
Inverted duplication including Endothelin 3 closely related to dermal hyperpigmentation in Silkie chickens
Ming TIAN, Suyun FANG, Yanqiang WANG, Xiaorong GU, Chungang FENG, Rui HAO, Xiaoxiang HU, Ning LI
Front. Agr. Sci. Eng. ›› 2014, Vol. 1 ›› Issue (2) : 121-129.
Inverted duplication including Endothelin 3 closely related to dermal hyperpigmentation in Silkie chickens
The dermal hyperpigmentation phenotype in chickens is controlled by the dominant fibromelanosis allele. One of the ten unique characteristics of Silkie chickens is the fibromelanosis phenotype, which is pigmentation in the dermal layer of the skin and connective tissue. In this study, we found a mutation of fibromelanosis, a genomic rearrangement that included an inverted duplication of endothelin3 (EDN3), is responsible. We show that, as a stimulator of melanoblast proliferation, EDN3 expression was increased in silkie embryos and in both skin and muscle throughout adulthood. EDN3 expression led to an increase in expression of the downstream genes EDNRB2 and TYRP2, and was closely relate with the hyperpigmentation phenotype. We examined eight different Chinese chicken breeds showing hyperpigmentation and conclude that this structural genetic variant exists in all fibromelanosis chicken breeds.
dermal hyperpigmentation / duplication / endothelin 3 / Silkie chicken
Fig.1 Founding breeds of the mapping populations and chick pigmentation phenotypes. Individuals of the chicken breeds used to develop the population for pigmentation: (a) Silkie, (b) Gushi and (c) Youxima; after hatching, four-week-old chickens from the mapping populations displaying different pigmentation phenotypes in the comb, which represents the color of the skin: (d) a putative Fm/fm+ (black comb) individual and (e) a putative fm+/fm+ (white comb) individual. |
Tab.1 Primer sequences for locating the boundary with PCR |
Primer name | Orientation | Primer sequence (5′ to 3′) |
---|---|---|
Dup-CNV-1-5′-GSP1 | R | CACAATAACATAGGTAAGGGCACACACTG |
Dup-CNV-1-5′-GSP2 | R | CTGTGAGGCATTAGTAATCCCACCAAA |
Dup-CNV-1-3′-GSP1 | F | CCCTCCTTCAAAATCCCCATCTGTTA |
Dup-CNV-1-3′-GSP2 | F | GACTTGGTAGCAACGATAGCACTTATTCCT |
Dup-CNV-2-5′-GSP1 | R | CAATGGCTCTCCAAAGGAATGGCTCT |
Dup-CNV-2-5′-GSP2 | R | ACAACTGCCTAAAACTTTACTCGACTTCTC |
Dup-CNV-2-3′-GSP1 | F | GTCCATTATCCCAGAGACAGCCTTGC |
Dup-CNV-2-3′-GSP2 | F | GCTCAGTGAAACACCCAACATAAAATTAC |
AP1 | F | GTAATACGACTCACTATAGGGC |
AP2 | F | ACTATAGGGCACGCGTGGT |
Tab.2 Chinese chicken breeds used for confirmation of copy number variation regions |
Chicken breed | Abbreviation | Skin color | Shank color |
---|---|---|---|
Youxima | YX | White | Black |
Qingyuan | QY | White | Black |
Crossed FM family: white skin | FM W | White | Black |
Crossed FM family: gray skin | FM G | Gray | Black |
Crossed FM family: black skin | FM B | Black | Black |
Silkie | WJ | Black | Black |
Jinhu | JH | Black | Black |
Tengchong snow | TC | Black | Black |
Yanjin Silkie | YJ | Black | Black |
Wuding Silkie | WD | Black | Black |
Chuxiong Silkie | CX | Black | Black |
Fig.2 Results of qPCR analysis of genes and fragments for Dup-CNV-1 detection. Dup-CNV-1: (a) PCCA (control); (b) EDN3; (c) C20orf174-1; (d) ATP5e; (e) TUBB1. Genomic copy number was detected with qPCR in 11 breeds of chicken. The heterozygotes (FM G) showed an estimated copy number of approximately 1.5 × compared to wild-type individuals (YX, QY, FM W). Homozygotes (FM B, WJ, JH, TC, YJ, WD, CX) showed an estimated copy number of approximately 2 × compared to wild-type individuals. The numbers after the hyphen mean the label when feeding; “N”means the individual has no Fm loci; the data are the mean ± SD. |
Fig.3 Genome Walker PCR. PCR products were digested with four restriction enzymes, namely Dra II, EcoR V, Pvu II, Stu I, producing fragments of different lengths from the same lines and indicating differential amplification of segments with the same primers (i.e., polymorphic segments). |
Fig.4 Results of qPCR analysis of the expression of duplicated genes in Dup-CNV-1. (a): END3 mRNA; (b) SLMO2 mRNA; (c) ATP5e mRNA; (d) TUBBa mRNA. Gene expression analysis in Silkie (FM, WJ) and White Leghorn (fm+, BLH) chickens with SYBR Green qPCR normalized to expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Genes in the first duplicated region (EDN3, SLMO2, ATP5e, TUBB1) showed significantly increased expression from embryonic tissue (E3d) through adult skin and muscle tissue (4D) of the Silkie chicken. HL: hind leg; S: skin; M: muscle; L: liver. |
Fig.5 Expression of genes downstream of EDN3. Gene expression analysis of the EDN3 receptor genes EDNRB and EDNRB2 and the melanin biosynthesis pathway gene TYRP2. EDNRB expression in skin or muscle showed no significant difference between Silkie and White Leghorn chickens at either embryonic day 13 (a) or adult day 4 (b). However, the expression of EDNRB2 and TYRP2 was strongly increased in Silkie skin and muscle tissue in both the embryo and adult. In contrast, the expression of EDNRB2 and TYRP2 was very low in White Leghorn chickens. HL: hind leg; S: skin; M: muscle; L: liver. |
[1] |
Dorshorst B, Okimoto R, Ashwell C. Genomic regions associated with dermal hyperpigmentation, polydactyly and other morphological traits in the Silkie chicken. Journal of Heredity, 2010, 101(3): 339–350
CrossRef
Pubmed
Google scholar
|
[2] |
Smyth J R Jr. Genetics of plumage, skin and eye pigmentation in chickens. Crawford RD, ed. Amsterdam. New York, 1990
|
[3] |
Hutt F B. Genetics of the fowl. McGraw-Hill. New York, 1949
|
[4] |
Kuklenski J. Über das vorkommen und die verteilung des pigmentes in den organen und geweben bei japanischen seidenhühnern. (Over occurrence and the distribution of the pigment in the organs and tissues of Japanese Silky chickens). Archiv für mikroskopische Anatomie, 1915, 87(1): 1–37 (in German)
|
[5] |
Le D M N. The Neural Crest. Cambridge Univ. Cambridge, 1982
|
[6] |
Erickson C A, Reedy M V. Neural crest development: the interplay between morphogenesis and cell differentiation. Current Topics in Developmental Biology, 1998, 40: 177–209
CrossRef
Pubmed
Google scholar
|
[7] |
Erickson C A, Goins T L. Avian neural crest cells can migrate in the dorsolateral path only if they are specified as melanocytes. Development, 1995, 121(3): 915–924
Pubmed
|
[8] |
Reedy M V, Faraco C D, Erickson C A. Specification and migration of melanoblasts at the vagal level and in hyperpigmented Silkie chickens. Developmental Dynamics, 1998, 213(4): 476–485
CrossRef
Pubmed
Google scholar
|
[9] |
Faraco C D, Vaz S A, Pástor M V, Erickson C A. Hyperpigmentation in the Silkie fowl correlates with abnormal migration of fate-restricted melanoblasts and loss of environmental barrier molecules. Developmental Dynamics, 2001, 220(3): 212–225
CrossRef
Pubmed
Google scholar
|
[10] |
Lecoin L, Mercier P, Le Douarin N M. Growth of neural crest cells in vitro is enhanced by extracts from Silky Fowl embryonic tissues. Pigment Cell Research, 1994, 7(4): 210–216
CrossRef
Pubmed
Google scholar
|
[11] |
Hallet M M, Ferrand R. Quail melanoblast migration in two breeds of fowl and in their hybrids: evidence for a dominant genic control of the mesodermal pigment cell pattern through the tissue environment. Journal of Experimental Zoology, 1984, 230(2): 229–238
CrossRef
Pubmed
Google scholar
|
[12] |
Bateson W, Punnett R. The inheritance of the peculiar pigmentation of the silky fowl. Journal of Genetics, 1911, 1(3): 185–203
CrossRef
Google scholar
|
[13] |
Dunn L, Jull M. On the inheritance of some characters op the silky fowl. Journal of Genetics, 1927, 19(1): 27–63
CrossRef
Google scholar
|
[14] |
Bitgood J J. Linear relationship of the loci for barring, dermal melanin inhibitor, and recessive white skin on the chicken Z chromosome. Poultry Science, 1988, 67(4): 530–533
CrossRef
Pubmed
Google scholar
|
[15] |
Dorshorst B J, Ashwell C M. Genetic mapping of the sex-linked barring gene in the chicken. Poultry Science, 2009, 88(9): 1811–1817
CrossRef
Pubmed
Google scholar
|
[16] |
Groenen M A, Cheng H H, Bumstead N, Benkel B F, Briles W E, Burke T, Burt D W, Crittenden L B, Dodgson J, Hillel J, Lamont S, de Leon A P, Soller M, Takahashi H, Vignal A. A consensus linkage map of the chicken genome. Genome Research, 2000, 10(1): 137–147
Pubmed
|
[17] |
Levin I, Crittenden L B, Dodgson J B. Genetic map of the chicken Z chromosome using random amplified polymorphic DNA (RAPD) markers. Genomics, 1993, 16(1): 224–230
CrossRef
Pubmed
Google scholar
|
[18] |
Wright D, Kerje S, Lundström K, Babol J, Schütz K, Jensen P, Andersson L. Quantitative trait loci analysis of egg and meat production traits in a red junglefowl×White Leghorn cross. Animal Genetics, 2006, 37(6): 529–534
CrossRef
Pubmed
Google scholar
|
[19] |
Wang Y, Gu X, Feng C, Song C, Hu X, Li N. A genome-wide survey of copy number variation regions in various chicken breeds by array comparative genomic hybridization method. Animal Genetics, 2012, 43(3): 282–289
|
[20] |
Garcia R J, Ittah A, Mirabal S, Figueroa J, Lopez L, Glick A B, Kos L. Endothelin 3 induces skin pigmentation in a keratin-driven inducible mouse model. Journal of Investigative Dermatology, 2008, 128(1): 131–142
CrossRef
Pubmed
Google scholar
|
[21] |
Lahav R, Ziller C, Dupin E, Le Douarin N M. Endothelin 3 promotes neural crest cell proliferation and mediates a vast increase in melanocyte number in culture. Proceedings of the National Academy of Sciences of the United States of America, 1996, 93(9): 3892–3897
CrossRef
Pubmed
Google scholar
|
[22] |
Nataf V, Lecoin L, Eichmann A, Le Douarin N M. Endothelin-B receptor is expressed by neural crest cells in the avian embryo. Proceedings of the National Academy of Sciences of the United States of America, 1996, 93(18): 9645–9650
CrossRef
Pubmed
Google scholar
|
[23] |
Lecoin L, Sakurai T, Ngo M T, Abe Y, Yanagisawa M, Le Douarin N M. Cloning and characterization of a novel endothelin receptor subtype in the avian class. Proceedings of the National Academy of Sciences of the United States of America, 1998, 95(6): 3024–3029
CrossRef
Pubmed
Google scholar
|
[24] |
Dorshorst B, Molin A M, Rubin C J, Johansson A M, Strömstedt L, Pham M H, Chen C F, Hallböök F, Ashwell C, Andersson L. A complex genomic rearrangement involving the endothelin 3 locus causes dermal hyperpigmentation in the chicken. PLOS Genetics, 2011, 7(12): e1002412
CrossRef
Pubmed
Google scholar
|
[25] |
Stranger B E, Forrest M S, Dunning M, Ingle C E, Beazley C, Thorne N, Redon R, Bird C P, de Grassi A, Lee C, Tyler-Smith C, Carter N, Scherer S W, Tavaré S, Deloukas P, Hurles M E, Dermitzakis E T. Relative impact of nucleotide and copy number variation on gene expression phenotypes. Science, 2007, 315(5813): 848–853
CrossRef
Pubmed
Google scholar
|
[26] |
Lahav R, Dupin E, Lecoin L, Glavieux C, Champeval D, Ziller C, Le Douarin N M. Endothelin 3 selectively promotes survival and proliferation of neural crest-derived glial and melanocytic precursors in vitro. Proceedings of the National Academy of Sciences of the United States of America, 1998, 95(24): 14214–14219
CrossRef
Pubmed
Google scholar
|
Supplementary files
Supplementary Material 1 (230 KB)
Supplementary Material 2 (221 KB)
Supplementary Material 3 (450 KB)
Supplementary Material 4 (54 KB)
Supplementary Material 5 (447 KB)
/
〈 |
|
〉 |