GDF15 negatively regulates chemosensitivity via TGFBR2-AKT pathway-dependent metabolism in esophageal squamous cell carcinoma

Yingxi Du , Yarui Ma , Qing Zhu , Yong Fu , Yutong Li , Ying Zhang , Mo Li , Feiyue Feng , Peng Yuan , Xiaobing Wang

Front. Med. ›› 2023, Vol. 17 ›› Issue (1) : 119 -131.

PDF (9008KB)
Front. Med. ›› 2023, Vol. 17 ›› Issue (1) :119 -131. DOI: 10.1007/s11684-022-0949-7
RESEARCH ARTICLE
RESEARCH ARTICLE
GDF15 negatively regulates chemosensitivity via TGFBR2-AKT pathway-dependent metabolism in esophageal squamous cell carcinoma
Author information +
History +
PDF (9008KB)

Abstract

Treating patients with esophageal squamous cell carcinoma (ESCC) is challenging due to the high chemoresistance. Growth differentiation factor 15 (GDF15) is crucial in the development of various types of tumors and negatively related to the prognosis of ESCC patients according to our previous research. In this study, the link between GDF15 and chemotherapy resistance in ESCC was further explored. The relationship between GDF15 and the chemotherapy response was investigated through in vitro and in vivo studies. ESCC patients with high levels of GDF15 expression showed an inferior chemotherapeutic response. GDF15 improved the tolerance of ESCC cell lines to low-dose cisplatin by regulating AKT phosphorylation via TGFBR2. Through an in vivo study, we further validated that the anti-GDF15 antibody improved the tumor inhibition effect of cisplatin. Metabolomics showed that GDF15 could alter cellular metabolism and enhance the expression of UGT1A. AKT and TGFBR2 inhibition resulted in the reversal of the GDF15-induced expression of UGT1A, indicating that TGFBR2-AKT pathway-dependent metabolic pathways were involved in the resistance of ESCC cells to cisplatin. The present investigation suggests that a high level of GDF15 expression leads to ESCC chemoresistance and that GDF15 can be targeted during chemotherapy, resulting in beneficial therapeutic outcomes.

Keywords

GDF15 / esophageal squamous cell carcinoma / chemoresistance / cellular metabolism / TGFBR2 / AKT

Cite this article

Download citation ▾
Yingxi Du, Yarui Ma, Qing Zhu, Yong Fu, Yutong Li, Ying Zhang, Mo Li, Feiyue Feng, Peng Yuan, Xiaobing Wang. GDF15 negatively regulates chemosensitivity via TGFBR2-AKT pathway-dependent metabolism in esophageal squamous cell carcinoma. Front. Med., 2023, 17(1): 119-131 DOI:10.1007/s11684-022-0949-7

登录浏览全文

4963

注册一个新账户 忘记密码

1 Introduction

Esophageal cancer (EC) is a common malignant tumor worldwide, with millions of new cases diagnosed each year [1]. In particular, esophageal squamous cell carcinoma (ESCC) remains to be the most common histological type and accounts for approximately 85% of all EC cases diagnosed globally [2]. Currently, chemotherapy is a vital treatment option to improve the survival rates of ESCC patients, especially those with an advanced disease [3], and cisplatin-based chemotherapy is the first-line treatment for ESCC [4]. However, most ESCC patients develop resistance to chemotherapy during treatment, leading to disease progression. Therefore, fully elucidating the mechanism behind chemoresistance and seeking effective diagnostic markers and therapeutic targets for ESCC are essential.

Growth differentiation factor 15 (GDF15), also called macrophage inhibitory cytokine-1 (MIC-1), is an important member of the transforming growth factor-β (TGF-β) cytokine superfamily [5]. The expression of GDF15 is weak and stable under normal circumstances but abnormally high in many diseases, including heart diseases and various malignant tumors of epithelial origin [6]. GDF15 has been reported to be a predictor of malignancy [7,8], and increasing evidence shows that GDF15 is an extremely important biomarker of a negative response to chemotherapy in some cancers [911]. Our previous study revealed that GDF15 is overexpressed in ESCC tumor cells, and elevated levels of GDF15 in serum are negatively related to the prognosis of ESCC patients [12]. However, whether the resistance function of GDF15 leads to poor clinical outcomes in ESCC is not well understood, prompting us to elucidate the potential mechanisms that affect the sensitivity to chemotherapy. Whether GDF15 is a novel marker that can predict chemoresistance in ESCC patients is worthy of exploring. Therefore, our research focused on the mechanism and relationship between GDF15 and drug resistance in ESCC.

In this study, we discovered that GDF15 was overexpressed in chemoresistant ESCC. Functionally, GDF15 promoted the chemoresistance of ESCC in vivo and in vitro. Mechanistically, GDF15 modulated the drug metabolism by activating the AKT pathway via TGFBR2. Altogether, these findings reveal a new mechanism of chemoresistance and indicate that GDF15 may be a predictor and an effective target against the chemoresistance of ESCC.

2 Materials and methods

2.1 Cell lines and reagents

KYSE30 and KYSE150 cell lines were given by Dr. Shimada (Kyoto University). KYSE30 overexpressing TGFBR2 was previously established by our group [13]. The KYSE30 and KYSE150 cell lines were cultured in RPMI 1640 (Gibco, Carlsbad, CA) supplemented with 10% fetal bovine serum (Invitrogen, San Diego, CA) and penicillin (100 U/mL)/streptomycin (0.1 mg/mL). All cells were grown at 37 °C in a humidified atmosphere with 5% CO2. Anti-GDF15 antibody and recombinant GDF15 were made in our own laboratory. The specificity, potency, and efficacy of the GDF15 neutralization antibody have been validated in our previous study [12]. GDF15 was reconstituted in 10 mM PBS to a concentration of 1.0 mg/mL and stored at −20 °C. LY2157299 and LY2109761 were purchased from Selleck (Shanghai, China). LY294002 was purchased from MedChemExpress (Beijing, China). The chosen doses of cisplatin were consistent with the peak plasma concentration (PPC). The concentrations of cisplatin (DDP) were 200%, 50%, 25%, 12.5%, and 6.25% of PPC. For GDF15 and GDF15 antibodies, we used the same concentrations as mentioned in our previous study. For these inhibitors, we identified a range of concentrations according to the recommended concentration of inhibitors. Two days after the treatment, we found that approximately half of the cells were inhibited at the concentration and regarded the dose as the optimal one.

2.2 Bioinformatics analysis

The function of GDF15 was analyzed in databases, including The Cancer Genome Atlas (TCGA), Gene Expression Profiling Interactive Analysis (GEPIA), Gene Expression Omnibus (GEO), and Gene Set Cancer Analysis (GSCA). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were conducted using the “clusterProfiler” package [14]. The R package “pRRophetic” was used to examine the half-maximal inhibitory concentration (IC50) of common chemotherapy drugs [15].

2.3 Gene deletion by CRISPR/Cas9

The gRNA oligos were annealed and cloned into the Lenti-CRISPR-v2 vector. Lentivirus was produced by cotransfecting HEK293T cells with two other helper plasmids (psPAX2, pMD2.G) by using the Neofect™ DNA transfection reagent (1 μL/mL; Neofect, Beijing, China). The lentiviral supernatant was collected after three days by using a 0.45 µm filter. The collected lentivirus was used to infect cells with the addition of 4 µg/mL polybrene. Infected cells were cultured in fresh media with 2 µg/mL of puromycin for two days. TGFBR2 deletion was validated by Western blot. The following gRNAs targeting TGRBR2 were used: sgRNA 1: ATGATAGTCACTGACAACAA, sgRNA 2: AGTTGCTCATGCAGGATTTC, and control sgRNA: GCTTTCACGGAGGTTCGACG.

2.4 Western blot

Cell lysates were collected from KYSE30 and KYSE150 cells by using the RIPA lysis buffer. The protein concentration was measured with a BCA protein assay kit (Applygen, China). We pipetted samples and molecular weight markers into separate wells, separated the proteins by SDS-PAGE (10% polyacrylamide), transferred them to PVDF membranes (Millipore), and blocked them in 5% dry milk in tris-buffered saline with Tween 20 (TBST; PLYGEN, Beijing, China). Next, we incubated the primary antibodies and the membrane at 4 °C overnight and incubated the secondary antibodies and the membrane for 2 h at room temperature on a shaker. Afterward, target proteins were detected by enhanced chemiluminescence (ECL) using the ECL detection reagent (PLYGEN, Beijing, China). The antibodies used were as follows: Bax (Cell Signaling Technology Cat# 5023), Bcl-2 (Cell Signaling Technology Cat# 15071), AKT (Cell Signaling Technology Cat# 9272), phospho-AKT (Cell Signaling Technology Cat# 4060), TGFBR2 (Abcam, Cat# ab184948), and GAPDH (ProteinTech Cat# 60004-1-Ig).

2.5 mRNA sequencing

The KYSE30 cells were plated on a six-well plate. GDF15 (5 ng/mL) was added the next day. The total RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA) after two days. RNA sequencing was performed by Majorbio (Shanghai, China), and enrichment analysis of differentially expressed genes was conducted by DAVID [16,17].

2.6 Quantitative real-time PCR analysis

Total RNA was collected using the RNA Quick Purification Kit (RN001, Yishan, China) in accordance with the manufacturer’s instructions. Then, cDNA was prepared from total RNA (500 ng) by using the PrimeScript RT Reagent Kit (TaKaRa; Tokyo, Japan). Quantitative real-time PCR (qRT-PCR) was conducted using SYBR® Premix Ex Taq™ (TaKaRa; Tokyo, Japan) on ABI V7 (ABI; Indianapolis, IN, USA). The cycle parameters were as follows: 1 cycle with a pre-incubation step (98 °C for 10 min) and 45 cycles with an amplification step (98 °C for 10 s, 58 °C for 10 s, and 72 °C for 30 s), followed by a melting step (95 °C for 10 s, 55 °C for 1 min, and 95 °C continuous) and a cooling step of 1 s at 40 °C. Gene expression was normalized to GAPDH, and the relative quantification was calculated with 2−ΔΔCt. The primer sequences used were as follows: UGT1A, forward ATCTGCTTGGTCACCCGATG, reverse TCCATGCGCTTTGCATTGTC; UGT1A3, forward GAGAGTGGAAAGGTGTTGGTG, reverse AGGTTGTCAGGGTGAAAAAGTTC; UGT1A8, forward GCTCTAAAAGCAGTCATCAATGAC, reverse GTGCCTCATCACAAACTCCACC; and GAPDH, forward GGAGCGAGATCCCTCCAAAAT, reverse GGCTGTTGTCATACTTCTCATGG.

2.7 Cell viability assay

Cells were plated in triplicate on 96-well plates with 4000 cells per well. The next day, various concentrations of drugs were administered to the cells for two days. CCK8 (10 μL) was added to 100 μL of medium in each well and incubated with the cells for an hour at 37 °C. By using a microplate reader (Bio-Rad Laboratories; Hercules, CA, USA), 450 nm absorbance was measured.

2.8 Flow cytometry

Various concentrations of drugs were used to treat the cells for two days. Apoptotic cells were detected using an Annexin V Apoptosis Detection Kit (Dojindo; Kumamoto, Japan) in accordance with the manufacturer’s protocol. All samples were analyzed using a flow cytometer (Beckman Coulter), and FlowJo was used for data analysis.

2.9 Immunohistochemistry

Twenty paraffin-embedded tumor tissues on slides (10 resistant tissues and 10 sensitive tissues) were dewaxed and hydrated. Antigen retrieval was performed on sections with citrate buffer. The sections were then blocked with sheep serum working solution, incubated with the primary antibody overnight at 4 °C, and incubated with biotinylated antibody. Diaminobenzidine (DAB; ZSGB-BIO, Beijing, China) was used as the chromogenic substrate. The semiquantitative method was applied for the expression of GDF15 protein.

2.10 Transfection of UGT1A siRNA

UGT1A siRNAs were purchased from GenePharma (Suzhou, China). Cells were plated on six-well plates and transfected with 50 nmol/L siRNAs by using Lipofectamine RNAiMAX (Invitrogen, Cat# 13778030) in accordance with the manufacturer’s instructions. The knockdown efficiency was evaluated via qRT-PCR 48 h after transfection. The following siRNA sequences were used: UGT1A-1-F CUACAUUAAUGCUUCUGGATT, UGT1A-1-R UCCAGAAGCAUUAAUGUAGTT; UGT1A-2-F CUUCUGGAGAACAUGGAAUTT, UGT1A-2-R AUUCCAUGUUCUCCAGAAGTT; and negative control-F UUCUCCGAACGUGUCACGUTT, negative control-R ACGUGACACGUUCGGAGAATT.

2.11 Metabolomic profiling

The detailed methods have already been described in our previous study [18]. In brief, after being cultured overnight in RPMI 1640, the KYSE30 cells were treated with DMSO or GDF15 (5 ng/mL) for two days. Then, the metabolites were extracted with prechilled 80% (v/v) HPLC-grade methanol. After centrifugation, the supernatant containing the metabolites was concentrated in a vacuum centrifugal concentrator for an hour. The metabolites were redissolved proportionally in accordance with the protein concentration before liquid chromatography with tandem mass spectrometry (LC-MS/MS) analysis.

2.12 In vivo tumor xenograft experiment

A suspension of 5 × 106 KYSE150 cells in 100 μL PBS was subcutaneously injected into male Balb/c nude mice at the age of six weeks. When the tumor volumes reached 100 mm3, the mice were divided into the following treatment groups (n = 6 animals/group): vehicle, DDP (25 mg/kg), GDF15 antibody (5 mg/kg), or a combination of DDP and GDF15 antibody. The animals were treated every four days for 28 days. Tumor measurement was conducted every four days, and tumor size was calculated using the following ellipsoid formula: 0.5 × a × b2, where a is the long diameter and b is the short diameter. At the end of the experiment (after 32 days), the mice were euthanized through the intraperitoneal injection of 100 mg/kg of pentobarbital sodium (Sigma, St. Louis, MO, USA), and the xenograft tumors were resected and weighed.

2.13 Statistical analyses

Data were analyzed with GraphPad Prism 9.00 and R version 4.0.2. Fisher’s exact test was used to analyze the categorical variables. Student’s t-test was employed for comparisons between two groups. Data are shown as the mean ± standard deviation (SD). P values are denoted in the figures as follows: not significant [ns], *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

3 Results

3.1 GDF15 expression was upregulated and correlated with chemoresistance in ESCC

To explore the potential function of the GDF15 gene in ESCC, we searched the GEPIA online database for GDF15 gene expression in patients with ESCC, and the results revealed that GDF15 expression was upregulated in ESCC (Fig.1). Similarly, the results from the GSE44021 data set confirmed that GDF15 was upregulated (Fig.1). Next, survival analyses indicated that ESCC patients with high GDF15 expression had a tendency toward reduced disease-free survival and overall survival (OS) than those with low GDF15 expression (Fig. S1A). The GDF15 expression in the ESCC patients who received chemotherapy from TCGA was also explored to determine whether patients with high GDF15 expression had reduced OS. Thirty-six patients who received chemotherapy involving a combination of two or three anticancer agents, including cisplatin, carboplatin, oxaliplatin, 5-fluorouracil, paclitaxel, docetaxel, etoposide, gemcitabine, leucovorin, capecitabine, and epirubicin, were divided into groups with high and low GDF15 expression. Compared with patients with high expression of GDF15, those with a low expression had significantly longer OS (Fig.1). We also found that patients with low GDF15 expression showed a higher response rate to chemotherapy compared with patients with high GDF15 expression (Fig. S1B). Next, the R package “pRRophetic” was used to examine the IC50 of common chemotherapy drugs. As shown in Fig.1 and S1C, patients with high GDF15 expression exhibited high estimated IC50 for DDP and other chemotherapeutic drugs. IHC staining revealed that GDF15 was highly expressed in 7 (70%) of 10 resistant tissues and 1 (10%) of 10 sensitive tissues (P = 0.0198). Therefore, high GDF15 expression positively correlated with chemoresistance in the ESCC patients (Fig.1). The high levels of GDF15 expression might be related to the poor response of ESCC patients due to chemotherapy resistance.

3.2 GDF15 negatively regulated cancer cell chemosensitivity to cisplatin in vitro and in vivo

To further explore the molecular mechanism by which GDF15 affects DDP sensitivity in ESCC, we applied GDF15 protein directly to KYSE30, an ESCC cell line that has low GDF15 expression, to verify the function of GDF15 in chemotherapy. As expected, GDF15 alone did not have a significant effect on cell viability (Fig. S2A). However, as shown in Fig.2, the addition of GDF15 obviously resulted in increased resistance to low concentrations of DDP. The flow cytometry results revealed that GDF15 induced less cell apoptosis in the KYSE30 cell lines treated with DDP than in the control group (Fig.2). Moreover, no direct antitumor effect was observed when the anti-GDF15 antibody was applied alone to KYSE150 cell lines, which have a high GDF15 expression level (Fig. S2B). We depleted GDF15 with the anti-GDF15 antibody at two different concentrations and treated KYSE150 cells with various concentrations of DDP. The depletion of GDF15 resulted in decreased resistance to DDP, and this effect was dose-dependent (Fig.2). These findings were further verified by the result that Bax2 protein was significantly elevated in the anti-GDF15 groups, and Bcl2 was downregulated in these groups, as indicated in Fig.2. These data confirm the important function of GDF15 in negatively regulating the ESCC cell response to DDP, but GDF15 had no direct antitumor effect on ESCC. GDF15 regulated the chemotherapeutic response by regulating the cell apoptosis pathway in vitro. To further confirm that blocking GDF15 can attenuate the chemoresistance of ESCC in vivo, we subcutaneously transplanted KYSE150 cells into nude mice to assess the therapeutic efficacy of the anti-GDF15 antibody combined with DDP treatment. Compared with either the anti-GDF15 antibody or DDP alone, the anti-GDF15 antibody and DDP combination exerted a beneficial effect (Fig.2 and 2F). Furthermore, combined treatment with the anti-GDF15 antibody and DDP resulted in a lower tumor mass than either the anti-GDF15 antibody or DDP treatment alone (Fig.2). These results suggest that GDF15 can affect the sensitivity to cisplatin and that GDF15 neutralizing antibodies can increase the chemosensitivity of esophageal cells to cisplatin in vivo.

3.3 GDF15 was correlated with the drug metabolism pathway

Next, we investigated why GDF15 affects the sensitivity to chemotherapy. Patients in the TCGA database were divided into two groups in accordance with the median value of GDF15. Then, enrichment analysis of differentially expressed genes was conducted. The biological functions and pathway enrichment of GDF15 were evaluated through GO and KEGG analyses. In conclusion, most of the biological functions and pathways were related to cellular metabolism, including drug metabolism (Fig.3 and 3B). Given the effects of drug-metabolizing enzymes on the regulation of chemotherapeutic agents, GDF15 might be involved in drug metabolism. For further validation, tests to detect GDF15 effects were subsequently performed on the KYSE30 cell line. RNA sequencing of KYESE30 cells treated or untreated with GDF15 was performed (Fig.3), and pathway enrichment analysis of the differentially regulated genes was conducted. The KEGG enrichment analysis results indicated that most of the differentially expressed genes were enriched in the drug metabolism pathways (Fig.3). These data indicate that GDF15 was related to drug metabolism and other nutrient metabolism and inspired us to explore the specific metabolic changes caused by GDF15.

3.4 GDF15 altered esophageal cancer cell metabolism

To further investigate potential metabolic alterations in ESCC cells, we performed metabolomic analyses using LC-MS/MS. First, the differences in the metabolite profiles were assessed through principal component analysis. As illustrated in Fig. S3A and S3B, the score plots showed good discrimination between the two groups. Second, the metabolic levels for metabolites were presented using heatmaps to provide an intuitive view of the differences (Fig.4 and 4C). Overall, several important metabolites differed between the two groups (Fig. S3C). Lastly, on the basis of the differential metabolites, we analyzed the different metabolic pathways. Various metabolic pathways, including carbohydrate metabolism, lipid metabolism, and metabolic pathways for other nutritional substances, were identified (Fig.4 and 4D). Therefore, we hypothesized that these metabolic pathways might be involved in the resistance of ESCC cells to DDP. These findings reveal that GDF15 affected the efficacy of chemotherapy and regulated cellular metabolism in ESCC.

3.5 GDF15 regulated the TGFBR2-AKT pathway

To investigate the molecular mechanisms by which GDF15 is involved in regulating metabolism and chemotherapy resistance in ESCC, we explored the potential signaling pathway of GDF15 in GSCA. As shown in Fig.5, GDF15 could activate the receptor tyrosine kinase in ESCC. We found a relationship between GDF15 and AKT through the STING database (Fig.5). Using the p-308 AKT antibody, we discovered that the application of the anti-GDF15 antibody resulted in reduced AKT phosphorylation (Fig.5). GDF15 significantly enhanced AKT phosphorylation in the KYSE30 cells without affecting the total AKT protein level (Fig.5). GDF15 belongs to the TGFβ superfamily; however, the specific binding receptor of GDF15 in chemoresistance in ESCC cells has not been revealed. Here, we further investigated the potential role of the TGF-β receptor (TGFBR) in GDF15 signaling because TGFBR is an important activator of AKT. When the TGF-β receptor type I inhibitor (LY2157299) and TGF-β receptor type I/II inhibitor (LY2109761) were used to block TGFB signal activation in the KYSE150 cells, the anti-GDF15 antibody could not inhibit the phosphorylation of AKT when the TGF-β receptor types I/II were blocked simultaneously; meanwhile, the anti-GDF15 antibody inhibited AKT phosphorylation under TGF-β receptor type I inhibitor treatment (Fig.5 and 5F). We generated KYSE150 cell lines with TGFBR2 knockout (Fig. S4A). An interesting phenomenon was observed in the TGFBR2 knockout cells, that is, TGFBR2 knockdown could not inhibit AKT phosphorylation with anti-GDF15 antibody treatment (Fig.5). By contrast, the anti-GDF15 antibody reduced AKT phosphorylation in the TGFBR2-overexpressing cells (Fig.5). Overall, these results suggest that GDF15 regulated AKT phosphorylation through TGFBR2. Next, we tested the response of esophageal cancer cells to cisplatin under treatment with GDF15, LY294002, and LY2109761 in combination and alone. The results showed that inhibition of TGFBR2 and AKT could promote apoptosis under DDP treatment, and adding GDF15 did not inhibit apoptosis (Fig. S4B).

3.6 GDF15 regulated the sensitivity of ESCC to cisplatin via UGT1A

The transcriptome sequencing results indicated that the UDP-glucuronosyltransferase 1A (UGT1A) subfamily enzymes were affected by GDF15. Dysregulation of the expression and activity of UGT1A is associated with the progression of several cancers [19]. Therefore, we surmised that GDF15 might regulate UGT1A expression through the TGFBR2-AKT pathway. We selected six experimental groups and evaluated the expression of UGT1A via real-time PCR. The UGT1A gene expression levels increased after two days of GDF15 treatment. LY294002, a well-characterized AKT-specific inhibitor, and LY2109761 greatly reduced UGT1A expression (Fig.6). Similar results were observed for UGT1A3 and UGT1A8 (Fig. S4C). Specific siRNA was used to silence the UGT1A genes to further investigate the role of UGTs. The mRNA levels were evaluated after siRNA transfection. The mRNA levels of UGT1A were reduced, but the negative control siRNA had little effect (Fig. S4D). UGT1A inhibition attenuated GDF15-induced cisplatin resistance in esophageal cancer cells by detecting cell proliferation (Fig.6 and 6D) and cell apoptosis (Fig.6 and 6E). These results confirm that GDF15 modulated UGT1A expression through TGFBR2 and AKT activity, which in turn led to the occurrence of chemotherapy resistance.

4 Discussion

More than 80% of esophageal cancer cases are esophageal squamous cell carcinoma (ESCC). Chemotherapy is a general neoadjuvant method for cancer therapy, but chemoresistance is one of the major reasons for treatment failure in ESCC [20]. The mechanisms of drug resistance in esophageal cancer have been investigated to resolve this issue. For example, the protein levels of MRE11A and UBQLN4 can be used to predict the chemotherapy responses of ESCC patients [21]. However, few of these biomarkers have been identified as meaningful prognostic and predictive markers for ESCC patients treated with chemotherapeutic agents. Unmet clinical needs led us to hypothesize that additional biomarkers may also influence chemotherapy efficacy.

GDF15 plays physiologic and pathological roles [22]. Growing evidence implicates GDF15 in tumorigenesis and progression [23]. Emerging evidence also demonstrates that GDF15 is involved in chemoresistance in colon, epithelial ovarian, gastric, and lung cancers [911,24]. Recently, we found that patients with ESCC may benefit from using GDF15 as a potential biomarker and as a target for antibody-based therapies. However, whether GDF15 promotes chemoresistance in esophageal cancer remains unclear. Thus, determining the mechanism by which GDF15 alters responses to chemotherapy in esophageal cancer may have significant therapeutic implications. In our study, GDF15 had a close link with chemotherapy resistance in esophageal cancer patients who received chemotherapy. Furthermore, GDF15 enhanced resistance to DDP in ESCC cells. Our data further suggest that the anti-GDF15 antibody could reverse chemoresistance in the xenograft mouse model. Therefore, GDF15 inhibition may enhance chemosensitivity in ESCC. Moreover, the anti-GDF15 antibody is likely to be a useful treatment for ESCC because the protein is secreted into the bloodstream and acts as a cytokine. Notably, although the expression of GDF15 has been associated with promoting cell proliferation in multiple tumor types [2528], we did not observe an impact of GDF15 on the proliferation of KYSE30 and KYSE150 cells, further highlighting the cell-type specific functions and dose dependence of GDF15.

According to previous studies, GDF15 is strongly correlated with anorexia and weight loss in cancer patients [29,30]. Recent studies have revealed that high levels of GDF15 enhance triglyceride metabolism and fatty acid β-oxidation in tumor cells [31,32]. Meanwhile, numerous studies have reported that GDF15 inhibition reverses cancer cachexia [33], further supporting its crucial role as a metabolic mediator. In our study, GDF15 altered the metabolism of ESCC cells through RNA-seq. Hence, we hypothesized that GDF15 may regulate cellular metabolism. This hypothesis was further confirmed by targeted metabolomics.

Although GDF15 is critical for tumor cell metabolism and chemotherapy resistance, the specific binding receptor of GDF15 on ESCC cells is still unclear. Through drug inhibition and gene manipulation, we found that TGFBR2 was a receptor of GDF15 in ESCC. TGFBR2 is necessary for regulating canonical or noncanonical signaling pathways [34]. It also plays a key role in tumor development, progression, and invasion [35]. To reveal the intracellular signaling pathway of GDF15, we analyzed GSCA and STING databases and found that GDF15 might be related to AKT signaling. We also found that AKT signaling, which has diverse downstream effects on cellular metabolism [36], was significantly activated by GDF15 and suppressed by the TGFBR2 inhibitor. Thus, GDF15 positively regulated AKT phosphorylation via TGFBR2.

To thoroughly understand the detailed downstream mechanism by which AKT regulates ESCC chemoresistance, we further analyzed UGT1A gene expression under different conditions. We found that GDF15 could regulate UGT1A family gene expression, whereas the inhibition of TGFBR2 and AKT counteracted this trend. An increasing number of studies have provided rational evidence suggesting that UGT1A family members are associated with clinical outcomes in cancer patients [37,38]. Therefore, our results demonstrate that GDF15 regulated UGT1A expression through TGFBR and AKT, which in turn led to the occurrence of chemotherapy resistance.

In conclusion, we found that inhibition of GDF15 sensitized ESCC cells to DDP cytotoxicity in vitro and in vivo. GDF15 exerted its biological effects by modulating the TGFBR2/AKT/UGT1A pathway (Fig.7). Our work suggests that GDF15 may be a predictor and potential target against ESCC chemoresistance and that targeting the GDF15/TGFBR2/AKT/UGT1A signaling axis may be a promising strategy to enhance the cisplatin response of patients with chemoresistant ESCC.

References

[1]

Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2021; 71(3): 209–249

[2]

Thrift AP. Global burden and epidemiology of Barrett oesophagus and oesophageal cancer. Nat Rev Gastroenterol Hepatol 2021; 18(6): 432–443

[3]

Sjoquist KM, Burmeister BH, Smithers BM, Zalcberg JR, Simes RJ, Barbour A, Gebski V; Australasian Gastro-Intestinal Trials Group. Survival after neoadjuvant chemotherapy or chemoradiotherapy for resectable oesophageal carcinoma: an updated meta-analysis. Lancet Oncol 2011; 12(7): 681–692

[4]

Yamasaki M, Yasuda T, Yano M, Hirao M, Kobayashi K, Fujitani K, Tamura S, Kimura Y, Miyata H, Motoori M, Shiraishi O, Makino T, Satoh T, Mori M, Doki Y. Multicenter randomized phase II study of cisplatin and fluorouracil plus docetaxel (DCF) compared with cisplatin and fluorouracil plus adriamycin (ACF) as preoperative chemotherapy for resectable esophageal squamous cell carcinoma (OGSG1003). Ann Oncol 2017; 28(1): 116–120

[5]

Breit SN, Brown DA, Tsai VW. The GDF15-GFRAL pathway in health and metabolic disease: friend or foe?. Annu Rev Physiol 2021; 83(1): 127–151

[6]

Desmedt S, Desmedt V, De Vos L, Delanghe JR, Speeckaert R, Speeckaert MM. Growth differentiation factor 15: a novel biomarker with high clinical potential. Crit Rev Clin Lab Sci 2019; 56(5): 333–350

[7]

Wang Y, Jiang T, Jiang M, Gu S. Appraising growth differentiation factor 15 as a promising biomarker in digestive system tumors: a meta-analysis. BMC Cancer 2019; 19(1): 177

[8]

Li C, Wang X, Casal I, Wang J, Li P, Zhang W, Xu E, Lai M, Zhang H. Growth differentiation factor 15 is a promising diagnostic and prognostic biomarker in colorectal cancer. J Cell Mol Med 2016; 20(8): 1420–1426

[9]

Zheng X, Ma N, Wang X, Hu J, Ma X, Wang J, Cao B. Exosomes derived from 5-fluorouracil-resistant colon cancer cells are enriched in GDF15 and can promote angiogenesis. J Cancer 2020; 11(24): 7116–7126

[10]

Zhao D, Wang X, Zhang W. GDF15 predict platinum response during first-line chemotherapy and can act as a complementary diagnostic serum biomarker with CA125 in epithelial ovarian cancer. BMC Cancer 2018; 18(1): 328

[11]

Yu S, Li Q, Yu Y, Cui Y, Li W, Liu T, Liu F. Activated HIF1α of tumor cells promotes chemoresistance development via recruiting GDF15-producing tumor-associated macrophages in gastric cancer. Cancer Immunol Immunother 2020; 69(10): 1973–1987

[12]

Wang XB, Jiang XR, Yu XY, Wang L, He S, Feng FY, Guo LP, Jiang W, Lu SH. Macrophage inhibitory factor 1 acts as a potential biomarker in patients with esophageal squamous cell carcinoma and is a target for antibody-based therapy. Cancer Sci 2014; 105(2): 176–185

[13]

Ma Y, He S, Gao A, Zhang Y, Zhu Q, Wang P, Yang B, Yin H, Li Y, Song J, Yue P, Li M, Zhang D, Liu Y, Wang X, Guo M, Jiao Y. Methylation silencing of TGF-β receptor type II is involved in malignant transformation of esophageal squamous cell carcinoma. Clin Epigenetics 2020; 12(1): 25

[14]

Yu G, Wang LG, Han Y, He QY. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS 2012; 16(5): 284–287

[15]

Geeleher P, Cox N, Huang RS. pRRophetic: an R package for prediction of clinical chemotherapeutic response from tumor gene expression levels. PLoS One 2014; 9(9): e107468

[16]

Huang W, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 2009; 4(1): 44–57

[17]

Huang W, Sherman BT, Lempicki RA. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res 2009; 37(1): 1–13

[18]

Ma Y, Zhu Q, Liang J, Li Y, Li M, Zhang Y, Wang X, Zeng Y, Jiao Y. A CRISPR knockout negative screen reveals synergy between CDKs inhibitor and metformin in the treatment of human cancer in vitro and in vivo. Signal Transduct Target Ther 2020; 5(1): 152

[19]

Allain EP, Rouleau M, Lévesque E, Guillemette C. Emerging roles for UDP-glucuronosyltransferases in drug resistance and cancer progression. Br J Cancer 2020; 122(9): 1277–1287

[20]

Mao C, Zeng X, Zhang C, Yang Y, Xiao X, Luan S, Zhang Y, Yuan Y. Mechanisms of pharmaceutical therapy and drug resistance in esophageal cancer. Front Cell Dev Biol 2021; 9: 612451

[21]

Murakami T, Shoji Y, Nishi T, Chang SC, Jachimowicz RD, Hoshimoto S, Ono S, Shiloh Y, Takeuchi H, Kitagawa Y, Hoon DSB, Bustos MA. Regulation of MRE11A by UBQLN4 leads to cisplatin resistance in patients with esophageal squamous cell carcinoma. Mol Oncol 2021; 15(4): 1069–1087

[22]

Assadi A, Zahabi A, Hart RA. GDF15, an update of the physiological and pathological roles it plays: a review. Pflugers Arch 2020; 472(11): 1535–1546

[23]

Rochette L, Méloux A, Zeller M, Cottin Y, Vergely C. Functional roles of GDF15 in modulating microenvironment to promote carcinogenesis. Biochim Biophys Acta Mol Basis Dis 2020; 1866(8): 165798

[24]

Deng J, Zhang M, Zhang H, Lu C, Hou G, Feng Y, Fang Z, Lv X. Value of growth/differentiation factor 15 in diagnosis and the evaluation of chemotherapeutic response in lung cancer. Clin Ther 2021; 43(4): 747–759

[25]

Okamoto M, Koma YI, Kodama T, Nishio M, Shigeoka M, Yokozaki H. Growth differentiation factor 15 promotes progression of esophageal squamous cell carcinoma via TGF-β type II receptor activation. Pathobiology 2020; 87(2): 100–113

[26]

Li S, Ma YM, Zheng PS, Zhang P. GDF15 promotes the proliferation of cervical cancer cells by phosphorylating AKT1 and Erk1/2 through the receptor ErbB2. J Exp Clin Cancer Res 2018; 37(1): 80

[27]

Urakawa N, Utsunomiya S, Nishio M, Shigeoka M, Takase N, Arai N, Kakeji Y, Koma Y, Yokozaki H. GDF15 derived from both tumor-associated macrophages and esophageal squamous cell carcinomas contributes to tumor progression via Akt and Erk pathways. Lab Invest 2015; 95(5): 491–503

[28]

Yang CZ, Ma J, Zhu DW, Liu Y, Montgomery B, Wang LZ, Li J, Zhang ZY, Zhang CP, Zhong LP. GDF15 is a potential predictive biomarker for TPF induction chemotherapy and promotes tumorigenesis and progression in oral squamous cell carcinoma. Ann Oncol 2014; 25(6): 1215–1222

[29]

Breen DM, Kim H, Bennett D, Calle RA, Collins S, Esquejo RM, He T, Joaquim S, Joyce A, Lambert M, Lin L, Pettersen B, Qiao S, Rossulek M, Weber G, Wu Z, Zhang BB, Birnbaum MJ. GDF-15 neutralization alleviates platinum-based chemotherapy-induced emesis, anorexia, and weight loss in mice and nonhuman primates. Cell Metab 2020; 32(6): 938–950.e6

[30]

Tsai VWW, Husaini Y, Sainsbury A, Brown DA, Breit SN. The MIC-1/GDF15-GFRAL pathway in energy homeostasis: implications for obesity, cachexia, and other associated diseases. Cell Metab 2018; 28(3): 353–368

[31]

Zheng H, Yu S, Zhu C, Guo T, Liu F, Xu Y. HIF1α promotes tumor chemoresistance via recruiting GDF15-producing TAMs in colorectal cancer. Exp Cell Res 2021; 398(2): 112394

[32]

Luan HH, Wang A, Hilliard BK, Carvalho F, Rosen CE, Ahasic AM, Herzog EL, Kang I, Pisani MA, Yu S, Zhang C, Ring AM, Young LH, Medzhitov R. GDF15 is an inflammation-induced central mediator of tissue tolerance. Cell 2019; 178(5): 1231–1244.e11

[33]

Suriben R, Chen M, Higbee J, Oeffinger J, Ventura R, Li B, Mondal K, Gao Z, Ayupova D, Taskar P, Li D, Starck SR, Chen HH, McEntee M, Katewa SD, Phung V, Wang M, Kekatpure A, Lakshminarasimhan D, White A, Olland A, Haldankar R, Solloway MJ, Hsu JY, Wang Y, Tang J, Lindhout DA, Allan BB. Antibody-mediated inhibition of GDF15-GFRAL activity reverses cancer cachexia in mice. Nat Med 2020; 26(8): 1264–1270

[34]

Vander Ark A, Cao J, Li X. TGF-β receptors: in and beyond TGF-β signaling. Cell Signal 2018; 52: 112–120

[35]

Itatani Y, Kawada K, Sakai Y. Transforming growth factor-β signaling pathway in colorectal cancer and its tumor microenvironment. Int J Mol Sci 2019; 20(23): 5822

[36]

Hoxhaj G, Manning BD. The PI3K-AKT network at the interface of oncogenic signalling and cancer metabolism. Nat Rev Cancer 2020; 20(2): 74–88

[37]

Chen P, Zhu KW, Zhang DY, Yan H, Liu H, Liu YL, Cao S, Zhou G, Zeng H, Chen SP, Zhao XL, Yang J, Chen XP. Influence of UGT1A1 polymorphisms on the outcome of acute myeloid leukemia patients treated with cytarabine-base regimens. J Transl Med 2018; 16(1): 197

[38]

Yu Q, Zhang T, Xie C, Qiu H, Liu B, Huang L, Peng P, Feng J, Chen J, Zang A, Yuan X. UGT1A polymorphisms associated with worse outcome in colorectal cancer patients treated with irinotecan-based chemotherapy. Cancer Chemother Pharmacol 2018; 82(1): 87–98

RIGHTS & PERMISSIONS

Higher Education Press

PDF (9008KB)

Supplementary files

FMD-22026-OF-WXB_suppl_1

4168

Accesses

0

Citation

Detail

Sections
Recommended

/