCTCTGTTG
Ednrb2	NM_204120	Upper: TCCCCTTAGTATGCACTGGCA Down: ACGCCGTTTCATGTGGTCA
Scf	NM_205130	Upper: GCGCTGCCATTCCTTATGAAG Down: TGGATTCCCGCAGGAACTCT
Mc1r	NM_001031462	Upper: TCCGCCACATGGACAATGT Down: GCAGCGCATAGAAGATGGTGA
Pomc	NM_001031098	Upper: GAAAAGAAGGATGGAGGCTCG Down: CGATGGCGTTTTTGAACAGAG

3 Results

3.1 Differentially expressed genes in SF and WL

The genes differentially expressed between SF and WL at hatching day 3, 3.5, 4 and 4.5 were detected and analyzed. 1146, 951, 1089 and 974 up- and down-expressed genes were found at each time point, respectively (Fig. 1).

Fig.1 Numbers of differentially expressed genes between Silky Fowl and White Leghorn during critical times of melanocyte migration. Black bars: number of up-regulated genes in Silky Fowl; open bars: Numbers of down- regulated genes in Silky Fowl. Expression data were filtered by GeneSpring 10 using t-test (P<0.01, Fold change>2).

Full size|PPT slide

3.2 Gene ontology and biological pathways annotation of differentially expressed genes

Differentially expressed genes between SF and WL were categorized by gene ontology and six over represented GO categories between SF and WL were identified (Table 2). The GO terms of pigmentation during development and pigment metabolic process are significantly enriched functional categories in our study, and are mainly associated with melanocyte development. In addition, GO terms of positive regulation of immune system process (P = 0.0185) and response to biotic stimulus (P = 0.0071) were found to be differentially regulated between the two breeds. Moreover, there were significant differences in expressions of the genes associated with responses to other organism (P = 0.0013) and rhythmic behavior (P = 0.0099).

Tab.2 Overrepresented GO categories of differentially expressed genes between SF and WL

GO Id	Gene category	Hit	Enrichment test P-value
GO:0051707	Response to other organism	9	0.0013
GO:0048066	Pigmentation during development	4	0.0047
GO:0009607	Response to biotic stimulus	9	0.0071
GO:0007622	Rhythmic behavior	2	0.0099
GO:0002684	Positive regulation of immune system process	7	0.0185
GO:0042440	Pigment metabolic process	3	0.0491

By searching the Biocarta and KEGG (Kyoto Encyclopedia of Genes and Genomes) databases (http://www.genome.jp/kegg/pathway.html), seven significantly enriched pathways were mapped (Table 3). Melanogenesis was the most significantly over-represented pathway (P = 0.0015) in this study including seven differently expressed genes. The same five genes were detected in both the melanogenesis pathway and neuroactive ligand-receptor interaction pathway, owing to melanoblasts being derived from neural crest cells. Eight genes in the cytokine-cytokine receptor interaction pathway were identified. Other significantly over-represented pathways were retinol metabolism, ABC transporters, purine metabolism and the NOD-like receptor signaling pathway.

Tab.3 Significantly enriched pathways of differentially expressed genes between SF and WL

Pathway DB	Gene Category	Hit	Enrichment test P-value
Kegg	Melanogenesis	7	0.0015
	Neuroactive ligand-receptor interaction	12	0.0059
	Cytokine-cytokine receptor interaction	8	0.0151
	Retinol metabolism	3	0.0161
	ABC transporters	3	0.0251
	Purine metabolism	6	0.0288
	NOD-like receptor signaling pathway	3	0.0407

3.3 Differentially expressed genes related to melanocyte development

According to the annotations, a list of genes related to melanocyte development significantly differentially expressed between SF and WL was compiled. In general, higher expression of the dorsolateral genes Kitlg, Edn3, and Pomc was observed in SF compared to WL, at all four stages (Fig. 2). However, the expression of the melanocyte specific genes Mc1r, Ednrb2, Silv, and Dct was statistically different until day 4 between SF and WL. The expression of Agrp in WL was significant higher than that in SF at all four stages (Fig. 2). The results of microarray assay demonstrated that the eight differential expression genes show more than a twofold difference between SF and WL at one or more developmental stages.

Fig.2 Expression patterns of differentially expressed genes related to pigment development. Data are represented as mean±SD of replicates. The statistical variation between two chicken breeds was assessed by t-test (* means P<0.05, ** means P<0.01). Dark bars: gene expression level in Silky Fowl (SF); light bars: gene expression level in White Leghorn (WL).

Full size|PPT slide

3.4 Differentially expressed genes were verified by quantitative PCR

To verify the microarray data, quantitative real-time PCR was conducted. Five of the genes (Kitlg, Edn3, Ednrb2, Pomc and Mc1r) related to melanocyte development that showed differential expressions were selected for q-PCR. The results showed that there was strong coincidence with the microarray data (Table 4), with only slightly different fold-changes.

Tab.4 Detection of expression of six genes by microarray and quantitative real-time PCR

Gene	D3 SF/WL	D3.5 SF/WL	D4 SF/WL	D4.5 SF/WL
Microarray	q-PCR	Microarray	q-PCR	Microarray	q-PCR	Microarray	q-PCR
Kitlg	2.2944	–	2.39404	1.6410	2.0823	–	1.9673	1.3421
Edn3	2.1170	2.1744	2.5549	2.7336	2.2183	5.6704	2.1193	3.6986
Ednrb2	–	–	–	–	2.4260	7.3574	1.7654	2.4993
Pomc	–	–	3.2155	1.4718	3.0032	2.2160	–	–
Mc1r	–	–	–	–	1.7667	6.9335	2.0253	3.7251

Note: D3, day 3; D3.5, day 3.5; D4, day 4; D4.5, day 4.5.

4 Discussion

The thoracic region of the chicken embryo is an important target for studying the mechanism of melanocyte development and most of the research findings for melanocyte development come from the studies at the thoracic level in avian embryos [ 11, 12]. Melanocyte development depends on precise temporal and spatial gene regulation during embryogenesis. SF embryos show abnormal migration of melanoblasts, during embryogenesis and the gene expression profiles at four representative stages of melanoblast migration were investigated and analyzed, in order to provide information regarding melanocyte development by comparison with the process in WL.

Previously, we reported the use of a semiquantitative method to investigate the expression profiles of 13 genes which are relevant to the development of melanocytes from day 2.5 to 15 in SF and WL [ 17]. Our results showed that Agrp plays an important role in the process of melanin synthesis. But, there are several shortcomings in the semiquantitative method for analysis. First, the circle number in semiquantitative analysis is very difficult to control. Second, the expression level varies for different genes, stages and chicken breeds. Therefore, the difference between many high-expressed and low-expressed genes will not be found. In this study, a 44K Agilent chicken whole genome wide oligo nucleotide (60-mer) microarray was adopted to investigate the molecular events during melanocyte development in the thoracic region in SF compared with WL. Unlike a short oligonucleotide library, a long oligo nucleotide microarray can provide significantly improved sensitivity and can even detect one single transcript in one cell [ 18]. Previous studies have shown that the 44K Agilent chicken long oligonucleotide microarray can provide reliable results by detecting different chicken tissues [ 19]. Moreover, in order to improve the accuracy, three tissues from different individuals were pooled together for RNA extraction and hybridization in this study. There were two reasons for pooling: (1) tissue derived from a single embryos at these stages was too small to extract sufficient RNA; (2) pooling reduced the effect of individual variation, but highlighted the differences between breeds [ 20, 21].

The key objective of this study was to identify candidate genes relevant to melanocyte development. According to functional annotation, the genes Kitlg, Edn3, Ednrb2, Pomc, Mc1r, Agrp, Silv and Dct were identified and shown to be significantly associated with the development of melanocytes. Kitlg is produced by the dermomyotome, which could direct the melanoblasts to the dorsolateral pathway and induce high mitogenesis of melanoblasts by binding with the Kit receptor [ 22]. In mouse, the expression of Kitlg has been detected in the dermomyotome, and the Kit receptor is expressed on the cell surface of melanoblasts. After binding, Kitlg can assist the melanoblast migration to the dorsal pathway [ 23]. However, in the avian embryo, some researchers found Kitlg is not produced by the dermomyotome but by the ectoderm after stage 25 when melanoblast migration has finished [ 24]. Moreover, they suggested that Kitlg has no role in regulating the melanoblast migration in chicken [ 12, 24]. In our study, however, the expression of Kitlg mRNA was detected no later than stage 20, and showed significantly increased expressed in SF, but the expression level gradually declined in both chicken breeds. It is suggested, therefore, that Kitlg may be involved in the atypical migration of melanocytes in SF in early embryo development.

By combination with Ednrb2, Edn3 can regulate substantially the migration and proliferation of melanoblasts [ 25]. From the results of mice experiment, End3 was found to be the necessary factor for the specialization of melanoblasts, which can collaborate with the Kit signal pathway to regulate melanoblast migration. In avians, Edn3 is expressed by the ectoderm and dermomyotome during early embryo development [ 26]. Initially, Ednrb was found in the neural crest cells, and then decreased Ednrb expression and increased Ednrb2 expression were detected in melanoblasts when they began to migrate in the dorsal pathway. So Edn3 plays a positive role in attracting melanoblasts into the dorsolateral space [ 10]. Besides the effect on melanoblast migration, several studies discovered that Edn3 could obviously promote proliferation and maintain survival of melanoblasts, which was closely related to hyperpigmentation of internal organs in SF [ 27]. Our results indicated that the Edn3 significantly increased from day 3, which could facilitate the migration, survival and differentiation of the melanoblasts in SF. In view of the sample limitation in this study, the question whether End3 is expressed in other embryo tissues that results in wide distribution of melanocytes need to be further investigated. In contrast, the delayed expression of Ednrb2 in embryos probably resulted from the fact that melanonblasts increased significantly until day 4 post incubation [ 5].

Pomc is a precursor peptide, which could produce numerous peptides by proteolytic action [ 28]. Two peptides from Pomc, ACTH and α-MSH can stimulate melanogenesis, dendricity and proliferation of melanocytes by interaction with their surface receptor Mc1r [ 29, 30]. After binding, the cAMP or PKA signal pathways can be activated, followed by stimulated expression of Mitf which is the most important factor in the multiple stages of melanocyte development. In our study, overexpression of Pomc on day 3.5 and 4 post incubation was detected and might have resulted in an increase in α-MSH. Additionally, it is noteworthy that increased expression of Mc1R was detected on day 4 and 4.5 post incubation, and the increased α-MSH could interact with Mc1R and play a role in the development of melanocytes. Agrp is an antagonist of Mc3R and Mc4R in mammals, but would be a physiological antagonist of Mc1R in chicken [ 31]. We found that Agrp expression in WL was significantly higher than that in SF, which can result in no pigmentation in WL but obvious pigmentation in multiple tissues in SF.

Silv is one of the main structural fibrillar components for the formation of melanosomes [ 32]. We found that in SF, Silv expression was obviously increased from day 3.5 to day 4.5, which is coincides with the time of melanoblast migration and location. Dct is a key enzyme during melanin synthesis and controls the types and qualities of melanin in melanocytes [ 33, 34]. In our study, the increase of Dct in SF was detected which would be helpful for the demand for melanin synthesis at the late stages of embryo development. The results indicated that high expressions of Silv and Dct in SF embryos occurred after 4 days post incubation when the melanocytes significantly increased, and similar changes to Ednrb2 and Mc1R appeared.

There are undoubtedly significant differences in genes expression during melanocyte development between SF and WL, but it is intriguing to note the differential expression between the two in the genes associated with the immune response. The results of GO annotation showed that innate immune genes were expressed in the SF embryo, such as the immune defense genes Defb1, Gal, Tap2 and IL-2rg, whereas some downregulated immune response genes were also observed including IRF7, IL18, Cd3e and Pldn (Data not shown). In addition, the Kegg pathway analysis showed that the differentially expressed genes were mainly involved in cytokine-cytokine receptor interaction and the NOD-like receptor signaling pathway, which relate to many biological processes. These results suggest that the big differences in immune genes expression are possibly related to the substantial melanoblasts migration in early SF embryo development, resulting in the aberrant development of the immune systems in SF. However, the immune defense genes were upregulated as a result, which could shield against pathogens infection or external stress. This suggestion needs further studies to be confirmed.

5 Conclusions

This study first dissected the gene expression differences between hyperpigmented SF and normal WL using microarray analysis. On account of the nonsufficient probes, several genes related to melanocyte development were found during embryo development. Other genes discovered in this study will help us to understand the influence of hyperpigmentation on other tissue development in SF.

References

[1] Griffith F. The significance of pneumococcal types. Journal of Hygiene, 1928, 27(2): 113–159

[2] Avery O T, Macleod C M, McCarty M. Studies on the chemical nature of the substance inducing transformation of pneumococcal types: induction of transformation by a desoxyribonucleic acid fraction isolated from pneumococcus type III. Journal of Experimental Medicine, 1944, 79(2): 137–158

[3] Jackson D A, Symons R H, Berg P. Biochemical method for inserting new genetic information into dna of simian virus 40: circular SV40 DNA molecules containing lambda phage genes and the galactose operon of Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America, 1972, 69(10): 2904–2909

[4] Cohen S N, Chang A C, Boyer H W, Helling R B. Construction of biologically functional bacterial plasmids in vitro. Proceedings of the National Academy of Sciences of the United States of America, 1973, 70(11): 3240–3244

[5] Gilbert W, Maxam A. The nucleotide sequence of the lac operator. Proceedings of the National Academy of Sciences of the United States of America, 1973, 70(12): 3581–3584

[6] Sanger F, Nicklen S, Coulson A R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America, 1977, 74(12): 5463–5467

[7] ISAAA. Biotech/GM crops planted on two billion hectares from 1996 to 2015. http://www.isaaa.org/kc/cropbiotechupdate/specialedition/2016/2016-04-13-cbu.html, 2016–10–12

[8] Sussex I M. The scientific roots of modern plant biotechnology. Plant Cell, 2008, 20(5): 1189–1198

[9] Miki B, McHugh S. Selectable marker genes in transgenic plants: applications, alternatives and biosafety. Journal of Biotechnology, 2004, 107(3): 193–232

[10] Gilissen L J, Metz P L, Stiekema W J, Nap J P. Biosafety of E. coli β-glucuronidase (GUS) in plants. Transgenic Research, 1998, 7(3): 157–163

[11] Shimomura O, Johnson F H, Saiga Y. Extraction, purification and properties of aequorin, a bioluminescent protein from the luminous hydromedusan, Aequorea. Journal of Cellular and Comparative Physiology, 1962, 59(3): 223–239

[12] Cubitt A B, Heim R, Adams S R, Boyd A E, Gross L A, Tsien R Y. Understanding, improving and using green fluorescent proteins. Trends in Biochemical Sciences, 1995, 20(11): 448–455

[13] Siemering K R, Golbik R, Sever R, Haseloff J. Mutations that suppress the thermosensitivity of green fluorescent protein. Current Biology, 1996, 6(12): 1653–1663

[14] Stewart C N Jr. The utility of green fluorescent protein in transgenic plants. Plant Cell Reports, 2001, 20(5): 376–382

[15] Tsien R Y. The green fluorescent protein. Annual Review of Biochemistry, 1998, 67(1): 509–544

[16] Chalfie M, Tu Y, Euskirchen G, Ward W W, Prasher D C. Green fluorescent protein as a marker for gene expression. Science, 1994, 263(5148): 802–805

[17] Wang X, Xue L, Sun J, Zuo J. The Arabidopsis BE1 gene, encoding a putative glycoside hydrolase localized in plastids, plays crucial roles during embryogenesis and carbohydrate metabolism. Journal of Integrative Plant Biology, 2010, 52(3): 273–288

[18] Chiu W, Niwa Y, Zeng W, Hirano T, Kobayashi H, Sheen J. Engineered GFP as a vital reporter in plants. Current Biology, 1996, 6(3): 325–330

[19] Aflalo C. Biologically localized firefly luciferase: a tool to study cellular processes. International Review of Cytology, 1991, 130: 269–323

[20] Ow D W, De Wet J R, Helinski D R, Howell S H, Wood K V, Deluca M. Transient and stable expression of the firefly luciferase gene in plant cells and transgenic plants. Science, 1986, 234(4778): 856–859

[21] Millar A, Short S, Hiratsuka K, Chua N H, Kay S. Firefly luciferase as a reporter of regulated gene expression in higher plants. Plant Molecular Biology Reporter, 1992, 10(4): 324–337

[22] McNabb D S, Reed R, Marciniak R A. Dual luciferase assay system for rapid assessment of gene expression in Saccharomyces cerevisiae. Eukaryotic Cell, 2005, 4(9): 1539–1549

[23] Bevan M W, Flavell R B, Chilton M D. A chimaeric antibiotic resistance gene as a selectable marker for plant cell transformation. Nature, 1983, 304(5922): 184–187

[24] Waldron C, Murphy E B, Roberts J L, Gustafson G D, Armour S L, Malcolm S K. Resistance to hygromycin B: a new marker for plant transformation studies. Plant Molecular Biology, 1985, 5(2): 103–108

[25] Block M D, Botterman J, Vandewiele M, Dockx J, Thoen C, Gossele V, Movva N R, Thompson C, Montagu M V, Leemans J. Engineering herbicide resistance in plants by expression of a detoxifying enzyme. EMBO Journal, 1987, 6(9): 2513–2518

[26] Sawasaki T, Seki M, Anzai H, Irifune K, Morikawa H. Stable transformation of Arabidopsis with the bar gene using particle bombardment. Transgenic Research, 1994, 3(5): 279–286

[27] Cao J, Duan X, McEiroy D, Wu R. Regeneration of herbicide resistant transgenic rice plants following microprojectile-mediated transformation of suspension culture cells. Plant Cell Reports, 1992, 11(11): 586–591

[28] Zuo J, Niu Q W, Ikeda Y, Chua N H. Marker-free transformation: increasing transformation frequency by the use of regeneration-promoting genes. Current Opinion in Biotechnology, 2002, 13(2): 173–180

[29] Kunkel T, Niu Q W, Chan Y S, Chua N H. Inducible isopentenyl transferase as a high-efficiency marker for plant transformation. Nature Biotechnology, 1999, 17(9): 916–919

[30] Covey S N, Lomonossoff G P, Hull R. Characterisation of cauliflower mosaic virus DNA sequences which encode major polyadenylated transcripts. Nucleic Acids Research, 1981, 9(24): 6735–6748

[31] Odell J T, Nagy F, Chua N H. Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature, 1985, 313(6005): 810–812

[32] Guilley H, Dudley R K, Jonard G, Balazs E, Richards K E. Transcription of cauliflower mosaic virus DNA: detection of promoter sequences, and characterization of transcripts. Cell, 1982, 30(3): 763–773

[33] Fang R X, Nagy F, Sivasubramaniam S, Chua N H. Multiple cis regulatory elements for maximal expression of the cauliflower mosaic virus 35S promoter in transgenic plants. Plant Cell, 1989, 1(1): 141–150

[34] Kay R, Chan A, Daly M, McPherson J. Duplication of CaMV 35S promoter sequences creates a strong enhancer for plant genes. Science, 1987, 236(4806): 1299–1302

[35] Yan L, Wei S, Wu Y, Hu R, Li H, Yang W, Xie Q. High-efficiency genome editing in Arabidopsis using YAO promoter-driven CRISPR/Cas9 system. Molecular Plant, 2015, 8(12): 1820–1823

[36] Wilkinson J E, Twell D, Lindsey K. Activities of CaMV 35S and nos promoters in pollen: implications for field release of transgenic plants. Journal of Experimental Botany, 1997, 48(2): 265–275

[37] McElroy D, Zhang W, Cao J, Wu R. Isolation of an efficient actin promoter for use in rice transformation. Plant Cell, 1990, 2(2): 163–171

[38] He C, Lin Z, McElroy D, Wu R. Identification of a rice actin2 gene regulatory region for high-level expression of transgenes in monocots. Plant Biotechnology Journal, 2009, 7(3): 227–239

[39] Jang I C, Choi W B, Lee K H, Song S I, Nahm B H, Kim J K. High-level and ubiquitous expression of the rice cytochrome c gene OsCc1 and its promoter activity in transgenic plants provides a useful promoter for transgenesis of monocots. Plant Physiology, 2002, 129(4): 1473–1481

[40] Jeon J S, Lee S, Jung K H, Jun S H, Kim C, An G. Tissue-preferential expression of a rice α-tubulin gene, OsTubA1, mediated by the first intron. Plant Physiology, 2000, 123(3): 1005–1014

[41] Lu J, Sivamani E, Li X, Qu R. Activity of the 5′ regulatory regions of the rice polyubiquitin rubi3 gene in transgenic rice plants as analyzed by both GUS and GFP reporter genes. Plant Cell Reports, 2008, 27(10): 1587–1600

[42] Wang J, Oard J H. Rice ubiquitin promoters: deletion analysis and potential usefulness in plant transformation systems. Plant Cell Reports, 2003, 22(2): 129–134

[43] Christensen A H, Sharrock R A, Quail P H. Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Molecular Biology, 1992, 18(4): 675–689

[44] Schledzewski K, Mendel R. Quantitative transient gene expression: comparison of the promoters for maize polyubiquitin1, rice actin1, maize-derived Emu and CaMV 35S in cells of barley, maize and tobacco. Transgenic Research, 1994, 3(4): 249–255

[45] An G. Development of plant promoter expression vectors and their use for analysis of differential activity of nopaline synthase promoter in transformed tobacco cells. Plant Physiology, 1986, 81(1): 86–91

[46] Ebert P R, Ha S B, An G. Identification of an essential upstream element in the nopaline synthase promoter by stable and transient assays. Proceedings of the National Academy of Sciences of the United States of America, 1987, 84(16): 5745–5749

[47] Jeong H J, Jung K H. Rice tissue-specific promoters and condition-dependent promoters for effective translational application. Journal of Integrative Plant Biology, 2015, 57(11): 913–924

[48] Potenza C, Aleman L, Sengupta-Gopalan C. Targeting transgene expression in research, agricultural, and environmental applications: promoters used in plant transformation. In Vitro Cellular & Developmental Biology-Plant, 2004, 40(1): 1–22

[49] Saijo T, Nagasawa A. Development of a tightly regulated and highly responsive copper-inducible gene expression system and its application to control of flowering time. Plant Cell Reports, 2014, 33(1): 47–59

[50] Aoyama T, Chua N H. A glucocorticoid-mediated transcriptional induction system in transgenic plants. Plant Journal, 1997, 11(3): 605–612

[51] Zuo J, Niu Q W, Chua N H. An estrogen receptor-based transactivator XVE mediates highly inducible gene expression in transgenic plants. Plant Journal, 2000, 24(2): 265–273

[52] Deveaux Y, Peaucelle A, Roberts G R, Coen E, Simon R, Mizukami Y, Traas J, Murray J A, Doonan J H, Laufs P. The ethanol switch: a tool for tissue-specific gene induction during plant development. Plant Journal, 2003, 36(6): 918–930

[53] Wang X, Niu Q W, Teng C, Li C, Mu J, Chua N H, Zuo J. Overexpression of PGA37/MYB118 and MYB115 promotes vegetative-to-embryonic transition in Arabidopsis. Cell Research, 2009, 19(2): 224–235

[54] Okuzaki A, Konagaya K, Nanasato Y, Tsuda M, Tabei Y. Estrogen-inducible GFP expression patterns in rice (Oryza sativa L.). Plant Cell Reports, 2011, 30(4): 529–538

[55] Ambavaram M M, Basu S, Krishnan A, Ramegowda V, Batlang U, Rahman L, Baisakh N, Pereira A. Coordinated regulation of photosynthesis in rice increases yield and tolerance to environmental stress. Nature Communications, 2014, 5: 5302

[56] Caddick M X, Greenland A J, Jepson, Krause K P, Qu N, Riddell K V, Salter M G, Schuch W, Sonnewald U, Tomsett A B. An ethanol inducible gene switch for plants used to manipulate carbon metabolism. Nature Biotechnology, 1998, 16(2): 177–180

[57] Gatz C, Frohberg C, Wendenburg R. Stringent repression and homogeneous de-repression by tetracycline of a modified CaMV 35S promoter in intact transgenic tobacco plants. Plant Journal, 1992, 2(3): 397–404

[58] Cocking E C. Turning point article plant protoplasts. In Vitro Cellular & Developmental Biology-Plant, 2000, 36(2): 77–82

[59] Johnson C M, Carswell G K, Shillito R D. Direct gene transfer via polyethylene glycol. Journal of Tissue Culture Methods, 1989, 12(4): 127–133

[60] Davey M R, Anthony P, Power J B, Lowe K C. Plant protoplasts: status and biotechnological perspectives. Biotechnology Advances, 2005, 23(2): 131–171

[61] Klein T M, Wolf E D, Wu R, Sanford J C. High-velocity microprojectiles for delivering nucleic acids into living cells. Nature, 1987, 327(6117): 70–73

[62] Wang K, Drayton P, Frame B, Dunwell J, Thompson J. Whisker-mediated plant transformation: an alternative technology. In Vitro Cellular & Developmental Biology-Plant, 1995, 31(2): 101–104

[63] Potrykus I. Gene transfer to plants: assessment and perspectives. Physiologia Plantarum, 1990, 79(1): 125–134

[64] Bock R. Engineering plastid genomes: methods, tools, and applications in basic research and biotechnology. Annual Review of Plant Biology, 2015, 66(1): 211–241

[65] Fraley R T, Rogers S G, Horsch R B, Sanders P R, Flick J S, Adams S P, Bittner M L, Brand L A, Fink C L, Fry J S, Galluppi G R, Goldberg S B, Hoffmann N L, Woo S C. Expression of bacterial genes in plant cells. Proceedings of the National Academy of Sciences of the United States of America, 1983, 80(15): 4803–4807

[66] Herrera-Estrella L, Depicker A, Van Montagu M, Schell J. Expression of chimaeric genes transferred into plant cells using a Ti-plasmid-derived vector. Nature, 1983, 303(5914): 209–213

[67] Hoekema A, Hirsch P R, Hooykaas P J J, Schilperoort R A. A binary plant vector strategy based on separation of vir- and T-region of the Agrobacterium tumefaciens Ti-plasmid. Nature, 1983, 303(5913): 179–180

[68] Bevan M. Binary Agrobacterium vectors for plant transformation. Nucleic Acids Research, 1984, 12(22): 8711–8721

[69] Lee L Y, Gelvin S B. T-DNA binary vectors and systems. Plant Physiology, 2008, 146(2): 325–332

[70] Clough S J, Bent A F. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal, 1998, 16(6): 735–743

[71] Saha P, Blumwald E. Spike-dip transformation of Setaria viridis. Plant Journal, 2016, 86(1): 89–101

[72] Nguyen T, Liu X, Derocher J. Floral dip method for transformation of camelina. United States of America, 2014, 8779238

[73] Ow D W. The long road to recombinase-mediated plant transformation. Plant Biotechnology Journal, 2016, 14(2): 441–447

[74] Zuo J, Niu Q W, Moller S G, Chua N H. Chemical-regulated, site-specific DNA excision in transgenic plants. Nature Biotechnology, 2001, 19(2): 157–161

[75] Terada R, Urawa H, Inagaki Y, Tsugane K, Iida S. Efficient gene targeting by homologous recombination in rice. Nature Biotechnology, 2002, 20(10): 1030–1034

[76] Steinert J, Schiml S, Puchta H. Homology-based double-strand break-induced genome engineering in plants. Plant Cell Reports, 2016, 35(7): 1429–1438

[77] Townsend J A, Wright D A, Winfrey R J, Fu F, Maeder M L, Joung J K, Voytas D F. High-frequency modification of plant genes using engineered zinc-finger nucleases. Nature, 2009, 459(7245): 442–445

[78] Funke T, Han H, Healy-Fried M L, Fischer M, Schonbrunn E. Molecular basis for the herbicide resistance of Roundup Ready crops. Proceedings of the National Academy of Sciences of the United States of America, 2006, 103(35): 13010–13015

[79] Temple W. Review of the evidence relating to glyphosate and carcinogenicity. http://www.epa.govt.nz/Publications/EPA_glyphosate_review.pdf, 2016–10–12

[80] Perlak F J, Fuchs R L, Dean D A, McPherson S L, Fischhoff D A. Modification of the coding sequence enhances plant expression of insect control protein genes. Proceedings of the National Academy of Sciences of the United States of America, 1991, 88(8): 3324–3328

[81] Höfte H, Whiteley H R. Insecticidal crystal proteins of Bacillus thuringiensis. Microbiological Reviews, 1989, 53(2): 242–255

[82] Cao J, Zhao J Z, Tang D, Shelton M, Earle D. Broccoli plants with pyramided cry1Ac and cry1C Bt genes control diamondback moths resistant to Cry1A and Cry1C proteins. Theoretical and Applied Genetics, 2002, 105(2–3): 258–264

[83] McGaughey W H, Whalon M E. Managing insect resistance to Bacillus thuringiensis toxins. Science, 1992, 258(5087): 1451–1455

[84] Ricroch A E, Hénard-Damave M C. Next biotech plants: new traits, crops, developers and technologies for addressing global challenges. Critical Reviews in Biotechnology, 2016, 36(4): 675–690

[85] Fitch M M M, Manshardt R M, Gonsalves D, Slightom J L, Sanford J C. Virus resistance papaya derived from tissue bombarded with the coat protein gene of papaya ringspot virus. Nature Biotechnology, 1992, 10(11): 1466–1472

[86] Geo Pie Project #8. Genetically engineered foods: plant virus resistance. https://scholarworks.iupui.edu/bitstream/handle/1805/813/GE%20plant%20virus%20resistance.pdf, 2016–10–12

[87] Scorza R, Kriss A B, Callahan A M, Webb K, Demuth M, Gottwald T. Spatial and temporal assessment of pollen- and seed-mediated gene flow from genetically engineered plum Prunus domestica. PLoS One, 2013, 8(10): e75291

[88] Baulcombe D. Viruses and gene silencing in plants. in Calisher C H, Horzinek M C, eds. 100 years of virology: The birth and growth of a discipline. Vienna: Springer Vienna, 1999, 189–201

[89] Sudarshana M R, Roy G, Falk B W. Methods for engineering resistance to plant viruses. in Ronald P C, eds. Plant-pathogen interactions: methods and protocols. 1nd. Totowa NJ: Humana Press, 2007, 183–195

[90] Halpin C. Gene stacking in transgenic plants—the challenge for 21st century plant biotechnology. Plant Biotechnology Journal, 2005, 3(2): 141–155

[91] James C. Global status of commercialized biotech/GM crops. ISAAA Brief No. 49. New York: The International Service for the Acquisition of Agri-biotech Applications (ISAAA), 2014

[92] James C. Preview: global status of commercialized transgenic crops. ISAAA Briefs No. 30. New York: The International Service for the Acquisition of Agri-biotech Applications (ISAAA), 2003

[93] Casini A, Storch M, Baldwin G S, Ellis T. Bricks and blueprints: methods and standards for DNA assembly. Nature Reviews Molecular Cell Biology, 2015, 16(9): 568–576

[94] Ow D W. Recombinase-directed plant transformation for the post-genomic era. in Town C, eds. Functional genomics. Dordrecht: Springer Netherlands, 2002, 183–200

[95] Li Z, Xing A, Moon B P, McCardell R P, Mills K, Falco S C. Site-specific integration of transgenes in soybean via recombinase-mediated DNA cassette exchange. Plant Physiology, 2009, 151(3): 1087–1095

[96] Li Z, Moon B P, Xing A, Liu Z B, McCardell R P, Damude H G, Falco S C. Stacking multiple transgenes at a selected genomic site via repeated recombinase-mediated DNA cassette exchanges. Plant Physiology, 2010, 154(2): 622–631

[97] Depicker A, Herman L, Jacobs A, Schell J, Van Montagu M. Frequencies of simultaneous transformation with different T-DNAs and their relevance to the Agrobacterium/plant cell interaction. Molecular & General Genetics, 1985, 201(3): 477–484

[98] De Block M, Debrouwer D. Two T-DNA’s co-transformed into Brassica napus by a double Agrobacterium tumefaciens infection are mainly integrated at the same locus. Theoretical and Applied Genetics, 1991, 82(3): 257–263

[99] McCormac A C, Fowler M R, Chen D F, Elliott M C. Efficient co-transformation of Nicotiana tabacum by two independent T-DNAs, the effect of T-DNA size and implications for genetic separation. Transgenic Research, 2001, 10(2): 143–155

[100] Li L, Zhou Y, Cheng X, Sun J, Marita J M, Ralph J, Chiang V L. Combinatorial modification of multiple lignin traits in trees through multigene cotransformation. Proceedings of the National Academy of Sciences of the United States of America, 2003, 100(8): 4939–4944

[101] Hu W J, Harding S A, Lung J, Popko J L, Ralph J, Stokke D D, Tsai C J, Chiang V L. Repression of lignin biosynthesis promotes cellulose accumulation and growth in transgenic trees. Nature Biotechnology, 1999, 17(8): 808–812

[102] Ye X, Al-Babili S, Kloti A, Zhang J, Lucca P, Beyer P, Potrykus I. Engineering the provitamin A (β-carotene) biosynthetic pathway into (carotenoid-free) rice endosperm. Science, 2000, 287(5451): 303–305

[103] Datta K, Baisakh N, Oliva N, Torrizo L, Abrigo E, Tan J, Rai M, Rehana S, Al-Babili S, Beyer P, Potrykus I, Datta S K. Bioengineered ‘golden’ indica rice cultivars with β-carotene metabolism in the endosperm with hygromycin and mannose selection systems. Plant Biotechnology Journal, 2003, 1(2): 81–90

[104] Paine J A, Shipton C A, Chaggar S, Howells R M, Kennedy M J, Vernon G, Wright S Y, Hinchliffe E, Adams J L, Silverstone A L, Drake R. Improving the nutritional value of Golden Rice through increased pro-vitamin A content. Nature Biotechnology, 2005, 23(4): 482–487

[105] Zhu C, Naqvi S, Breitenbach J, Sandmann G, Christou P, Capell T. Combinatorial genetic transformation generates a library of metabolic phenotypes for the carotenoid pathway in maize. Proceedings of the National Academy of Sciences of the United States of America, 2008, 105(47): 18232–18237

[106] Joel A. 107 Nobel laureates sign letter blasting Greenpeace over GMOs. https://www.washingtonpost.com/news/speaking-of-science/wp/2016/06/29/more-than-100-nobel-laureates-take-on-greenpeace-over-gmo-stance/, 2016–06–30

[107] Westhoff P, Herrmann R G. Complex RNA maturation in chloroplasts. The psbB operon from spinach. European Journal of Biochemistry, 1988, 171(3): 551–564

[108] Zhou F, Karcher D, Bock R. Identification of a plastid intercistronic expression element (IEE) facilitating the expression of stable translatable monocistronic mRNAs from operons. Plant Journal, 2007, 52(5): 961–972

[109] Nakashita H, Arai Y, Shikanai T, Doi Y, Yamaguchi I. Introduction of bacterial metabolism into higher plants by polycistronic transgene expression. Bioscience, Biotechnology, and Biochemistry, 2001, 65(7): 1688–1691

[110] Magee A M, Horvath E M, Kavanagh T A. Pre-screening plastid transgene expression cassettes in Escherichia coli may be unreliable as a predictor of expression levels in chloroplast-transformed plants. Plant Science, 2004, 166(6): 1605–1611

[111] Lu Y, Rijzaani H, Karcher D, Ruf S, Bock R. Efficient metabolic pathway engineering in transgenic tobacco and tomato plastids with synthetic multigene operons. Proceedings of the National Academy of Sciences of the United States of America, 2013, 110(8): E623–E632

[112] de Felipe P. Skipping the co-expression problem: the new 2A “CHYSEL” technology. Genetic Vaccines and Therapy, 2004, 2(1): 13

[113] Zhao Q, Liu M, Tan M, Gao J, Shen Z. Expression of Cry1Ab and Cry2Ab by a polycistronic transgene with a self-cleavage peptide in rice. PLoS One, 2014, 9(10): e110006

[114] Belhaj K, Chaparro Garcia A, Kamoun S, Patron N J, Nekrasov V. Editing plant genomes with CRISPR/Cas9. Current Opinion in Biotechnology, 2015, 32: 76–84

[115] Auer T O, Duroure K, De Cian A, Concordet J P, Del Bene F. Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Research, 2014, 24(1): 142–153

[116] Wang Y, Cheng X, Shan Q, Zhang Y, Liu J, Gao C, Qiu J L. Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nature Biotechnology, 2014, 32(9): 947–951

[117] Ecker J R, Davis R W. Inhibition of gene expression in plant cells by expression of antisense RNA. Proceedings of the National Academy of Sciences of the United States of America, 1986, 83(15): 5372–5376

[118] Smith C J S, Watson C F, Ray J, Bird C R, Morris P C, Schuch W, Grierson D. Antisense RNA inhibition of polygalacturonase gene expression in transgenic tomatoes. Nature, 1988, 334(6184): 724–726

[119] Sheehy R E, Pearson J, Brady C J, Hiatt W R. Molecular characterization of tomato fruit polygalacturonase. Molecular & General Genetics, 1987, 208(1): 30–36

[120] van der Krol A R, Lenting P E, Veenstra J, van der Meer I M, Koes R E, Gerats A G M, Mol J N M, Stuitje A R. An anti-sense chalcone synthase gene in transgenic plants inhibits flower pigmentation. Nature, 1988, 333(6176): 866–869

[121] Smith C J, Watson C F, Bird C R, Ray J, Schuch W, Grierson D. Expression of a truncated tomato polygalacturonase gene inhibits expression of the endogenous gene in transgenic plants. Molecular & General Genetics, 1990, 224(3): 477–481

[122] Smith C J S, Watson C F, Morris P C, Bird C R, Seymour G B, Gray J E, Arnold C, Tucker G A, Schuch W, Harding S, Grierson D. Inheritance and effect on ripening of antisense polygalacturonase genes in transgenic tomatoes. Plant Molecular Biology, 1990, 14(3): 369–379

[123] van der Krol A R, Mur L A, Beld M, Mol J N, Stuitje A R. Flavonoid genes in petunia: addition of a limited number of gene copies may lead to a suppression of gene expression. Plant Cell, 1990, 2(4): 291–299

[124] Jorgensen R. Altered gene expression in plants due totrans interactions between homologous genes. Trends in Biotechnology, 1990, 8: 340–344

[125] Grierson D, Fray R G, Hamilton A J, Smith C J S, Watson C F. Does co-suppression of sense genes in transgenic plants involve antisense RNA? Trends in Biotechnology, 1991, 9(1): 122–123

[126] Sijen T, Wellink J, Hiriart J B, Van Kammen A. RNA-mediated virus resistance: role of repeated transgenes and delineation of targeted regions. Plant Cell, 1996, 8(12): 2277–2294

[127] Gazzani S, Lawrenson T, Woodward C, Headon D, Sablowski R. A link between mRNA turnover and RNA interference in Arabidopsis. Science, 2004, 306(5698): 1046–1048

[128] Thran M, Link K, Sonnewald U. The Arabidopsis DCP2 gene is required for proper mRNA turnover and prevents transgene silencing in Arabidopsis. Plant Journal, 2012, 72(3): 368–377

[129] Herr A J, Molnar A, Jones A, Baulcombe D C. Defective RNA processing enhances RNA silencing and influences flowering of Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America, 2006, 103(41): 14994–15001

[130] Cluster P D, O’Dell M, Metzlaff M, Flavell R B. Details of T-DNA structural organization from a transgenic Petunia population exhibiting co-suppression. Plant Molecular Biology, 1996, 32(6): 1197–1203

[131] Flavell R B. Inactivation of gene expression in plants as a consequence of specific sequence duplication. Proceedings of the National Academy of Sciences of the United States of America, 1994, 91(9): 3490–3496

[132] Que Q, Wang H Y, English J J, Jorgensen R A. The frequency and degree of cosuppression by sense chalcone synthase transgenes are dependent on transgene promoter strength and are reduced by premature nonsense codons in the transgene coding sequence. Plant Cell, 1997, 9(8): 1357–1368

[133] Han Y, Griffiths A, Li H, Grierson D. The effect of endogenous mRNA levels on co-suppression in tomato. FEBS Letters, 2004, 563(1–3): 123–128

[134] Baulcombe D C. RNA as a target and an initiator of post-transcriptional gene silencing in trangenic plants. Plant Molecular Biology, 1996, 32(1): 79–88

[135] Ratcliff F, Martin-Hernandez A M, Baulcombe D C. Tobacco rattle virus as a vector for analysis of gene function by silencing. Plant Journal, 2001, 25(2): 237–245

[136] Mei Y, Zhang C, Kernodle B M, Hill J H, Whitham S A. A foxtail mosaic virus vector for virus-induced gene silencing in maize. Plant Physiology, 2016, 171(2): 760–772

[137] Liu N, Xie K, Jia Q, Zhao J, Chen T, Li H, Wei X, Diao X, Hong Y, Liu Y. Foxtail mosaic virus-induced gene silencing in monocot plants. Plant Physiology, 2016, 171(3): 1801–1807

[138] Hamilton A J, Brown S, Yuanhai H, Ishizuka M, Lowe A, Solis A G A, Grierson D. A transgene with repeated DNA causes high frequency, post-transcriptional suppression of ACC-oxidase gene expression in tomato. Plant Journal, 1998, 15(6): 737–746

[139] Hamilton A J, Baulcombe D C. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science, 1999, 286(5441): 950–952

[140] Fire A, Xu S, Montgomery M K, Kostas S A, Driver S E, Mello C C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature, 1998, 391(6669): 806–811

[141] Baulcombe D. RNA silencing. Trends in Biochemical Sciences, 2005, 30(6): 290–293

[142] Wesley S V, Helliwell C A, Smith N A, Wang M B, Rouse D T, Liu Q, Gooding P S, Singh S P, Abbott D, Stoutjesdijk P A, Robinson S P, Gleave A P, Green A G, Waterhouse P M. Construct design for efficient, effective and high-throughput gene silencing in plants. Plant Journal, 2001, 27(6): 581–590

[143] Yin Y, Chory J, Baulcombe D. RNAi in transgenic plants. Current Protocols in Molecular Biology, 2005, Unit 26.6

[144] Grierson D. Identifying and silencing tomato ripening genes with antisense genes. Plant Biotechnology Journal, 2016, 14(3): 835–838

[145] Grierson D. Ethylene and the control of fruit ripening. in Seymour G, Poole M, Giovannoni J, Tucker G, eds. Molecular Biology and Biochemistry of Fruit Ripening. John Wiley & Sons, Inc, 2013, 43–73

[146] Grierson D, Hamilton A J, Lycett G W. The life and times of ACC oxidase, alias TOM13. Molecular Biology Reports, 2013, 40(4): 3021–3022

[147] Prins M, Laimer M, Noris E, Schubert J, Wassenegger M, Tepfer M. Strategies for antiviral resistance in transgenic plants. Molecular Plant Pathology, 2008, 9(1): 73–83

[148] Koch A, Kogel K H. New wind in the sails: improving the agronomic value of crop plants through RNAi-mediated gene silencing. Plant Biotechnology Journal, 2014, 12(7): 821–831

[149] Baum J A, Bogaert T, Clinton W, Heck G R, Feldmann P, Ilagan O, Johnson S, Plaetinck G, Munyikwa T, Pleau M, Vaughn T, Roberts J. Control of coleopteran insect pests through RNA interference. Nature Biotechnology, 2007, 25(11): 1322–1326

[150] Nawaz-ul-Rehman M S, Mansoor S, Khan A A, Zafar Y, Briddon R W. RNAi-mediated male sterility of tobacco by silencing TA29. Molecular Biotechnology, 2007, 36(2): 159–165

[151] Wang X, Singer S D, Liu Z. Silencing of meiosis-critical genes for engineering male sterility in plants. Plant Cell Reports, 2012, 31(4): 747–756

[152] Coleman H D, Park J Y, Nair R, Chapple C, Mansfield S D. RNAi-mediated suppression of p-coumaroyl-CoA 3′-hydroxylase in hybrid poplar impacts lignin deposition and soluble secondary metabolism. Proceedings of the National Academy of Sciences of the United States of America, 2008, 105(11): 4501–4506

[153] Xu B, Escamilla-Trevino L L, Sathitsuksanoh N, Shen Z, Shen H, Zhang Y H, Dixon R A, Zhao B. Silencing of 4-coumarate: coenzyme A ligase in switchgrass leads to reduced lignin content and improved fermentable sugar yields for biofuel production. New Phytologist, 2011, 192(3): 611–625

[154] Jung J H, Fouad W M, Vermerris W, Gallo M, Altpeter F. RNAi suppression of lignin biosynthesis in sugarcane reduces recalcitrance for biofuel production from lignocellulosic biomass. Plant Biotechnology Journal, 2012, 10(9): 1067–1076

[155] Fornalé S, Capellades M, Encina A, Wang K, Irar S, Lapierre C, Ruel K, Joseleau J P, Berenguer J, Puigdomenech P, Rigau J, Caparros-Ruiz D. Altered lignin biosynthesis improves cellulosic bioethanol production in transgenic maize plants down-regulated for cinnamyl alcohol dehydrogenase. Molecular Plant, 2012, 5(4): 817–830

[156] Lee C, Teng Q, Huang W, Zhong R, Ye Z H. Down-regulation of PoGT47C expression in poplar results in a reduced glucuronoxylan content and an increased wood digestibility by cellulase. Plant & Cell Physiology, 2009, 50(6): 1075–1089

[157] Biswal A K, Hao Z, Pattathil S, Yang X, Winkeler K, Collins C, Mohanty S S, Richardson E A, Gelineo-Albersheim I, Hunt K, Ryno D, Sykes R W, Turner G B, Ziebell A, Gjersing E, Lukowitz W, Davis M F, Decker S R, Hahn M G, Mohnen D. Downregulation of GAUT12 in Populus deltoides by RNA silencing results in reduced recalcitrance, increased growth and reduced xylan and pectin in a woody biofuel feedstock. Biotechnology for Biofuels, 2015, 8(1): 41

[158] Kim M J, Yang S W, Mao H Z, Veena S P, Yin J L, Chua N H. Gene silencing of Sugar-dependent 1 (JcSDP1), encoding a patatin-domain triacylglycerol lipase, enhances seed oil accumulation in Jatropha curcas. Biotechnology for Biofuels, 2014, 7(1): 36

[159] Trentacoste E M, Shrestha R P, Smith S R, Gle C, Hartmann A C, Hildebrand M, Gerwick W H. Metabolic engineering of lipid catabolism increases microalgal lipid accumulation without compromising growth. Proceedings of the National Academy of Sciences of the United States of America, 2013, 110(49): 19748–19753

[160] Price D R, Gatehouse J A. RNAi-mediated crop protection against insects. Trends in Biotechnology, 2008, 26(7): 393–400

[161] Whyard S, Singh A D, Wong S. Ingested double-stranded RNAs can act as species-specific insecticides. Insect Biochemistry and Molecular Biology, 2009, 39(11): 824–832

[162] Wang J, Wu M, Wang B, Han Z. Comparison of the RNA interference effects triggered by dsRNA and siRNA in Tribolium castaneum. Pest Management Science, 2013, 69(7): 781–786

[163] Zhang J, Khan S A, Hasse C, Ruf S, Heckel D G, Bock R. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science, 2015, 347(6225): 991–994

[164] Yoder J I, Scholes J D. Host plant resistance to parasitic weeds; recent progress and bottlenecks. Current Opinion in Plant Biology, 2010, 13(4): 478–484

[165] Aly R, Cholakh H, Joel D M, Leibman D, Steinitz B, Zelcer A, Naglis A, Yarden O, Gal-On A. Gene silencing of mannose 6-phosphate reductase in the parasitic weed Orobanche aegyptiaca through the production of homologous dsRNA sequences in the host plant. Plant Biotechnology Journal, 2009, 7(6): 487–498

[166] Bandaranayake P C, Yoder J I. Trans-specific gene silencing of acetyl-CoA carboxylase in a root-parasitic plant. Molecular Plant-Microbe Interactions, 2013, 26(5): 575–584

[167] de Framond A, Rich P, McMillan J, Ejeta G. Effects of Striga parasitism of transgenic maize armed with RNAi constructs targeting essential S. asiatica genes. in Ejeta G, Gressel J, eds. Integrating new technologies for Striga control. 1nd. Singapore: World Scientific Publishing Company, 2007, 185–196

[168] Kirigia D, Runo S, Alakonya A. A virus-induced gene silencing (VIGS) system for functional genomics in the parasitic plant Striga hermonthica. Plant Methods, 2014, 10(1): 16

[169] Huang G, Allen R, Davis E L, Baum T J, Hussey R S. Engineering broad root-knot resistance in transgenic plants by RNAi silencing of a conserved and essential root-knot nematode parasitism gene. Proceedings of the National Academy of Sciences of the United States of America, 2006, 103(39): 14302–14306

[170] Sindhu A S, Maier T R, Mitchum M G, Hussey R S, Davis E L, Baum T J. Effective and specific in planta RNAi in cyst nematodes: expression interference of four parasitism genes reduces parasitic success. Journal of Experimental Botany, 2009, 60(1): 315–324

[171] Xue B, Hamamouch N, Li C, Huang G, Hussey R S, Baum T J, Davis E L. The 8D05 parasitism gene of Meloidogyne incognita is required for successful infection of host roots. Phytopathology, 2013, 103(2): 175–181

[172] Niu J, Liu P, Liu Q, Chen C, Guo Q, Yin J, Yang G, Jian H. Msp40 effector of root-knot nematode manipulates plant immunity to facilitate parasitism. Scientific Reports, 2016, 6: 19443

[173] Yadav B C, Veluthambi K, Subramaniam K. Host-generated double stranded RNA induces RNAi in plant-parasitic nematodes and protects the host from infection. Molecular and Biochemical Parasitology, 2006, 148(2): 219–222

[174] Lourenco-Tessutti I T, Souza J D Junior, Martins-de-Sa D, Viana A A, Carneiro R M, Togawa R C, de Almeida-Engler J, Batista J A, Silva M C, Fragoso R R, Grossi-de-Sa M F. Knock-down of heat-shock protein 90 and isocitrate lyase gene expression reduced root-knot nematode reproduction. Phytopathology, 2015, 105(5): 628–637

[175] Dinh P T, Zhang L, Mojtahedi H, Brown C R, Elling A A. Broad meloidogyne resistance in potato based on RNA interference of effector gene 16D10. Journal of Nematology, 2015, 47(1): 71–78

[176] Dutta T K, Banakar P, Rao U. The status of RNAi-based transgenic research in plant nematology. Frontiers in Microbiology, 2014, 5: 760

[177] Waltz E. USDA approves next-generation GM potato. Nature Biotechnology, 2015, 33(1): 12–13

[178] Waltz E. Nonbrowning GM apple cleared for market. Nature Biotechnology, 2015, 33(4): 326–327

[179] Nathans D, Smith H O. Restriction endonucleases in the analysis and restructuring of DNA molecules. Annual Review of Biochemistry, 1975, 44(1): 273–293

[180] Davis D, Stokoe D. Zinc finger nucleases as tools to understand and treat human diseases. BMC Medicine, 2010, 8(1): 42

[181] Sander J D, Dahlborg E J, Goodwin M J, Cade L, Zhang F, Cifuentes D, Curtin S J, Blackburn J S, Thibodeau-Beganny S, Qi Y, Pierick C J, Hoffman E, Maeder M L, Khayter C, Reyon D, Dobbs D, Langenau D M, Stupar R M, Giraldez A J, Voytas D F, Peterson R T, Yeh J R, Joung J K. Selection-free zinc-finger-nuclease engineering by context-dependent assembly (CoDA). Nature Methods, 2011, 8(1): 67–69

[182] Li T, Liu B, Spalding M H, Weeks D P, Yang B. High-efficiency TALEN-based gene editing produces disease-resistant rice. Nature Biotechnology, 2012, 30(5): 390–392

[183] Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna J A, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 2012, 337(6096): 816–821

[184] Whitworth K M, Lee K, Benne J A, Beaton B P, Spate L D, Murphy S L, Samuel M S, Mao J, O’Gorman C, Walters E M, Murphy C N, Driver J, Mileham A, McLaren D, Wells K D, Prather R S. Use of the CRISPR/Cas9 system to produce genetically engineered pigs from in vitro-derived oocytes and embryos. Biology of Reproduction, 2014, 91(3): 78

[185] Pul U, Wurm R, Arslan Z, Geissen R, Hofmann N, Wagner R. Identification and characterization of E. coli CRISPR-cas promoters and their silencing by H-NS. Molecular Microbiology, 2010, 75(6): 1495–1512

[186] Silas S, Mohr G, Sidote D J, Markham L M, Sanchez-Amat A, Bhaya D, Lambowitz A M, Fire A Z. Direct CRISPR spacer acquisition from RNA by a natural reverse transcriptase-Cas1 fusion protein. Science, 2016, 351(6276): aad4234

[187] Bortesi L, Fischer R. The CRISPR/Cas9 system for plant genome editing and beyond. Biotechnology Advances, 2015, 33(1): 41–52

[188] Shalem O, Sanjana N E, Zhang F. High-throughput functional genomics using CRISPR-Cas9. Nature Reviews Genetics, 2015, 16(5): 299–311

[189] Sanchez-Rivera F J, Jacks T. Applications of the CRISPR-Cas9 system in cancer biology. Nature Reviews Cancer, 2015, 15(7): 387–395

[190] Nekrasov V, Staskawicz B, Weigel D, Jones J D, Kamoun S. Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nature Biotechnology, 2013, 31(8): 691–693

[191] Li J F, Norville J E, Aach J, McCormack M, Zhang D, Bush J, Church G M, Sheen J. Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nature Biotechnology, 2013, 31(8): 688–691

[192] Shan Q, Wang Y, Li J, Zhang Y, Chen K, Liang Z, Zhang K, Liu J, Xi J J, Qiu J L, Gao C. Targeted genome modification of crop plants using a CRISPR-Cas system. Nature Biotechnology, 2013, 31(8): 686–688

[193] Brooks C, Nekrasov V, Lippman Z B, Van Eck J. Efficient gene editing in tomato in the first generation using the clustered regularly interspaced short palindromic repeats/CRISPR-associated9 system. Plant Physiology, 2014, 166(3): 1292–1297

[194] Zhou H, Liu B, Weeks D P, Spalding M H, Yang B. Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice. Nucleic Acids Research, 2014, 42(17): 10903–10914

[195] Fauser F, Schiml S, Puchta H. Both CRISPR/Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana. Plant Journal, 2014, 79(2): 348–359

[196] Xing H L, Dong L, Wang Z P, Zhang H Y, Han C Y, Liu B, Wang X C, Chen Q J A. CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biology, 2014, 14(1): 327

[197] O’Geen H, Yu A S, Segal D J. How specific is CRISPR/Cas9 really? Current Opinion in Chemical Biology, 2015, 29: 72–78

[198] Schiml S, Puchta H. Revolutionizing plant biology: multiple ways of genome engineering by CRISPR/Cas. Plant Methods, 2016, 12(1): 8

[199] Lowder L G, Zhang D, Baltes N J, Paul III J W, Tang X, Zheng X, Voytas D F, Hsieh T F, Zhang Y, Qi Y A. CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiology, 2015, 169(2): 971–985

[200] Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu Y G. A Robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Molecular Plant, 2015, 8(8): 1274–1284

[201] Xie K, Minkenberg B, Yang Y. Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proceedings of the National Academy of Sciences of the United States of America, 2015, 112(11): 3570–3575

[202] Zhang Z, Mao Y, Ha S, Liu W, Botella J R, Zhu J K. A multiplex CRISPR/Cas9 platform for fast and efficient editing of multiple genes in Arabidopsis. Plant Cell Reports, 2016, 35(7): 1519–1533

[203] Vazquez-Vilar M, Bernabe-Orts J M, Fernandez-Del-Carmen A, Ziarsolo P, Blanca J, Granell A, Orzaez D. A modular toolbox for gRNA-Cas9 genome engineering in plants based on the GoldenBraid standard. Plant Methods, 2016, 12(1): 10

[204] Cermák T, Baltes N J, Cegan R, Zhang Y, Voytas D F. High-frequency, precise modification of the tomato genome. Genome Biology, 2015, 16(1): 232

[205] Li Z, Liu Z B, Xing A, Moon B P, Koellhoffer J P, Huang L, Ward R T, Clifton E, Falco S C, Cigan A M. Cas9-guide RNA directed genome editing in soybean. Plant Physiology, 2015, 169(2): 960–970

[206] Sun Y, Zhang X, Wu C, He Y, Ma Y, Hou H, Guo X, Du W, Zhao Y, Xia L. Engineering herbicide-resistant rice plants through CRISPR/Cas9-mediated homologous recombination of acetolactate synthase. Molecular Plant, 2016, 9(4): 628–631

[207] Liu L, Fan X D. CRISPR-Cas system: a powerful tool for genome engineering. Plant Molecular Biology, 2014, 85(3): 209–218

[208] Baltes N J, Voytas D F. Enabling plant synthetic biology through genome engineering. Trends in Biotechnology, 2015, 33(2): 120–131

[209] Nejat N, Rookes J, Mantri N L, Cahill D M. Plant-pathogen interactions: toward development of next-generation disease-resistant plants. Critical Reviews in Biotechnology, 2016, 22: 1–9

[210] Xu R F, Li H, Qin R Y, Li J, Qiu C H, Yang Y C, Ma H, Li L, Wei P C, Yang J B. Generation of inheritable and “transgene clean” targeted genome-modified rice in later generations using the CRISPR/Cas9 system. Scientific Reports, 2015, 5: 11491

[211] Kanchiswamy C N, Malnoy M, Velasco R, Kim J S, Viola R. Non-GMO genetically edited crop plants. Trends in Biotechnology, 2015, 33(9): 489–491

[212] Abbott A. Europe’s genetically edited plants stuck in legal limbo. Nature, 2015, 528(7582): 319–320

[213] Huang S, Weigel D, Beachy R N, Li J. A proposed regulatory framework for genome-edited crops. Nature Genetics, 2016, 48(2): 109–111

[214] Streatfield S J, Kushnir N, Yusibov V. Plant-produced candidate countermeasures against emerging and reemerging infections and bioterror agents. Plant Biotechnology Journal, 2015, 13(8): 1136–1159

[215] Chan H T, Daniell H. Plant-made oral vaccines against human infectious diseases—Are we there yet? Plant Biotechnology Journal, 2015, 13(8): 1056–1070

[216] Shahid N, Daniell H. Plant-based oral vaccines against zoonotic and non-zoonotic diseases. Plant Biotechnology Journal, 2016, 14(11): 2079–2099

[217] Fahlgren N, Bart R, Herrera-Estrella L, Rellán-Álvarez R, Chitwood D H, Dinneny J R. Plant scientists: GM technology is safe. Science, 2016, 351(6275): 824

Acknowledgements

This work was supported by the National Natural Science Foundation of China (31371693, 31471556, 31600289 and 31471502).

Compliance with ethics guidelines

Xingchun Wang, Shujun Chang, Jie Lu, Rupert Fray, Don Grierson, and Yuanhuai Han declare that they have no conflict of interest or financial conflicts to disclose.

This article is a review and does not contain any studies with human or animal subjects performed by any of the authors.

RIGHTS & PERMISSIONS

The Author(s) 2017. Published by Higher Education Press. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0)