PAK5-mediated PKM2 phosphorylation is critical for anaerobic glycolysis in endometriosis

Abstract

P21-activated kinase 5 (PAK5) belongs to the PAK-II subfamily, which is an important regulator of cell survival, adhesion, and motility. However, the functions of PAK5 in endometriosis remain unclear. Here, PAK5 is strikingly upregulated in endometriosis. Furthermore, the knockdown of PAK5 or its inhibitor GNE 2861 blocks the development of endometriosis, which is equally demonstrated in PAK5-knockout mice. In addition, PAK5 promotes glycolysis by enhancing the protein stability of pyruvate kinase 2 (PKM2) in endometriotic cells, which is a key enzyme for glucose metabolism. Moreover, the phosphorylation of PKM2 at Ser519 by PAK5 mediates endometriosis cell proliferation and metastasis. Collectively, PAK5 plays an indispensable role in endometriosis. Our findings demonstrate that PAK5 is an important target for the treatment of endometriosis.

Keywords

PAK5 / PKM2 / phosphorylation / endometriosis / glycolysis

1 Introduction

Endometriosis is a common gynecological disease with presenting symptoms, including pelvic pain, dysmenorrhea, and dyspareunia, which negatively impacts the quality of life of women [1]. At present, the pathogenesis and etiology of endometriosis remain unclear. Meanwhile, the effective therapy of endometriosis is still a challenge. Hence, investigating the mechanism of endometriosis is important.

P21-activated kinases (PAKs) are the binding protein of small GTPases, which can be categorized into two groups based on sequence and structure [2,3]. Increasing research has confirmed that PAKs are overexpressed in various cancers [4–6]. PAK5, as the last PAK family member to be found and understood, is mainly distributed in the mitochondria and nucleus [7]. PAK5 is essential for many diseases and cellular functions by affecting cytoskeletal remodeling and intracellular signaling [5,6,8]. PAK5 deficiency represses breast tumorigenesis [5]. In addition, PAK5-mediated AIF phosphorylation promotes breast cancer tumorigenesis [9]. However, the role of PAK5 in endometriosis remains poorly understood. Hence, the underlying molecular mechanism of PAK5 in endometriosis must be further clarified.

Pyruvate kinase (PK) is an indispensable enzyme that determines glycolytic activity, which has four isoenzymes [10]. Pyruvate kinase M2 isozyme (PKM2) is initially found in hepatoma cell lines [11]. Elevated levels of PKM2 are observed in many cancer cells [12,13]. PKM2 contributes to the Warburg effect, which increased lactate production and glucose uptake, regardless of oxygen availability [14]. Furthermore, the Warburg effect facilitates cell growth [15,16]. In addition, PKM2 plays an indispensable role in cell energy supply, cell invasion, metastasis, proliferation, and EMT in many diseases [17]. Moreover, PKM2 promotes endometrial stromal cell invasion [18]. However, the post-translational modification of PKM2 is seldom discussed in endometriosis.

In this study, the underlying mechanisms of PAK5 in the progression of endometriosis were investigated. In addition, the biological functions of PAK5, including cell proliferation, migration, and invasion, in endometriosis were studied. PAK5 promoted PKM2 protein stability via phosphorylation at the Ser519 site. Our results indicate that PAK5 is a potential target for the treatment of endometriosis.

2 Materials and methods

2.1 Cell culture, regents, and antibodies

Endometrial epithelial cell (11Z) was established by Anna Starzinski-Powitz from the Humangenetik fur Biologen der Universitat [19]. An immortalized human endometrial stromal cell (HESC) was established by Graciela Krikun from Yale University School of Medicine, USA, and this cell was phenotypically similar to primary parental cells [20]. HEK293T cells were cultured in DMEM supplemented with 10% FBS. 11Z and HESC cells were cultured in Dulbecco’s Modified Eagle Medium/Ham’s F-12 50/50 Mix (DMEM/F-12) supplemented with 10% FBS (Gibco, Carlsbad, CA, USA). All cell lines were maintained in a humidified incubator containing 5% CO₂ at 37 °C. All media were supplemented with 100 μg/mL penicillin and 100 μg/mL streptomycin. The antibodies and other reagents used were shown in Table S1.

2.2 Plasmid construction and mutagenesis

PCR-amplified human PAK5 and PKM2 were cloned into pcDNA3.0/HA. Mutations on PKM2 and PAK5 were generated using the Quickchange-XL Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA, USA). The indicated cells were transfected with the appropriate plasmids using Lipofectamine 2000 following the manufacturer’s instruction.

2.3 Tissue collection and immunohistochemistry

All tissue samples utilized in the study were collected from the Reproductive Center of Affiliated Hospital of Shandong Second Medical University, China. The donors of the human tissues of this experiment were informed, and they signed an informed consent form before the operation. None of the patients had any other severe medical or surgical comorbidities, and they did not receive hormone therapy within the last 3 months. This experiment was approved by the Ethic Committee of the Shandong Second Medical University. Paraffin-embedded tissues were sliced and heated for 60–120 min at 60 °C. Then, the tissues were dewaxed with xylene and rehydrated in an alcohol gradient. The tissue slides were added to the antigen repair solution, heated by microwave for 30 min, blocked using 3% H₂O₂ to quench the peroxidase activity for 20 min, and incubated with a primary antibody at 4 °C overnight. The tissue slides were rinsed with phosphate-buffered saline (PBS) the following day, incubated with a secondary antibody, and stained with DAB. After hematoxylin counterstaining, all the tissue slides were dehydrated and sealed. The scores for immunohistochemistry staining frequency (0=negative, 1=1%–25%, 2=26%–50%, 3=51%–75%, and 4=76%–100%) and intensity (0=negative, 1=weak, 2=moderate, and 3=strong staining) were multiplied to obtain an overall staining score.

2.4 Generation of stable cell pools

The small-hairpin (sh) RNA sequences used are shown in Table S2. A scramble negative control shRNA (shNC) was synthesized serving as control shRNA. In HEK293T cells, PAK5 genes were constructed into the pLVX-IRES-Neo vectors and then transfected with pMD2.G package vector and psPAX2 package vector. The lentivirus infected the 11Z and HESC cells, following a selection with G418 for two weeks. Stable cells were selected with an indicated marker. Before using, positive 11Z and HESC cells were identified by Western blot.

2.5 RNA extraction and quantitative real-time PCR

In accordance with the manufacturer’s instruction, total RNA was harvested and extracted using a Trizol reagent. After cDNA synthesis by reverse transcription, quantitative real-time PCR was performed using the SYBR Green PCR Master Mix (Takara) and CFX96 Real-Time PCR detection system (Bio-Rad, Shanghai, China). RT-PCR was performed as described previously [21]. The sequences of primers used for qRT-PCR are shown in Table S3.

2.6 Western blot and co-immunoprecipitation (Co-IP)

Protein was extracted from the indicated cells and centrifuged at 12 000 rpm for 10 min at 4 °C using lysis buffer (50 mmol/L Tris-HCl, pH 7.5, 150 mmol/L NaCl, and 0.5% NP40) [22]. Finally, the supernatants were collected and used as 5× loading buffer and boiled for 10 min. The protein was separated by SDS-PAGE, and then the protein in the gels was transferred to the PVDF membrane. Five percent non-fat milk was applied for 1 h. Finally, the immunoblot assay was finished using the indicated antibodies, which was performed as described previously [23]. For the Co-IP assay, protein A/G beads were incubated with a cell lysis supernatant at 4 °C for 12–16 h. Beads were washed with lysis buffer. Immunoprecipitated proteins were analyzed as described previously.

2.7 In vitro protein kinase assay

The bacterially purified recombinant His-PKM2 (2 μg) were incubated with His-PAK5 (0.2 μg) in 50 μL of kinase buffer (50 mmol/L HEPES, pH 7.5, 10 mmol/L MgCl₂, 2 mM MnCl₂, and 0.2 mM DTT, 10 μmol/L ATP, Sigma) at 30 °C for 30 min. The reaction was subjected to SDS-PAGE and then immunoblot analyzed with the indicated antibodies.

2.8 Cell proliferation assay

Cells were transfected with the indicated constructs and re-plated in 24-well plates. After 24 h, the cell numbers were counted every 24 h for 4 days [24].

2.9 Colony formation assay

The cells were transfected with the indicated constructs. After 24 h, a total of 200–800 cells were plated per well in six-well plates, which were cultured for 7–14 days. Then, the cells were rinsed and fixed. Afterward, the cells were stained with 0.5% crystal violet for 20–30 min. Colony-forming units were calculated and photographed [25].

2.10 Wound healing assay

The cells were placed in six-well plates and transfected with the indicated constructs. After 24 h, the cells were reseeded. The middle 200 μL pipette tip was used to slowly scratch a line. After washing with PBS, the cells were photographed using a microscope. After 12–24 h, the cells were photographed again.

2.11 Glucose consumption, lactate production, and glycolytic rate

The cells were transfected with the indicated constructs, which were reseeded in new six-well plates after 24 h. When the cell fusion degree of cells reached 80%, the culture medium was replaced with the serum-free culture medium. After 24 h, the serum-free culture media were collected to measure the concentration of glucose and lactic acid by using the glucose (GO) assay kit (Sigma, #GAGO20-1KT) and lactate assay kit (Biovision, #k627-100). The glycolytic rate was determined using a Seahorse XFe24 analyzer (Agilent) [26].

2.12 Immunofluorescent analysis

The cells were transfected with the indicated plasmids. The cells were reseeded in 24-well plates after 24 h. One day later, the cells were fixed in 4% paraformaldehyde for 10 min at room temperature. Then, the cells were blocked with 1% BSA and were incubated with the primary antibody at 4 °C overnight. Subsequently, the secondary antibody mixing Alexa Fluor 488 and Alexa Fluor 593 was used to dye it, and DAPI was used to dye DNA [27].

2.13 Transwell cell migration and invasion assays

Transwell cell migration/invasion assays were performed in two-chamber plates with an 8-mm pore-size polycarbonate membrane. For the invasion assay, the BD Biocoat Matrigel (BD Biosciences, Bedford, MA, USA, 1:8) was added to the upper chamber of the transwell plates. Inserts coated without Matrigel were applied for transwell migration assays. The treated cells were incubated in the serum-free medium and added to the upper chamber. The serum medium containing 10% FBS was added to the lower chamber. Subsequently, the cells were incubated for 12–24 h in a 5% CO₂ incubator at 37 °C. The migrated cells on the lower surface of the membranes were washed with PBS for 3 min three times. Subsequently, the cells were fixed with 5% paraformaldehyde and stained with crystal violet. Finally, the indicated cells were photographed and recorded.

2.14 Mouse model of endometriosis

The mouse model of endometriosis was established by intraperitoneal injection of endometrial fragments [28]. Six-week-old C57BL/6 female mice were used [29]. C57BL/6J mice were purchased from Medical Laboratory Animal Center, Shandong Second Medical University (Weifang, China). The donor mice were injected intramuscularly with estradiol benzoate, which was diluted with oil to promote endometrial development, 3 μg/mice, three times for one week. One week later, the uterus of donor mice was cut into pieces and injected into the recipient mice. Two recipient mice received the uterus pieces derived from one donor mouse. After injecting estradiol benzoate three times for one week, the experienced group received GNE 2861 (25 mg/kg) with 10% DMSO, and the control group received the same pump containing PBS with 10% DMSO three times a week for three weeks. Finally, the mice were sacrificed to observe the endometriosis lesion by CO₂ euthanasia. Ectopic tissue volume was calculated in accordance with the formula: volume = (length × width²)/2. In the study, all animals were administered under relevant regulations and institutional guidelines.

PAK5 knockout mice were purchased from Cyagen Biosciences (Taicang, China). PAK5 knockout mice were generated using CRISPR/Cas9-mediated genome editing (gRNA1: TACCCAGAAAACACGACATTAGG; gRNA2: GTCCATATGCTAACTCCACCAGG; gRNA3: AGCTGCAATGTATTCCTTATTGG; gRNA4: ATCCATTCAGAGTGTTGGATGGG). The donor mice (6-week-old PAK5^−/− female mice and C57BL/6 female mice) were initially injected with 3 μg/mice estradiol benzoate intramuscularly. After one week, they were killed, and the uterus containing warm sterile saline from donor mice was cut into pieces and seeded in the recipient mice. Two recipient mice received the uterus pieces derived from one donor mouse [30]. After 21 days, the body weight was measured before mice were sacrificed by CO₂ euthanasia. The volume of ectopic tissues was calculated in accordance with the formula: volume = (length × width²)/2. In the study, all animals were administered in accordance with relevant regulations and institutional guidelines. The Ethics Committee of Shandong Second Medical University approved the animal experiment.

2.15 Statistical analysis

All statistical analyses were conducted by using SPSS software version 17.0 (Chicago, IL) or GraphPad Prism 7.0 software and presented as mean ± SEM. Two-tailed unpaired Student’s t-test was used for comparison between two groups. One-way ANOVA was used for comparison among multiple groups. P values < 0.05 were considered statistically significantly. *P < 0.05, **P < 0.01, ***P < 0.001, and n.s. = not significant.

3 Results

3.1 PAK5 promotes endometriosis cell proliferation

To explore the biological functions of PAK5 in endometriosis, we manipulated PAK5 expression in 11Z and HESC cells, and PAK5 expression was confirmed by Western blot and immunofluorescence (Fig. S1A–S1F). Cell proliferation assay showed that PAK5 enhanced the capacity of cell proliferation in 11Z and HESC cells (Fig.1 and 1B). On the contrary, the knockdown of PAK5 in 11Z and HESC cells markedly suppressed the cell proliferation in 11Z and HESC cells (Fig.1 and 1D). Similarly, PAK5-enhanced cell proliferation was substantiated by colony formation assay (Fig.1 and 1F). To investigate the effect of PAK5 on the growth of endometriotic tissues in vivo, we conducted animal experiments. The PAK5 knockout mouse model of endometriosis was established (Fig.1). Finally, these recipient mice were sacrificed to observe endometriotic tissues (Fig.1). The ectopic endometriotic tissues from PAK5 knockout mice markedly reduced compared with the control group (Fig.1). Consistently, the volume and weight of ectopic endometrial tissues were significantly reduced compared with the control group (Fig.1 and 1K). Collectively, PAK5 facilitates endometriosis cell proliferation in vitro and in vivo.

Fig.1 PAK5 promotes endometriosis cell proliferation. (A, B) 11Z and HESC cell proliferation were assessed by cell proliferation assay after stable overexpression of PAK5. The cell numbers were recorded every day for 4 days. (C, D) 11Z and HESC stably knocked down PAK5. The cell numbers were recorded. (E, F) The colony formation capacity of 11Z and HESC cells was determined by colony formation assay after the stable overexpression or knocked down of PAK5. One day later, the indicated cells were seeded in six-well plates. The clone numbers were analyzed until visible cell colonies were formed. (G) Endometriosis mouse model was established using 6-week-old PAK5–/– female mice and C57BL/6 female mice. (H) Mice were killed, and the excised endometriotic tissues were observed. (I) Excised endometriotic tissues were shown. (J) The volume of the endometriotic tissues was measured. (K) The weight of the endometriotic tissues was weighed. All data are represented as mean ± SEM, n≥ 3, *P < 0.05, **P < 0.01, ***P < 0.001, and ns, not significant.

Full size|PPT slide

3.2 PAK5 promotes cell migration and invasion in endometriotic cells

Epithelial–mesenchymal transition (EMT) can enhance cellular migratory ability [31]. Meanwhile, the role of EMT is important in the development of endometriosis [32,33]. To study whether PAK5 promoted the invasion and migration of endometriotic cells, the cell invasion and migration assays were performed. The invasion assay showed that PAK5 significantly altered the invasion ability of 11Z and HESC cells (Fig.2 and 2B). In addition, PAK5 dramatically promoted the migration of endometriotic cells, which was substantiated by transwell migration assay (Fig. S2A and S2B). Moreover, wound healing assay demonstrated that PAK5 dramatically increased the migration capability in 11Z and HESC cells (Fig.2 and 2D). Next, whether PAK5 influenced several key genes was explored, which were related to the EMT signal pathway. The epithelial marker E-cadherin was downregulated, and EMT inducers (vimentin, snail, β-catenin, and α-SMA) were upregulated when PAK5 was stably overexpressed (Fig.2). On the contrary, the knockdown of PAK5 led to opposing effects (Fig.2). Moreover, Western blot analysis was used to detect the expression level of EMT-related markers (Fig.2 and 2H). Concomitant with the abovementioned findings, IHC analysis of ectopic endometrial tissues substantiated that PAK5 was a driver of the EMT signaling pathway in endometriosis (Fig. S2C). Our results indicate that PAK5 promotes the cell migration and invasion in endometriotic cells.

Fig.2 PAK5 promotes the migration and invasion of endometriotic cells. (A, B) Stably overexpressed or knocked down PAK5 of 11Z and HESC cells showed invasion ability by transwell invasion assay. The invaded cells were fixed and stained with crystal violet. (C, D) Representative images of 11Z and HESC cells wound healing stably overexpressed or knocked down PAK5 were showed. (E, F) qRT-PCR analysis of the indicated mRNA levels in 11Z and HESC cells stably overexpressed or knocked down PAK5. (G, H) Relative fold change in indicated protein levels were determined by Western blot in 11Z and HESC cells transfected with Flag-PAK5 or stably knocked down PAK5. All data are represented as mean ± SEM, n = 3, *P < 0.05, **P < 0.01, ***P < 0.001, and ns, not significant.

Full size|PPT slide

3.3 Effects of GNE 2861 on endometriosis in vitro and in vivo

To study PAK5-regulated endometriosis, GNE 2861 as a specific small-molecule inhibitor of the PAK family was used. 11Z and HESC cells were seeded using different concentration gradients of GNE 2861 to obtain the IC₅₀ value of both cell lines (Fig.3 and 3B). Our data showed that GNE 2861 could inhibit the proliferation of 11Z and HESC cells (Fig.3 and 3D). Meanwhile, the colony formation assay indicated that GNE 2861 could block the proliferation of both cell lines (Fig.3). Furthermore, GNE 2861 could inhibit the migration of 11Z and HESC cells, which was demonstrated by the wound healing assay (Fig.3). Similarly, the transwell migration assay also substantiated that GNE 2861 blocked the migration ability of 11Z and HESC cells (Fig. S3A). The invasion ability of 11Z and HESC cells was also evaluated by the transwell invasion assay using the GNE 2861 inhibitor (Fig.3). In addition, the GNE 2861 inhibitor led to the upregulation of the epithelial marker E-cadherin and the downregulation of the mRNA levels of EMT inducers (vimentin, snail, β-catenin, and α-SMA; Fig.3). Furthermore, to determine the GNE 2861 inhibitor modulating the development of endometriosis in vivo, we constructed the mouse model of endometriosis (Fig.3). However, we found that only four ectopic endometrial tissues of the mice treated with GNE 2861 were observed (Fig.3). Consistently, the volume and weight of ectopic lesions from the experimental group significantly reduced compared with the control group (Fig.3 and 3L). Moreover, EMT-related markers except for E-cadherin were significantly suppressed in ectopic endometrial tissues from the experimental group in contrast to the control group by IHC (Fig. S3B). In addition, GNE 2861 significantly impacted the protein expression of EMT-related markers by Western blot analysis (Fig. S3C). All these data suggest that GNE 2861 plays a therapeutic role in the mouse model of endometriosis, which indicates that PAK5 is a potential target for the treatment of endometriosis.

Fig.3 Effects of GNE 2861 on endometriosis in vitro and in vivo. (A, B) After exposure to different concentration gradients of GNE 2861, the IC50 value of the drug in 11Z and HESC cells was measured. (C, D) After exposure to GNE 2861, the cell proliferation of 11Z and HESC cells was assessed using the cell proliferation assay. The cell numbers were recorded for four consecutive days. (E) The colony formation capacity of 11Z and HESC cells was determined by using the colony formation assay. One day later, the indicated cells were seeded in six-well plates. GNE 2861 was added to the experimental group, and then clone numbers were analyzed until visible cell colonies were formed. (F) Wound healing assay was performed. The cell cultures were wounded by scratching using a medium pipette tip for 12–24 h at 37 °C. 11Z and HESC cells were treated with GNE 2861 in the experimental group, and then the cell cultures were photographed again. (G) 11Z and HESC cells were co-cultured with GNE 2861. Transwell invasion assay was performed. (H) 11Z and HESC cells were co-cultured with GNE 2861. qRT-PCR analysis was performed. (I) The mouse model of endometriosis was established using 6-week-old C57BL/6 female mice. (J) Excised endometriotic tissues were shown for each group. (K) The volume of the endometriotic tissues was measured. (L) The weight of endometriotic tissues was weighed. All data are represented as mean ± SEM, n≥ 3. *P < 0.05, **P < 0.01, ***P < 0.001, and ns, not significant.

Full size|PPT slide

3.4 PAK5 phosphorylates PKM2 at Ser519

Previously, we demonstrated that PAK5 overexpression dramatically increased the growth of 11Z and HESC cells. To investigate the PAK5 molecular mechanism in endometriosis, mass spectrometry associated with PAK5 was performed (Table S4). We found that PAK5 could directly interact with PKM2, which is a pivotal point of regulation in glucose metabolism [34]. To determine the relationship between PAK5 and PKM2, the Co-IP assay was performed. The data showed that PAK5 interacted with PKM2 (Fig.4, 4B, S4A, and S4B). Furthermore, the immunofluorescence assay demonstrated that PAK5 and PKM2 mostly overlapped in the cytoplasm of the 11Z and HESC cells (Fig.4). In addition, PAK5 overexpression could increase the protein expression level of PKM2 (Fig. S4C). PAK5 could also promote PKM2 protein expression in a dose-dependent way (Fig.4). Consistently, the overexpression or knockdown of PAK5 in 11Z and HESC cells remarkably altered the PKM2 protein level (Fig.4, 4E, S4D, and S4E). However, no significant difference was observed at the mRNA level when PAK5 was overexpressed or knockdown in 11Z and HESC cells (Fig. S4M). Subsequently, we overexpressed PAK5 or kinase-inactive PAK5 (K478M) with PKM2. No difference is found between PAK5 (K478M) and empty vector (Fig.4). Similarly, when PAK5 or kinase-inactive PAK5 (K478M) was overexpressed with PKM2 treated with cycloheximide (CHX), PAK5 did not alter the protein half-life of PKM2 in the presence of CHX (Fig. S4F). Consistent with this finding, the level of ubiquitination did not increase when we overexpressed PAK5 (Fig. S4G). However, we overexpressed PAK5 with PKM2 treated with Leupeptin, which is a broad-spectrum inhibitor of the lysosomal pathway. The protein stability of PKM2 was strongly increased in the presence of Leupeptin, which indicated that the PKM2 protein was degraded through the lysosomal pathway (Fig. S4H).

Fig.4 PAK5 phosphorylates PKM2 at Ser519. (A, B) 11Z and HESC cells were immunoprecipitated with an anti-PAK5 antibody or anti-PKM2 antibody followed by Western blot with the indicated antibodies. (C) The indicated plasmids were transfected into HEK293T cells and analyzed using Western blot. (D, E) The knockdown of PAK5 in 11Z and HESC cells was analyzed by Western blot. (F) HEK293T cells were transfected with Flag-PAK5 (K478M) and Flag-PAK5 followed by Western blot. (G) HEK293T cells were transfected with PKM2 truncations and Flag-PAK5 and then immunoprecipitated with the indicated antibody. (H) HEK293T cells were transfected with Flag-APK5 and HA-rPKM2 (S6A, S182A, S249A, or S519A), and then Western blot was performed with the indicated antibodies. (I) HEK293T cells were transfected with Flag-APK5 and HA-rPKM2 (WT, S519A, or S519D) using Western blot with the indicated antibodies. (J) PKM2 phosphorylation levels were analyzed by Western blot with the indicated antibodies. (K) Immunofluorescence co-localization assay was performed after PAK5 overexpression or knockdown in 11Z and HESC cells. All data are represented as mean ± SEM, n = 3, *P < 0.05, **P < 0.01, ***P < 0.001, and ns, not significant.

Full size|PPT slide

To confirm the PKM2 domain that is bound to PAK5, we constructed PKM2-truncated fragments (Fig. S4I). The Co-IP assay demonstrated that PAK5 bound to the PKM2 fragment (390–531 aa, Fig.4). In general, PAK5 acted on its targets mostly through phosphorylation. To confirm which phosphorylation site in PKM2 was phosphorylated by PAK5, Ser6, Ser182, Ser249, and Ser519 were predicted using GPS software (Fig. S4J) [35]. The four candidate phosphorylation sites were individually substituted with alanine (S6A, S182A, S249A, and S519A). We found that only the protein level of the PKM2 S519A mutant did not change when PAK5 was overexpressed (Fig.4). Meanwhile, we also found that PAK5 could not change the protein stability of the PKM2 S519A mutant and PKM2 S519D mutant (Fig.4). Hence, we demonstrated that PKM2 was phosphorylated by PAK5 at Ser519. Additionally, PAK5 enhanced the phosphorylation level of PKM2, whereas the kinase-inactive PAK5 (K478M) abolished PAK5-induced Ser519 phosphorylation on PKM2 using antibody that specifically recognizes PKM2 Ser519 phosphorylation (Fig.4). Moreover, phosphorylation of PKM2 at Ser519 was also identified in PTMs database, which was consistent with our data. Furthermore, the in vitro kinase assay confirmed that PAK5 directly phosphorylated PKM2 at Ser519 (Fig. S4K). Furthermore, PAK inhibitor GNE 2861 also affect PKM2 phosphorylation (Fig. S4L). Therefore, PAK5 phosphorylates PKM2 at Ser519.

3.5 PAK5 promotes PKM2-dependent glycolysis in endometriotic cells

To clarify whether PAK5 was dependent on PKM2 to regulate glucose metabolism in endometriosis, glucose consumption and lactate production were determined. PAK5 overexpression could increase glucose consumption and lactate production (Fig.5 and 5C). When PAK5 was knocked down, glucose consumption and lactate production were decreased in 11Z and HESC cells (Fig.5 and 5D). Subsequently, GNE 2861 decreased glucose consumption and lactate production (Fig.5 and 5F). Furthermore, whether PKM2 was required for the PAK5 regulation of glycolysis in endometriosis was determined. Hence, we knocked down PKM2 in 11Z or HESC cells using siRNA and overexpressed PAK5 simultaneously; consequently, PKM2 was required for PAK5-induced glycolysis in 11Z and HESC cells (Fig.5–5J). To confirm whether PAK5-mediated phosphorylation of PKM2 could regulate glucose metabolism in endometriosis, we reconstituted HA-tagged rPKM2 (WT, S519A, or S519D) in PKM2-depleted 11Z and HESC cells. Our study found that PKM2 S519A blocked glucose consumption and lactate production, which suggested that PKM2 Ser519 phosphorylation promoted glycolysis in endometriosis (Fig.5–5N). Then, we investigated the role of PAK5 on the glycolytic rate in 11Z and HESC cells using Seahorse Bioscience Flux Analyzer. PAK5 promoted the glycolytic rate of 11Z and HESC cells (Fig.5–5R). In general, PAK5-mediated PKM2 phosphorylation contributes to glycolysis in endometriotic cells.

Fig.5 PAK5 promotes PKM2-dependent glycolysis in endometriotic cells. (A, C) 11Z and HESC cells were transfected with Flag-PAK5 or empty vector and re-plated in six-well plates. After 24 h, the serum-free medium was collected for the detection of glucose consumption and lactic acid production using the glucose and lactic acid kits. (B, D) 11Z and HESC cells stably knocked down PAK5. Glucose consumption and lactic acid production were detected. (E, F) 11Z and HESC cells were treated with GNE 2861, and the serum-free medium was collected for the detection of glucose consumption and lactic acid production using the glucose and lactic acid kits. (G–J) 11Z and HESC cells were transfected with Flag-PAK5 and siPKM2. After 24 h, the serum-free medium was collected for the detection of glucose consumption and lactic acid production using the glucose and lactic acid kits. (K–N) Depleted PKM2 and reconstituted expression of rPKM2 (WT, S519A, or S519D) in 11Z and HESC cells; the serum-free medium was collected for the detection of glucose consumption and lactic acid production. (O–R) After PAK5 overexpression or knockdown in 11Z and HESC cells, the ECAR levels were measured using the Seahorse Bioscience Flux Analyzer. All data are represented as mean ± SEM, n = 3, *P < 0.05, **P < 0.01, ***P < 0.001, and ns, not significant.

Full size|PPT slide

3.6 PKM2 Ser519 phosphorylation promotes cell proliferation and migration in vitro

To determine the effect of PKM2 Ser519 phosphorylation, we reconstituted HA-tagged rPKM2 (WT, S519A, or S519D) in PKM2-depleted 11Z and HESC cells (Fig. S5A and S5B). As expected, rPKM2 S519A expression failed to promote cell proliferation in 11Z and HESC cells, which was verified by the cell proliferation assay (Fig.6 and 6B). The colony formation assay also showed that rPKM2 S519A significantly inhibited the cell proliferation (Fig.6). In addition, rPKM2 S519A significantly suppressed the migration ability, which was confirmed by wound healing assay (Fig.6). Furthermore, the transwell invasion assay showed that rPKM2 S519A significantly attenuated the invasion ability of 11Z and HESC cells (Fig.6). Consistently, the transwell migration assay confirmed that rPKM2 S519A significantly decreased the migration ability of 11Z and HESC cells (Fig. S5C). Collectively, these results indicate that PAK5-mediated PKM2 phosphorylation facilitates the growth of endometriotic cells.

Fig.6 PKM2 Ser519 phosphorylation promotes cell proliferation and migration in vitro. (A, B) Cell proliferation was assessed by cell proliferation assay in PKM2-depleted and reconstituted expression of rPKM2 (WT, S519A, or S519D) in 11Z and HESC cells. Cell counts were determined on four consecutive days to analyze cell growth. (C) The clone formation numbers were counted and analyzed in PKM2-depleted and reconstituted expression of rPKM2 (WT, S519A, or S519D) in 11Z and HESC cells. (D) Representative images of 11Z and HESC cell wound healing were shown in PKM2-depleted and reconstituted expression of rPKM2 (WT, S519A, or S519D) in 11Z and HESC cells. (E) Transwell invasion assay was performed to detect the invasion ability in PKM2-depleted and reconstituted expression of rPKM2 (WT, S519A, or S519D) in 11Z and HESC cells. The invaded cells were fixed and stained with crystal violet. All data are represented as mean ± SEM, n = 3, *P < 0.05, **P < 0.01, ***P < 0.001, and ns, not significant.

Full size|PPT slide

3.7 PAK5 expression is positively correlated with PKM2

We next evaluated the PAK5 and PKM2 expression in ectopic endometrial tissues from humans by IHC. The results showed that PAK5 expression had a positive relationship with PKM2 expression (Fig.7 and 7B). In addition, we uncovered that PAK5 and PKM2 strikingly increased at mRNA levels in the EcEM samples compared with the normal endometrial tissue samples (Fig. S6A and S6B). Furthermore, PAK5 and PKM2 expression in ectopic endometrial tissues from mice were evaluated by IHC (Fig.7). Meanwhile, the relationship between PKM2 phosphorylation and endometriosis was detected by immunostaining. The expression level of pSer519-PKM2 was high in endometriosis samples (Fig. S6C). The protein levels of PAK5 and PKM2 of mouse embryonic fibroblast cells from mouse embryos were consistent with the aforementioned finding (Fig. S6D). The results indicate that PAK5 has a positive correlation with PKM2 in endometriosis.

Fig.7 PAK5 expression is positively correlated with PKM2. (A) Representative images of PAK5 and PKM2 immunohistochemical staining in histopathologic sections of human endometriotic tissues are shown (scale bar, 20 μmol/L). (B) Pearson correlation analysis was performed on PAK5 and PKM2 semi-quantitative staining scores (n = 30, ***P < 0.001). (C) Representative images of immunohistochemical staining and H&E staining in histopathological sections of mouse endometriotic tissues. (D) A mechanism model of the PAK5-mediated phosphorylation of PKM2 promoting the progression of endometriosis. All data are represented as mean ± SEM, n≥ 3, *P < 0.05, **P < 0.01, ***P < 0.001, and ns, not significant.

Full size|PPT slide

4 Discussion

Endometriosis is defined as the deposition and growth of functioning endometrial tissues outside the uterine cavity [1]. The occurrence of endometriosis is complex with multiple factors [36]. Furthermore, endometriosis is a reproductive disease and an estrogen-dependent disorder affecting approximately 5%–10% of women worldwide [37]. However, its pathogenesis and pathophysiology are unclear. At present, endometriosis has no effective solution. So far, understanding the pathological mechanism of endometriosis is a challenge. Thus, identifying the molecular mechanisms associated with endometriosis aids in developing more promising therapies.

PAKs are downstream effectors in several disease signaling pathways [38]. PAK5 belongs to the PAK family member, which is overexpressed in many human malignancies [7,39–41]. However, the mechanisms of PAK5 functions in endometriosis progression remain unclear. Here, PAK5 significantly induced the development of endometriosis in vivo and in vitro. In addition, PAK5 directly phosphorylated PKM2 and regulated its protein stability in endometriotic cells. Women with endometriosis exhibit significantly higher glycolysis, and endometriosis lesions use glycolysis as a means of energy production, which is similar to the Warburg effect [42]. Moreover, the glycolytic capacity is enhanced, and glycolysis-related genes are upregulated in endometriosis [43]. Water-extracted P. vulgaris aggravates endometriosis by reprogramming Warburg-like metabolism [44]. Cinnamic acid affects endometrial stromal cells by targeting PKM2 to inhibit cell viability, invasion, and glycolysis in primary endometrial stromal cells [45]. In addition, HSF1 promotes glycolysis in endometriosis by upregulating PFKFB3 [46]. Furthermore, compared with eutopic endometrial stromal cells, the upregulation of PDK1 is accompanied by increasing lactate production and oxygen consumption rate, which provides a survival advantage to adapt to a hypoxic microenvironment in ectopic endometriotic stromal cells [47]. Furthermore, TGF-β1 enhances the development of endometriosis via glycolysis, which is mediated via HIF-1α-increasing lactate production to promote the progression of endometriosis [48]. Glycolysis requires an adequate uptake of glucose mediated by glucose transporter proteins, which are highly expressed in endometrial tissue and maintain the glycolysis in endometriosis [49]. Decreased oocyte quality in patients with endometriosis is related to glucose metabolism in granulosa cells [50]. In general, glycolysis is an important pathophysiological basis for endometriosis. Here, the elevated PKM2 protein level was due to PAK5. Mechanistically, PAK5 directly phosphorylated PKM2 on Ser519. PAK5-mediated PKM2 phosphorylation promoted glycolysis in endometriosis (Fig.7). Furthermore, PKM2 has several formation groups of monomers, dimers, and tetramers, which plays an integral role in cellular metabolism and disease progression [13,51]. Nevertheless, the specific molecular mechanism must be further explored in endometriosis.

In this study, we identified PAK5 as a new mediator of PKM2 and uncovered a new molecular target for endometriosis progression, which provides an underlying therapeutic avenue for the treatment of endometriosis.

References

[1] de Ziegler D, Borghese B, Chapron C. Endometriosis and infertility: pathophysiology and management. Lancet 2010; 376(9742): 730–738

[2] Sells MA, Boyd JT, Chernoff J. p21-activated kinase 1 (Pak1) regulates cell motility in mammalian fibroblasts. J Cell Biol 1999; 145(4): 837–849

[3] Jaffer ZM, Chernoff J. p21-activated kinases: three more join the Pak. Int J Biochem Cell Biol 2002; 34(7): 713–717

[4] Ye DZ, Field J. PAK signaling in cancer. Cell Logist 2012; 2(2): 105–116

[5] Wang XX, Cheng Q, Zhang SN, Qian HY, Wu JX, Tian H, Pei DS, Zheng JN. PAK5-Egr1-MMP2 signaling controls the migration and invasion in breast cancer cell. Tumour Biol 2013; 34(5): 2721–2729

[6] Zhu G, Li X, Guo B, Ke Q, Dong M, Li F. PAK5-mediated E47 phosphorylation promotes epithelial-mesenchymal transition and metastasis of colon cancer. Oncogene 2016; 35(15): 1943–1954

[7] Dan C, Nath N, Liberto M, Minden A. PAK5, a new brain-specific kinase, promotes neurite outgrowth in N1E-115 cells. Mol Cell Biol 2002; 22(2): 567–577

[8] Geng N, Li Y, Zhang W, Wang F, Wang X, Jin Z, Xing Y, Li D, Zhang H, Li Y, Li X, Cheng M, Jin F, Li F. A PAK5-DNPEP-USP4 axis dictates breast cancer growth and metastasis. Int J Cancer 2020; 146(4): 1139–1151

[9] Xing Y, Li Y, Hu B, Han F, Zhao X, Zhang H, Li Y, Li D, Li J, Jin F, Li F. PAK5-mediated AIF phosphorylation inhibits its nuclear translocation and promotes breast cancer tumorigenesis. Int J Biol Sci 2021; 17(5): 1315–1327

[10] Dombrauckas JD, Santarsiero BD, Mesecar AD. Structural basis for tumor pyruvate kinase M2 allosteric regulation and catalysis. Biochemistry 2005; 44(27): 9417–9429

[11] Kato H, Fukuda T, Parkison C, McPhie P, Cheng SY. Cytosolic thyroid hormone-binding protein is a monomer of pyruvate kinase. Proc Natl Acad Sci USA 1989; 86(20): 7861–7865

[12] Yang W, Xia Y, Ji H, Zheng Y, Liang J, Huang W, Gao X, Aldape K, Lu Z. Nuclear PKM2 regulates β-catenin transactivation upon EGFR activation. Nature 2011; 480(7375): 118–122

[13] Shi X, You L, Luo RY. Glycolytic reprogramming in cancer cells: PKM2 dimer predominance induced by pulsatile PFK-1 activity. Phys Biol 2019; 16(6): 066007

[14] Yang W, Zheng Y, Xia Y, Ji H, Chen X, Guo F, Lyssiotis CA, Aldape K, Cantley LC, Lu Z. ERK1/2-dependent phosphorylation and nuclear translocation of PKM2 promotes the Warburg effect. Nat Cell Biol 2012; 14(12): 1295–1304

[15] Vander Heiden MG, Cantley LC, Thompson CB. Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science 2009; 324(5930): 1029–1033

[16] Koppenol WH, Bounds PL, Dang CV. Otto Warburg’s contributions to current concepts of cancer metabolism. Nat Rev Cancer 2011; 11(5): 325–337

[17] Zhang Z, Deng X, Liu Y, Liu Y, Sun L, Chen F. PKM2, function and expression and regulation. Cell Biosci 2019; 9(1): 52

[18] Yao Q, Jing G, Zhang X, Li M, Yao Q, Wang L. Cinnamic acid inhibits cell viability, invasion, and glycolysis in primary endometrial stromal cells by suppressing NF-κB-induced transcription of PKM2. Biosci Rep 2021; 1: BSR20211828

[19] Gaetje R, Kotzian S, Herrmann G, Baumann R, Starzinski-Powitz A. Nonmalignant epithelial cells, potentially invasive in human endometriosis, lack the tumor suppressor molecule E-cadherin. Am J Pathol 1997; 150(2): 461–467

[20] Krikun G, Mor G, Alvero A, Guller S, Schatz F, Sapi E, Rahman M, Caze R, Qumsiyeh M, Lockwood CJ. A novel immortalized human endometrial stromal cell line with normal progestational response. Endocrinology 2004; 145(5): 2291–2296

[21] Ren C, Yang T, Qiao P, Wang L, Han X, Lv S, Sun Y, Liu Z, Du Y, Yu Z. PIM2 interacts with tristetraprolin and promotes breast cancer tumorigenesis. Mol Oncol 2018; 12(5): 690–704

[22] Ren C, Han X, Lu C, Yang T, Qiao P, Sun Y, Yu Z. Ubiquitination of NF-κB p65 by FBXW2 suppresses breast cancer stemness, tumorigenesis, and paclitaxel resistance. Cell Death Differ 2022; 29(2): 381–392

[23] Lu C, Ren C, Yang T, Sun Y, Qiao P, Wang D, Lv S, Yu Z. A noncanonical role of fructose-1, 6-bisphosphatase 1 is essential for inhibition of Notch1 in breast cancer. Mol Cancer Res 2020; 18(5): 787–796

[24] Yang T, Ren C, Qiao P, Han X, Wang L, Lv S, Sun Y, Liu Z, Du Y, Yu Z. PIM2-mediated phosphorylation of hexokinase 2 is critical for tumor growth and paclitaxel resistance in breast cancer. Oncogene 2018; 37(45): 5997–6009

[25] Han X, Ren C, Yang T, Qiao P, Wang L, Jiang A, Meng Y, Liu Z, Du Y, Yu Z. Negative regulation of AMPKα1 by PIM2 promotes aerobic glycolysis and tumorigenesis in endometrial cancer. Oncogene 2019; 38(38): 6537–6549

[26] Han X, Ren C, Lu C, Qiao P, Yang T, Yu Z. Deubiquitination of MYC by OTUB1 contributes to HK2 mediated glycolysis and breast tumorigenesis. Cell Death Differ 2022; 29(9): 1864–1873

[27] Lu C, Qiao P, Sun Y, Ren C, Yu Z. Positive regulation of PFKFB3 by PIM2 promotes glycolysis and paclitaxel resistance in breast cancer. Clin Transl Med 2021; 11(4): e400

[28] Somigliana E, Viganò P, Rossi G, Carinelli S, Vignali M, Panina-Bordignon P. Endometrial ability to implant in ectopic sites can be prevented by interleukin-12 in a murine model of endometriosis. Hum Reprod 1999; 14(12): 2944–2950

[29] Greaves E, Cousins FL, Murray A, Esnal-Zufiaurre A, Fassbender A, Horne AW, Saunders PT. A novel mouse model of endometriosis mimics human phenotype and reveals insights into the inflammatory contribution of shed endometrium. Am J Pathol 2014; 184(7): 1930–1939

[30] Yin B, Jiang H, Liu X, Guo SW. Enriched environment decelerates the development of endometriosis in mouse. Reprod Sci 2020; 27(7): 1423–1435

[31] Nieto MA. Epithelial-mesenchymal transitions in development and disease: old views and new perspectives. Int J Dev Biol 2009; 53(8–10): 1541–1547

[32] Sano M, Morishita T, Nozaki M, Yokoyama M, Watanabe Y, Nakano H. Elevation of the phospholipase A2 activity in peritoneal fluid cells from women with endometriosis. Fertil Steril 1994; 61(4): 657–662

[33] Weimar CHE, Macklon NS, Post Uiterweer ED, Brosens JJ, Gellersen B. The motile and invasive capacity of human endometrial stromal cells: implications for normal and impaired reproductive function. Hum Reprod Update 2013; 19(5): 542–557

[34] Li T, Han J, Jia L, Hu X, Chen L, Wang Y. PKM2 coordinates glycolysis with mitochondrial fusion and oxidative phosphorylation. Protein Cell 2019; 10(8): 583–594

[35] Li Y, Xing Y, Wang X, Hu B, Zhao X, Zhang H, Han F, Geng N, Wang F, Li Y, Li J, Jin F, Li F. PAK5 promotes RNA helicase DDX5 sumoylation and miRNA-10b processing in a kinase-dependent manner in breast cancer. Cell Rep 2021; 37(12): 110127

[36] Taylor HS, Kotlyar AM, Flores VA. Endometriosis is a chronic systemic disease: clinical challenges and novel innovations. Lancet 2021; 397(10276): 839–852

[37] do Amaral VF, Bydlowski SP, Peranovich TC, Navarro PA, Subbiah MT, Ferriani RA. Lipid peroxidation in the peritoneal fluid of infertile women with peritoneal endometriosis. Eur J Obstet Gynecol Reprod Biol 2005; 119(1): 72–75

[38] Aburatani T, Inokuchi M, Takagi Y, Ishikawa T, Okuno K, Gokita K, Tomii C, Tanioka T, Murase H, Otsuki S, Uetake H, Kojima K, Kawano T. High expression of P21-activated kinase 5 protein is associated with poor survival in gastric cancer. Oncol Lett 2017; 14(1): 404–410

[39] Bao Z, Ji W, Yang Y, Chen Z, Li Z, Wang K, Lu T, Yu Y, Xia W, Lu S. PAK5 promotes the cell stemness ability by phosphorylating SOX2 in lung squamous cell carcinomas. Exp Cell Res 2020; 395(2): 112187

[40] Han K, Zhou Y, Tseng KF, Hu H, Li K, Wang Y, Gan Z, Lin S, Sun Y, Min D. PAK5 overexpression is associated with lung metastasis in osteosarcoma. Oncol Lett 2018; 15(2): 2202–2210

[41] Pandey A, Dan I, Kristiansen TZ, Watanabe NM, Voldby J, Kajikawa E, Khosravi-Far R, Blagoev B, Mann M. Cloning and characterization of PAK5, a novel member of mammalian p21-activated kinase-II subfamily that is predominantly expressed in brain. Oncogene 2002; 21(24): 3939–3948

[42] Young VJ, Brown JK, Saunders PT, Duncan WC, Horne AW. The peritoneum is both a source and target of TGF-β in women with endometriosis. PLoS One 2014; 9(9): e106773

[43] Hou S, Lei S, Peng H, Weng L, Lv S, Li M, Zhao D. Downregulating HK2 inhibits proliferation of endometrial stromal cells through a noncanonical pathway involving phosphorylation of signal transducer and activator of transcription 1 in endometriosis. Biol Reprod 2022; 107(2): 488–499

[44] Cho MK, Jin L, Han JH, Jin JS, Cheon SY, Shin S, Bae SJ, Park JK, Ha KT. Water-extracted Prunella vulgaris alleviates endometriosis by reducing aerobic glycolysis. Front Pharmacol 2022; 13: 872810

[45] Yao Q, Jing G, Zhang X, Li M, Yao Q, Wang L. Cinnamic acid inhibits cell viability, invasion, and glycolysis in primary endometrial stromal cells by suppressing NF-κB-induced transcription of PKM2. Biosci Rep 2021; 1: BSR20211828

[46] Wang Y, Xiu J, Yang T, Ren C, Yu Z. HSF1 promotes endometriosis development and glycolysis by up-regulating PFKFB3 expression. Reprod Biol Endocrinol 2021; 19(1): 86

[47] Lee HC, Lin SC, Wu MH, Tsai SJ. Induction of pyruvate dehydrogenase kinase 1 by hypoxia alters cellular metabolism and inhibits apoptosis in endometriotic stromal cells. Reprod Sci 2019; 26(6): 734–744

[48] Young VJ, Ahmad SF, Brown JK, Duncan WC, Horne AW. ID2 mediates the transforming growth factor-β1-induced Warburg-like effect seen in the peritoneum of women with endometriosis. Mol Hum Reprod 2016; 22(9): 648–654

[49] von Wolff M, Ursel S, Hahn U, Steldinger R, Strowitzki T. Glucose transporter proteins (GLUT) in human endometrium: expression, regulation, and function throughout the menstrual cycle and in early pregnancy. J Clin Endocrinol Metab 2003; 88(8): 3885–3892

[50] Mao J, Zhang J, Cai L, Cui Y, Liu J, Mao Y. Elevated prohibitin 1 expression mitigates glucose metabolism defects in granulosa cells of infertile patients with endometriosis. Mol Hum Reprod 2022; 28(6): gaac018

[51] Wang HJ, Hsieh YJ, Cheng WC, Lin CP, Lin YS, Yang SF, Chen CC, Izumiya Y, Yu JS, Kung HJ, Wang WC. JMJD5 regulates PKM2 nuclear translocation and reprograms HIF-1α-mediated glucose metabolism. Proc Natl Acad Sci USA 2014; 111(1): 279–284

Acknowledgements

The study was supported by research grants from the National Natural Science Foundation of China (Nos. 81972489 and 82003201), the National Natural Science Foundation of Shandong Province (No. ZR2020YQ58), Shandong Province College Science and Technology Plan Project (No. J17KA254), Projects of medical and health technology development program in Shandong province (No. 2018WS057).

Electronic Supplementary Material

Supplementary material is available in the online version of this article at https://doi.org/10.1007/s11684-024-1069-3 and is accessible for authorized users.

Compliance with ethics guidelines

Conflict of interest Jiayi Lu, Xiaoyun Wang, Xiaodan Shi, Junyi Jiang, Lan Liu, Lu Liu, Chune Ren, Chao Lu, and Zhenhai Yu declare that they have no conflict of interest.

This study was approved by the Ethics Committee of the Affiliated Hospital of Shandong Second Medical University and the study was performed in accordance with the ethical standards as laid down in the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards. Informed consent was obtained from all patients for being included in the study. All institutional and national guidelines for the care and use of laboratory animals were followed.

RIGHTS & PERMISSIONS

2024 Higher Education Press