FERM domain-containing protein FRMD6 activates the mTOR signaling pathway and promotes lung cancer progression

Abstract

FRMD6, a member of the 4.1 ezrin–radixin–moesin domain-containing protein family, has been reported to inhibit tumor progression in multiple cancers. Here, we demonstrate the involvement of FRMD6 in lung cancer progression. We find that FRMD6 is overexpressed in lung cancer tissues relative to in normal lung tissues. In addition, the enhanced expression of FRMD6 is associated with poor outcomes in patients with lung squamous cell carcinoma (n = 75, P = 0.0054) and lung adenocarcinoma (n = 94, P = 0.0330). Cell migration and proliferation in vitro and tumor formation in vivo are promoted by FRMD6 but are suppressed by the depletion of FRMD6. Mechanistically, FRMD6 interacts and colocalizes with mTOR and S6K, which are the key molecules of the mTOR signaling pathway. FRMD6 markedly enhances the interaction between mTOR and S6K, subsequently increasing the levels of endogenous pS6K and downstream pS6 in lung cancer cells. Furthermore, knocking out FRMD6 inhibits the activation of the mTOR signaling pathway in Frmd6^−/− gene KO MEFs and mice. Altogether, our results show that FRMD6 contributes to lung cancer progression by activating the mTOR signaling pathway.

Keywords

FRMD6 / lung cancer / mTOR pathway

1 Introduction

Lung cancer is the most frequently diagnosed cancer worldwide and the most frequent cause of cancer-related deaths [1]. The Global Cancer Observatory 2020 database reported 2.21 million new cases (11.4% of total cancer cases) and 1.80 million deaths (18.0% of total cancer deaths) by lung cancer [2]. The prognosis of lung cancer is relatively poor, and 75% of the patients with this malignancy are diagnosed at an advanced stage [3]. Lung cancer is classified into small cell lung cancer and non-small cell lung cancer (NSCLC), including adenocarcinoma, squamous carcinoma, and large cell carcinoma. Lung adenocarcinoma (LUAD) accounts for 40% of all lung cancers, and lung squamous cell carcinoma (LUSC) accounts for approximately 25%–30% of all lung cancers [4]. Several efforts have been made to identify and validate characteristic genetic markers for lung cancer, such as estimated glomerular filtration rate, anaplastic lymphoma kinase, KRAS, and ROS1 [5,6]. However, the mechanism underlying the progression of lung cancer remains elusive. Therefore, screening for novel molecular prognostic biomarkers for the auxiliary diagnosis of lung cancer at the early stage is crucial.

The members of the 4.1 ezrin–radixin–moesin (FERM) domain-containing protein family are involved in cytoskeleton formation, intercellular connections, signal transduction, and cell movement. In addition, they are implicated in normal body development and cancer progression. FRMD6, also named Willin, is a member of the FERM domain-containing protein family and has been identified as the human ortholog of Drosophila expanded [7,8]. FRMD6 is widely expressed in neurogenic and non-neurogenic tissues and is involved in several signaling pathways. The aberrant expression of FRMD6 is associated with human diseases and disorders [7,9–11]. FRMD6 is an upstream component of the Hippo pathway and regulates the activity of the transcription cofactors Yes-associated protein/transcriptional coactivator with PDZ binding motif, thereby controlling cell morphology and behavior [12–14]. Furthermore, FRMD6 exerts a tumor-suppressive effect by upregulating p21^Cip1 and downregulating cyclin A to inhibit the progression of the S phase of the cell cycle [15]. FRMD6 inhibits the activity of several receptor tyrosine kinases, including c-Met and platelet-derived growth factor, and their downstream molecules, such as extracellular signal-regulated kinase (ERK) and protein kinase B (AKT) [16]. It also regulates ERK/mitogen-activated protein kinase signaling to control mammalian neuronal differentiation and mechanical phenotypes [8]. However, little is known about how FRMD6 positively regulates mammalian target of rapamycin (mTOR) signaling.

mTOR is a highly conserved serine/threonine protein kinase of the phosphoinositide 3-kinase (PI3K)-related kinase family. The activation of mechanistic target of rapamycin complex 1 (mTOR complex 1) promotes cell growth and proliferation by increasing anabolism, such as protein, lipid, and nucleotide synthesis, and inhibiting catabolism, such as autophagy. mTORC1 is known to primarily promote protein synthesis by phosphorylating two key effectors, namely, P70S6K1 (S6K1) and eIF4E binding protein 1. First, mTORC1 phosphorylates S6K1 at Thr389. Subsequently, it is phosphorylated and activated by PDK1. S6K1 phosphorylates several substrates, such as eukaryotic translation initiation factor 4B, programmed cell death 4, SKAR, and S6, thereby regulating translation extension and mRNA and ribosome biogenesis to promote protein synthesis [17]. The disruption of the activity of the mTOR signaling pathway inevitably leads to problems in normal development and cancer progression. Studies have reported that in homozygous mTOR^–/– mice, embryonic development is arrested at the E5.5 stage and inner cell mass and trophoblast cells fail to proliferate [18,19]. These data showed that mTOR is essential for the growth and proliferation of early mouse embryos and embryonic stem cells [18]. In addition, studies have demonstrated that the mTOR pathway is upregulated in several NSCLCs, with elevated p-mTOR in up to 90% of patients with adenocarcinoma, 60% of patients with large cell carcinoma, and 40% of patients with squamous cell carcinoma [20–22]. The downstream products of mTOR S6K and 4E-BP1 are activated in 58% and 25% of NSCLC specimens, respectively [23]. The increased expression of mTOR is associated with poor survival as confirmed by immunohistochemistry (IHC) [24].

Mechanistically, mTOR plays a key role in controlling the synthesis of biological macromolecules, such as proteins, nucleotides, and lipids, that are necessary for cell growth [7]. Activated p70S6K functions as an upstream regulator of Rac1 and Cdc42 that controls actin reorganization during cancer cell movement [8,9]. Activated p70S6K directly interacts with cross-linked F-actin to prevent actin depolymerization by cofilin family proteins [8]. In addition, mTOR, p70S6K, and eIF4E participate in the expression and activity of matrix metalloproteinases in cancer cell and are proteolytic enzymes that are responsible for extracellular matrix degradation during cell invasion [10]. However, the mechanism underlying the regulation of lung cancer by the mTOR pathway remains unknown.

In this study, we demonstrated that FRMD6 promotes the interaction between mTOR and S6K and activates the phosphorylation cascade of the mTOR signaling pathway, thus resulting in lung cancer. Furthermore, this result was reproduced and confirmed in Frmd6^–/– knockout (KO) mice and patients with lung cancer. Therefore, our findings uncovered a new regulatory function for FRMD6.

2 Materials and methods

2.1 Animals and genotyping

All animal studies conformed to the relevant regulatory standards and were approved by the Institutional Animal Care Committee of the Beijing Institute of Biotechnology. Frmd6-eKO1 mice (ID Frmd6: 319710, C57BL/6 genetic background) were generated by using CRISPR/Cas9 technology (Shanghai Model Organisms Center, Inc.). The guide RNA-targeting exon 3 of Frmd6 gene was designed. Cas9 mRNA and gRNA were obtained through in vitro transcription. Cas9 mRNA and gRNA were microinjected into the fertilized eggs of C57BL/6J mice to obtain F0 generation mice. The genotype of the F0 generation mice was identified by using PCR. PCR products were further verified through DNA sequencing. The positive F0 generation mice and wild-type (WT) mice were bred to obtain F1 Frmd6 heterozygote mice. The mice were housed at the Laboratory Animal Center of Peking University Health Science Center with a standard 12 h light/dark schedule, standard chow, and water. For the identification of mouse embryo genotypes, genomic DNA was prepared from the tail tips of 13.5-day-old embryos, and the Frmd6 mutation was identified through PCR amplification. Mouse genotypes were determined through PCR by using DNA prepared from mouse tail samples. PCR products were separated through gel electrophoresis on 1.5% agarose gel.

Frmd6 KO genotypes were identified by using the following primers:

Frmd6 5′–3′arm

P1: AAAAATGGTAAAAGACAGAACA;

P2: GACACAATCAGGCACTTTTTA;

P3: GTGAGGCGTTGCATTGGT;

P4: CATTTGTAGCGTTGTAGATGGTAA.

The reaction conditions were as follows: 5 min at 94 °C and 35 cycles of 30 s at 94 °C, 30 s at 58 °C, and 1 min at 72 °C followed by a 1 min cycle at 72 °C.

WT: A 291 bp fragment was obtained by using P1 and P2, and no fragments were provided by P3 and P4. Heterozygote: A 291 bp fragment was acquired with P1 and P2, and a 555 bp fragment was obtained with P3 and P4. KO: A 555 bp fragment was obtained with P3 and P4, and P1 and P2 could not provide a fragment.

2.2 Cell culture, treatment, and stable cell line establishment

The human embryonic kidney cell line HEK-293T and the human cervical carcinoma cell line HeLa were cultured in DMEM supplemented with 10% FBS (Invitrogen, Carlsbad, CA, USA), 2 mmol/L glutamine, 100 units/mL penicillin, and 0.1 mg/mL streptomycin. Human lung cancer cell lines (NCI-H1299 and A549) were cultured in RPMI 1640 supplemented with 10% FBS (Invitrogen, Carlsbad, CA, USA), 2 mmol/L glutamine, 100 units/mL penicillin, and 0.1 mg/mL streptomycin. The same batch of cells was thawed every 1–2 months. All cells were maintained at 37 °C and 1% O₂/5% CO₂ (vol/vol) and passaged by using 0.25% trypsin/0.02% EDTA for dissociation at 80% confluence.

For transient transfection, 70%–80% confluent cells were transfected with the indicated plasmids and small interfering RNA (siRNA) by using Lipofectamine 2000 and RNAi MAX, respectively, in accordance with the manufacturer’s instructions (Invitrogen).

FRMD6 KO cancer cells were generated by using CRISPR/Cas9 (Genloci Biotechnologies Inc.). CRISPRs were designed with a CRISPR design web tool. SgRNA sequences were ligated to the LentiCRISPRv2 plasmid then co-transfected with viral packaging plasmids (psPAX2 and pMD2G) into HEK-293T cells to generate H1299 FRMD6 KO cell lines [25]. The medium was changed 8 h after transfection, and the viral supernatant was filtered through a 0.45 mm strainer 24 h later. Targeted cells were infected by using the viral supernatant and selected with 2 µg/mL puromycin for 2 weeks. The sgRNA sequences targeting FRMD6 were designed by utilizing a CRISPR designer tool. The guide sequences of human FRMD6 are shown below:

FRMD6 (KO#1)

Forward: 5′- CACCGCATCACGGTGTTCGACTACG-3′;

Reverse: 5′- AAACGTAGTGCCACAAGCTGATGCC-3′.

FRMD6 (KO#2)

Forward: 5′- CACCGGCGGACGCGGAGCGCCCCTC-3′;

Reverse: 5′- AAACCGCCTGCGCCTCGCGGGGAGC-3′.

The cDNA of pLVX-Flag-tagged FRMD6 was subcloned into the pLVX-Flag retrovirus vector. The two plasmids were co-transfected with viral packaging plasmids (psPAX2 and pMD2G) into HEK-293T cells [25]. The medium was changed 8 h after transfection, and the viral supernatant was filtered through a 0.45 mm strainer 24 h later. The H1299 cell lines were infected by using the viral supernatant and selected with 2 µg/mL puromycin for 2 weeks.

2.3 In vivo xenograft tumor growth experiments

H1299 cells were left untreated or transfected with FRMD6 siRNA. Then, 4 × 10⁶ cells resuspended in PBS were mixed with MaxGel ECM (E0282, Sigma-Aldrich) at the ratio of 1:10 (v/v) and injected into the unilateral anterior armpits of 14–16 g female BALB/c nude mice. Tumor size was measured every 3 days with a caliper, and the tumor volume was determined by using the formula L × W²× 0.5, where L is the longest diameter, and W is the shortest diameter of the xenograft. At 26 days after injection, the tumors were removed. The tumors were photographed. Then, their weights and volumes were measured.

2.4 Immunofluorescence staining and confocal microscopy

Human lung cancer NCI-H1299 cells and human cervical carcinoma HeLa cells were cultured on coverslips, washed with PBS three times, fixed in 4% formaldehyde, permeabilized with 0.1% NP40, stained with specific primary antibodies overnight at 4 °C, then incubated with secondary antibodies conjugated with Alexa Fluor 488 or 568 (Invitrogen) for 45 min at room temperature. The cells were also stained with 4ʹ,6-diamidino-2-phenylindole (DAPI) to visualize nuclei. The primary antibodies mouse anti-Flag (Cat#F1804; Sigma-Aldrich, 1:100), rabbit anti-mTOR (Cat#2983; Cell Signaling Technology, 1:50), and rabbit anti-S6K (Cat#2708; Cell Signaling Technology, 1:50) were used. The stained cells were visualized under 63× magnification by employing confocal microscopy (Zeiss LSM 780 with Airyscan). The image-collecting software was Zen Black (ZEISS), and the images were exported and analyzed with Zen Blue (ZEISS).

2.5 Western blot analysis and antibodies

Proteins were analyzed through Western blot (WB) analysis in accordance with standard methods. Tissues or cell lysates were treated with RIPA lysis buffer containing 1× cocktail inhibitor (Roche, Basel, Switzerland) and 1× PhosSTOP (Roche, Basel, Switzerland). The samples were supplemented with 5× loading buffer or 2× loading buffer heated at 100 °C for 10 min and separated through SDS–PAGE. Polyvinylidene fluoride (PVDF) membranes were immunoblotted with primary antibodies overnight at 4 °C. After being washed with TBST buffer three times, the membranes were incubated with horseradish peroxidase (HP)-conjugated secondary antibody for 1 h at 4 °C. Enhanced chemiluminescence (ECL, Amersham Biosciences, Sunnyvale, CA, USA) was used to detect immobilized antibodies. Visualization was performed by using ECL (Thermo Fisher Scientific, #32106) [26]. The antibodies used were commercially obtained: mouse anti-Flag (Cat#F1804; Sigma-Aldrich, 1:2000), rabbit anti-HA (Cat#ab9110; Abcam, 1:1000), mouse anti-actin (Cat#TA-09; ZSGB-Bio, 1:2000), rabbit anti-FRMD6 (Cat#14688; Cell Signaling Technology, 1:500), rabbit anti-mTOR (Cat#2983; Cell Signaling Technology, 1:1000), rabbit anti-Phospho-mTOR Ser2481(Cat#2974; Cell Signaling Technology, 1:1000), rabbit anti-S6K (Cat#2708; Cell Signaling Technology, 1:1000), rabbit anti-Phospho-S6K Thr389 (Cat#9205; Cell Signaling Technology, 1:1000), rabbit anti-S6 (Cat#2217; Cell Signaling Technology, 1:1000), and rabbit anti-Phospho-S6 Ser235/236 (Cat#4858; Cell Signaling Technology, 1:2000). Secondary antibodies included goat anti-mouse HP and goat anti-rabbit HP (both Santa Cruz Biotechnology, Inc., 1:4000) (Tab.1).

2.6 Co-immunoprecipitation (Co-IP)

The immunoprecipitation methods used in this work have been described previously [26,27]. In brief, RIPA buffer (1× PBS, pH 7.4, 0.5% sodium deoxycholate, 1% Triton X-100, and 0.1% SDS) containing protease inhibitor cocktail and PhosSTOP was utilized to obtain HEK-293T and H1299 cell lysates. Then, cell debris was removed though centrifugation at 12 000 rpm for 10 min. For each assay, 2 mg of protein was used, and 2 µg of the indicated antibodies was added for each reaction. The indicated antibodies and normal immunoglobulin G (IgG) (as controls) were incubated with the precleared lysates overnight at 4 °C with rotation. The lysates were incubated with 35–50 μL of protein G agarose (Santa Cruz Biotechnology, Inc.) with rotation for 4 h. Then, the beads were washed with RIPA buffer three times and detected through WB analysis. Immunoprecipitation was carried out through incubation with M2 Affinity gel (Sigma-Aldrich) for over 4 h at 4 °C. After the incubation, the beads were washed three times with ice-cold RIPA buffer and detected by using WB analysis.

2.7 IHC staining

The tissue microarrays of patients with LUSC and LUAD were purchased from the National Human Genetic Resources Sharing Service Platform 2005DKA21300 (Shanghai Outdo Biotechnology Company Ltd., China). Sections were deparaffinized with xylene and rehydrated with ethanol. Then, endogenous peroxidase was eliminated through incubation with 3% hydrogen peroxide for 30 min at room temperature, followed by antigen retrieval in sodium citrate at pH 6.0 for 20 min in a 100 °C water bath. The specimens were then incubated with primary antibodies at 4 °C overnight. The PV9000 2-step plus Poly-HP anti-mouse/rabbit IgG detection system (ZSGB-Bio) was applied. Diaminobenzidine was used as the substrate (ChemMate Detection Kit, DAKO, Glostrup, Denmark) [28], and hematoxylin was utilized as a counterstain. The primary antibodies were used at the indicated concentrations for IHC analyses: rabbit anti-FRMD6 (ab218209; Abcam, 1:50) and rabbit anti-Phospho-S6(Ser235/236) (Cat#4858; Cell Signaling Technology, 1:50). Immunostainings were examined and photographed with a BX51 microscope (Olympus).

The tissue sections of patients with LUSC and LUAD were immunohistochemically stained by using the anti-FRMD antibody. The results of immunohistochemical staining were classified into four groups on the basis of four antibody-staining levels: weak staining was designated as 0, faint staining was designated as 1+, moderate staining was designated as 2+, and strong staining was designated as 3+. High expression was defined as ≥2 reactivities. P value < 0.05 was defined as statistically significant. Survival curves were estimated by using the Kaplan–Meier method, and survival rates in different groups were compared through the log-rank test.

2.8 In vitro migration assay

Before the experiment, H1299 cells were transfected with Flag or Flag-FRMD6, control siRNA, or FRMD6 siRNA. Then, the cells were starved for 6 h in RPMI-1640 with 0.1% FBS. A total of 5 × 10⁴ cells in 0.2 mL of 0.1% FBS medium were placed in the upper chamber of a Transwell plate. The chamber was then transferred to a 24-well plate containing 0.5 mL of media with 25% FBS. The cells were incubated at 37 °C for 10 h [29,30].

2.9 Cell proliferation and colony formation assays

The cells were plated into 96-well plates at the density of 600 cells/well. The cells were added with 10 μL of Cell Counting Kit-8 (CCK-8; 40203ES60; YESEN) reagent per well and incubated for 2 h at 37 °C. Then, the reaction mixture was measured by using a microplate reader at 450 nm.

For plate colonies, 800 cells were seeded into six-well plates in triplicate with RPMI-1640 medium supplemented with 10% FBS. After 7 days of growth, the cells were fixed in 4% paraformaldehyde for 15 min and stained with 0.5% crystal violet for 15 min at room temperature.

2.10 Mass spectrometry

HEK-293T cells were used for transfection. A total of 8 × 10⁶ cells were cultured in a 10 cm cell culture dish (6–8 dishes per group). In each dish, 2 mg of plasmid was mixed with 250 mL of OPTI-MEM (Thermo Fisher) and 6 mL of polyethylenimine (PEI, Polysciences) for a 1:4 ratio of plasmid:PEI. Plasmid Flag or Flag-FRMD6 was transfected into the indicated dishes (6–8 dishes per group). Then, the plasmid was mixed with the PEI solution. After 15 min at room temperature, the mixture was applied to the cells. After 48 h, the cells were recovered, washed three times with 1× PBS, and lysed with 400 mL of RIPA buffer (1× PBS, pH 7.4, 0.5% sodium deoxycholate, 1% Triton X-100, and 0.1% SDS) with a protease inhibitor cocktail (Roche). After 30 min at 4 °C, the samples were centrifuged for 15 min at 12 000 rpm and 4 °C. The supernatants were retained, and the protein contents were measured with a BCA Protein Assay Kit (Thermo Fisher) to ensure similar protein concentrations across the two groups. Then, Co-IP was performed with 20 mL of 50% Flag M2 beads (Sigma-Aldrich) at 4 °C for 4 h with rotation. After extended washes, the immune complexes were analyzed by using NuPAGE Tris-Acetate Mini Gels (Life Technologies) and stained with Coomassie brilliant blue. Indicated panels were cut for mass spectrometry analyses.

2.11 Tumor tissue microarray staining

All procedures involving the tumor tissue microarrays were performed in accordance with the aforementioned IHC assay and the manufacturer’s instructions. The clinical staging of the patients was performed in accordance with the 2020 version of the National Comprehensive Cancer Network Guidelines for NSCLC. No patients involved in this investigation received chemotherapy prior to surgery.

3 Results

3.1 Elevated FRMD6 predicts poor outcomes in patients with lung cancer

We first analyzed the expression of the Frmd6 gene in The Cancer Genome Atlas (TCGA) data set to examine the possible role of FRMD6 in lung cancer. The results showed that tumor tissues exhibited considerably higher FRMD6 expression than normal tissues (Fig.1 and 1B, Table S1). Furthermore, we examined the levels of FRMD6 protein in 75 patients with LUSC and 94 patients with LUAD by performing IHC with normal lung tissues as the control (Fig.1). Surprisingly, FRMD6 levels were significantly higher in LUSC (P < 0.0001) and LUAD (P < 0.0001) samples than in normal lung tissues (Fig.1). The probabilities of high expression were 48% in LUSC (Table S2) and 72.34% in LUAD (Table S1 and Tab.2). Kaplan–Meier analysis showed that higher levels of FRMD6 predicted poor overall survival in LUSC (P = 0.0054) and LUAD (P = 0.0330) (Fig.1). In addition, we found that the expression of FRMD6 was correlated with the T grades (P = 0.0166) and N grades (P = 0.0462) of the patients (Tab.2). Altogether, these findings indicated that FRMD6 expression is enhanced in patients with lung cancer and that elevated FRMD6 predicts poor outcomes in patients with lung cancer.

3.2 FRMD6 promotes the proliferation and migration of lung cancer cells

We overexpressed and knocked down Frmd6 in H1299 cells by using the Flag-FRMD6 plasmid or FRMD6 siRNA, respectively, to further explore the biological functions of FRMD6 in vitro. Compared with the control, FRMD6 overexpression markedly promoted the migration (Fig.2 and 2B) and proliferation (Fig.2 and 2D) of H1299 cells. By contrast, the proliferation and migration abilities of H1299 cells were significantly downregulated following the siRNA-mediated knockdown of FRMD6 (Fig.2–2H). H1299 cells with FRMD6 siRNA or control siRNA were injected subcutaneously into BALB/c nude mice at the density of 4 × 10⁶ cells per mouse to examine the function of FRMD6 in tumor formation in vivo. Consistent with the findings on in vitro functions, the xenograft group with FRMD6 knockdown presented slower growth (Fig.2) and smaller tumor size (Fig.2–2K) than the control group. Thus, FRMD6 deletion suppressed the growth of tumors in vivo. Altogether, these findings demonstrated the oncogenic function of FRMD6 in lung cancer cells in vitro and in vivo.

3.3 FRMD6 interacts with mTOR signaling pathway proteins

We identified FRMD6-interacting proteins to uncover the mechanism underlying the function of FRMD6 in promoting lung cancer. We first transfected Flag or Flag-FRMD6 into HEK-293T cells then performed Co-IP. Next, we performed sodium dodecyl sulfate–polyacrylamide gel electrophoresis (Fig.3). We analyzed contents through liquid chromatography with tandem mass spectrometry. We screened molecules with abundance ratios (Flag-FRMD6/Flag) greater than 4 for KEGG pathway enrichment analysis. The results showed that FRMD6 interacted with the proteins of the mTOR signaling pathway (Fig.3, Tables S3 and S4). mTOR is a serine/threonine protein kinase belonging to the phosphatidylinositol 3-kinase-related kinase family; it promotes cell growth by stimulating anabolic processes and repressing catabolic processes, such as autophagy [31]. Co-IP experiments were performed by using lysates obtained from Flag-FRMD6-transfected HEK-293T and H1299 cells to verify the mass spectrometry results. The results showed that endogenous mTOR, S6K, and S6 were co-immunoprecipitated by Flag-FRMD6 (Fig.3). Similarly, in HEK-293T cells, endogenous mTOR, S6K, and S6 were co-immunoprecipitated by endogenous FRMD6 (Fig.3). These results indicated that FRMD6 interacts with the proteins of the mTOR pathway, including mTOR, S6K, and S6, in living cells. Furthermore, by using immunofluorescence staining, we found that FRMD6 and mTOR colocalized in H1299 cells (Fig.3) and FRMD6 and S6K colocalized in HeLa cells (Fig.3). Collectively, these data demonstrated that FRMD6 interacts with key proteins of the mTOR signaling pathway.

3.4 FRMD6 promotes mTOR signaling pathway activation

Next, we explored whether FRMD6 regulates the mTOR signaling pathway. Interestingly, FRMD6 overexpression in H1299 cells significantly increased the levels of pS6K and pS6 (Fig.4). By contrast, the depletion of FRMD6 by the two siRNAs markedly decreased the levels of pS6K and pS6 in H1299 and A549 cells (Fig.4). Furthermore, the depletion of FRMD6 by siRNAs decreased the levels of pS6K and pS6 in SW480 and decreased the level of pS6 in PANC1 cells (Fig.4). In addition, CRISPR/Cas9-mediated FRMD6 KO inhibited the mTOR signaling pathway in H1299 cells (Fig.4). Given that mTOR is an important kinase of S6K, we speculate that the inhibition of S6K activation by FRMD6 could be attributed to the reduced interaction between mTOR and S6K. Co-IP assays were performed to confirm this conjecture. The results indicated that FRMD6 overexpression enhanced the levels of endogenous mTOR co-immunoprecipitated by Flag-S6K in HEK-293T and H1299 cells (Fig.4). However, FRMD6 did not change the extent of combination between S6K and S6. Meanwhile, FRMD6 levels were positively correlated with pS6 and pS6K in various lung cancer cells (Fig.4). As speculated, these results indicated that FRMD6 constitutes a bridge between mTOR and S6K and enhances their interaction to promote the phosphorylation of S6K and subsequently that of S6, finally activating the mTOR signaling pathway.

3.5 FRMD6 deficiency inhibits the mTOR signaling pathway in Frmd6 KO mice

Next, we studied whether FRMD6 regulates the mTOR pathway in vivo. To this end, we established Frmd6 KO mice by using the CRISPR/Cas9 strategy (Fig.5 and 5B). Next, we counted the genotype proportions of born mice (n = 604) and found that Frmd6 KO mice accounted for only 10.76% of all born mice. This result implied that only less than half of Frmd6 KO mice were born (Fig.5). After birth, the size of Frmd6 KO mice was significantly smaller than those of the WT group at the same age (Fig.5). During embryonic development, Frmd6 KO MEFs showed lower levels of pS6K and pS6 than WT MEFs (Fig.5). In addition, the mTOR signaling pathway in adult organs, such as the heart, spleen, and ovaries, of Frmd6 KO mice was severely inhibited relative to that in the same organs of the WT group (Fig.5). To summarize, FRMD6 is an important regulator for the activation of the mTOR signaling pathway during normal mouse development.

3.6 FRMD6 is positively correlated with pS6 in lung cancer samples

We detected the levels of FRMD6 and pS6 in adjacent slices of lung cancer tissues to further verify the regulation of the mTOR signaling pathway by FRMD6 in lung cancer tissues. The levels of FRMD6 and pS6 were positively correlated (Fig.6). On the basis of these findings, we propose the following working model: FRMD6 functions as a scaffold protein and promotes the interaction of mTOR with S6K to stimulate the phosphorylation of S6K, then promotes cell proliferation, migration, and lung cancer progression. By contrast, low FRMD6 levels inhibit the phosphorylation of the mTOR cascade and prevent cell proliferation, migration, and lung cancer progression (Fig.6).

4 Discussion

FRMD6, also named Willin, is a member of FERM domain-containing proteins [7]. The majority of previous studies on FRMD6 have described this protein as a tumor suppressor. However, we demonstrated for the first time that FRMD6 promotes lung cancer progression. We examined the expression of the Frmd6 gene by using the TCGA database and the protein levels of FRMD6 in specimens obtained from 169 cases of lung cancer. The expression of FRMD6 was significantly higher in patients with LUSC and LUAD and was of prognostic value. Moreover, functional experiments in vitro and in vivo suggested that the enhanced expression of FRMD6 promotes lung cancer, whereas its depletion suppresses lung cancer progression. By contrast, FRMD6 has been reported to function as a tumor suppressor in breast cancer [15], pancreatic cancer [9], and other malignant tumors [32]. Therefore, our findings indicated that FRMD6 could also function as a tumor promoter, thereby enhancing our understanding of this scaffold protein.

The mTOR signaling pathway is upregulated in several cancer types, including NSCLC [24], and is regulated by the PI3K–Akt and AMP-activated protein kinase (AMPK) signaling pathways [31,33]. The lysosomal v-ATPase–Ragulator complex is an essential activator of mTORC1 [34]. We provided evidence that FRMD6 directly binds to and phosphorylates important members of the mTOR signaling pathway, such as mTOR, S6K, and S6 (Fig.3). FRMD6 promotes the interaction between mTOR and S6K but not that between S6K and S6 (Fig.4), implying that FRMD6 activates the mTOR signaling pathway by promoting the binding of mTOR to S6K and phosphorylating it. Subsequently, the increased phosphorylation of S6K leads to the enhanced phosphorylation of S6. The depletion of FRMD6 by siRNAs also decreased the levels of pS6K and pS6 in SW480 and decreased the level of pS6 in PANC1 cells. This situation indicates that the regulation of the mTOR signaling pathway by FRMD6 commonly exists in various tumors. The importance of the interaction between FRMD6 and S6 remains to be further explored. Altogether, our findings indicated that FRMD6 is a crucial regulator of the mTOR signaling pathway.

Interestingly, we found that FRMD6 regulates development in mice. The depletion of FRMD6 has been reported to cause a reduction in body size accompanied by the suppression of the mTOR signaling pathway. mTOR is essential for the growth of early mouse embryos and the proliferation of embryonic stem cells [18]. In addition, studies have illustrated that in homozygous mTOR^–/– mice, embryonic development is arrested at the E5.5 stage, and inner cell mass and trophoblast cells fail to proliferate [18,19]. We established a Frmd6 KO mouse model by using the CRISPR/Cas9 technique and found that the deletion of Frmd6 reduced the mouse birth rate, with only less than half of Frmd6 KO mice being born. This result demonstrated that Frmd6 KO mice exhibit a phenotype similar to that presented by mTOR KO mice. Although individuals of Frmd6 KO mice were born, they were considerably smaller than WT mice during lactation. Lower levels pS6K and pS6 were detected in Frmd6 KO MEFs (E13.5) and organs than in the WT groups. These findings indicated that FRMD6 maintains the intrinsic activation of mTOR signaling under physiological conditions.

FRMD6 has previously been identified as an upstream regulator of the Hippo signaling pathway and reported to inhibit mammalian cell growth processes, including cell contact inhibition, apoptosis, proliferation, and tissue regeneration [12–14]. However, we found that FRMD6 is required for lung cancer cell progression and the maintenance of normal body size by controlling the activation of the mTOR signaling pathway. This finding has been supported by reports demonstrating that FRMD6 can act independently of the Hippo signaling pathway [8,35]. Taken together, our results showed that FRMD6 functions as a tumor promoter in lung cancer by activating the mTOR signaling pathway.

References

[1] Didkowska J, Wojciechowska U, Mańczuk M, Łobaszewski J. Lung cancer epidemiology: contemporary and future challenges worldwide. Ann Transl Med 2016; 4(8): 150

[2] Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2021; 71(3): 209–249

[3] Wadowska K, Bil-Lula I, TrembeckiŁ, Śliwińska-Mossoń M. Genetic markers in lung cancer diagnosis: a review. Int J Mol Sci 2020; 21(13): E4569

[4] Ruiz-Cordero R, Devine WP. Targeted therapy and checkpoint immunotherapy in lung cancer. Surg Pathol Clin 2020; 13(1): 17–33

[5] Villalobos P, Wistuba II. Lung cancer biomarkers. Hematol Oncol Clin North Am 2017; 31(1): 13–29

[6] Sears CR, Mazzone PJ. Biomarkers in lung cancer. Clin Chest Med 2020; 41(1): 115–127

[7] Gunn-Moore FJ, Tilston-Lünel AM, Reynolds PA. Willing to be involved in cancer. Genes (Basel) 2016; 7(7): E37

[8] Kronenberg NM, Tilston-Lunel A, Thompson FE, Chen D, Yu W, Dholakia K, Gather MC, Gunn-Moore FJ. Willin/FRMD6 influences mechanical phenotype and neuronal differentiation in mammalian cells by regulating ERK1/2 activity. Front Cell Neurosci 2020; 14: 552213

[9] Haldrup J, Strand SH, Cieza-Borrella C, Jakobsson ME, Riedel M, Norgaard M, Hedensted S, Dagnaes-Hansen F, Ulhoi BP, Eeles R, Borre M, Olsen JV, Thomsen M, Kote-Jarai Z, Sorensen KD. FRMD6 has tumor suppressor functions in prostate cancer. Oncogene 2021; 40(4): 763–776

[10] Chen D, Yu W, Aitken L, Gunn-Moore F. Willin/FRMD6: a multi-functional neuronal protein associated with Alzheimer’s disease. Cells 2021; 10(11): 3024

[11] Beck J, Kressel M. FERM domain-containing protein 6 identifies a subpopulation of varicose nerve fibers in different vertebrate species. Cell Tissue Res 2020; 381(1): 13–24

[12] Angus L, Moleirinho S, Herron L, Sinha A, Zhang X, Niestrata M, Dholakia K, Prystowsky MB, Harvey KF, Reynolds PA, Gunn-Moore FJ. Willin/FRMD6 expression activates the Hippo signaling pathway kinases in mammals and antagonizes oncogenic YAP. Oncogene 2012; 31(2): 238–250

[13] Fodor LE, Gézsi A, Ungvári L, Semsei AF, Gál Z, Nagy A, Gálffy G, Tamási L, Kiss A, Antal P, Szalai C. Investigation of the possible role of the Hippo/YAP1 pathway in asthma and allergy. Allergy Asthma Immunol Res 2017; 9(3): 247–256

[14] Moleirinho S, Patrick C, Tilston-Lünel AM, Higginson JR, Angus L, Antkowiak M, Barnett SC, Prystowsky MB, Reynolds PA, Gunn-Moore FJ. Willin, an upstream component of the Hippo signaling pathway, orchestrates mammalian peripheral nerve fibroblasts. PLoS One 2013; 8(4): e60028

[15] Visser-Grieve S, Hao Y, Yang X. Human homolog of Drosophila expanded, hEx, functions as a putative tumor suppressor in human cancer cell lines independently of the Hippo pathway. Oncogene 2012; 31(9): 1189–1195

[16] Xu Y, Wang K, Yu Q. FRMD6 inhibits human glioblastoma growth and progression by negatively regulating activity of receptor tyrosine kinases. Oncotarget 2016; 7(43): 70080–70091

[17] Holz MK, Ballif BA, Gygi SP, Blenis J. mTOR and S6K1 mediate assembly of the translation preinitiation complex through dynamic protein interchange and ordered phosphorylation events. Cell 2005; 123(4): 569–580

[18] Murakami M, Ichisaka T, Maeda M, Oshiro N, Hara K, Edenhofer F, Kiyama H, Yonezawa K, Yamanaka S. mTOR is essential for growth and proliferation in early mouse embryos and embryonic stem cells. Mol Cell Biol 2004; 24(15): 6710–6718

[19] Gangloff YG, Mueller M, Dann SG, Svoboda P, Sticker M, Spetz JF, Um SH, Brown EJ, Cereghini S, Thomas G, Kozma SC. Disruption of the mouse mTOR gene leads to early postimplantation lethality and prohibits embryonic stem cell development. Mol Cell Biol 2004; 24(21): 9508–9516

[20] Dobashi Y, Suzuki S, Matsubara H, Kimura M, Endo S, Ooi A. Critical and diverse involvement of Akt/mammalian target of rapamycin signaling in human lung carcinomas. Cancer 2009; 115(1): 107–118

[21] Dobashi Y, Suzuki S, Kimura M, Matsubara H, Tsubochi H, Imoto I, Ooi A. Paradigm of kinase-driven pathway downstream of epidermal growth factor receptor/Akt in human lung carcinomas. Hum Pathol 2011; 42(2): 214–226

[22] Hiramatsu M, Ninomiya H, Inamura K, Nomura K, Takeuchi K, Satoh Y, Okumura S, Nakagawa K, Yamori T, Matsuura M, Morikawa T, Ishikawa Y. Activation status of receptor tyrosine kinase downstream pathways in primary lung adenocarcinoma with reference of KRAS and EGFR mutations. Lung Cancer 2010; 70(1): 94–102

[23] Dobashi Y, Watanabe Y, Miwa C, Suzuki S, Koyama S. Mammalian target of rapamycin: a central node of complex signaling cascades. Int J Clin Exp Pathol 2011; 4(5): 476–495

[24] Tan AC. Targeting the PI3K/Akt/mTOR pathway in non-small cell lung cancer (NSCLC). Thorac Cancer 2020; 11(3): 511–518

[25] Boehm JS, Hession MT, Bulmer SE, Hahn WC. Transformation of human and murine fibroblasts without viral oncoproteins. Mol Cell Biol 2005; 25(15): 6464–6474

[26] Song J, Wang T, Chi X, Wei X, Xu S, Yu M, He H, Ma J, Li X, Du J, Sun X, Wang Y, Zhan J, Zhang H. Kindlin-2 inhibits the Hippo signaling pathway by promoting degradation of MOB1. Cell Rep 2019; 29(11): 3664–3677.e5

[27] Wan J, Liu H, Feng Q, Liu J, Ming L. HOXB9 promotes endometrial cancer progression by targeting E2F3. Cell Death Dis 2018; 9(5): 509–525

[28] Zhan J, Wang P, Li S, Song J, He H, Wang Y, Liu Z, Wang F, Bai H, Fang W, Du Q, Ye M, Chang Z, Wang J, Zhang H. HOXB13 networking with ABCG1/EZH2/Slug mediates metastasis and confers resistance to cisplatin in lung adenocarcinoma patients. Theranostics 2019; 9(7): 2084–2099

[29] Wan J, Zhan J, Li S, Ma J, Xu W, Liu C, Xue X, Xie Y, Fang W, Chin YE, Zhang H. PCAF-primed EZH2 acetylation regulates its stability and promotes lung adenocarcinoma progression. Nucleic Acids Res 2015; 43(7): 3591–3604

[30] Song J, Wang T, Xu W, Wang P, Wan J, Wang Y, Zhan J, Zhang H. HOXB9 acetylation at K27 is responsible for its suppression of colon cancer progression. Cancer Lett 2018; 426: 63–72

[31] González A, Hall MN, Lin SC, Hardie DG. AMPK and TOR: the yin and yang of cellular nutrient sensing and growth control. Cell Metab 2020; 31(3): 472–492

[32] Zhang CS, Jiang B, Li M, Zhu M, Peng Y, Zhang YL, Wu YQ, Li TY, Liang Y, Lu Z, Lian G, Liu Q, Guo H, Yin Z, Ye Z, Han J, Wu JW, Yin H, Lin SY, Lin SC. The lysosomal v-ATPase-Ragulator complex is a common activator for AMPK and mTORC1, acting as a switch between catabolism and anabolism. Cell Metab 2014; 20(3): 526–540

[33] Guan C, Chang Z, Gu X, Liu R. MTA2 promotes HCC progression through repressing FRMD6, a key upstream component of Hippo signaling pathway. Biochem Biophys Res Commun 2019; 515(1): 112–118

RIGHTS & PERMISSIONS

Higher Education Press