CD47 blockade improves the therapeutic effect of osimertinib in non-small cell lung cancer

Wei-Bang Yu , Yu-Chi Chen , Can-Yu Huang , Zi-Han Ye , Wei Shi , Hong Zhu , Jia-Jie Shi , Jun Chen , Jin-Jian Lu

Front. Med. ›› 2023, Vol. 17 ›› Issue (1) : 105 -118.

PDF (7197KB)
Front. Med. ›› 2023, Vol. 17 ›› Issue (1) :105 -118. DOI: 10.1007/s11684-022-0934-1
RESEARCH ARTICLE
RESEARCH ARTICLE
CD47 blockade improves the therapeutic effect of osimertinib in non-small cell lung cancer
Author information +
History +
PDF (7197KB)

Abstract

The third-generation epidermal growth factor receptor (EGFR) inhibitor osimertinib (OSI) has been approved as the first-line treatment for EGFR-mutant non-small cell lung cancer (NSCLC). This study aims to explore a rational combination strategy for enhancing the OSI efficacy. In this study, OSI induced higher CD47 expression, an important anti-phagocytic immune checkpoint, via the NF-κB pathway in EGFR-mutant NSCLC HCC827 and NCI-H1975 cells. The combination treatment of OSI and the anti-CD47 antibody exhibited dramatically increasing phagocytosis in HCC827 and NCI-H1975 cells, which highly relied on the antibody-dependent cellular phagocytosis effect. Consistently, the enhanced phagocytosis index from combination treatment was reversed in CD47 knockout HCC827 cells. Meanwhile, combining the anti-CD47 antibody significantly augmented the anticancer effect of OSI in HCC827 xenograft mice model. Notably, OSI induced the surface exposure of “eat me” signal calreticulin and reduced the expression of immune-inhibitory receptor PD-L1 in cancer cells, which might contribute to the increased phagocytosis on cancer cells pretreated with OSI. In summary, these findings suggest the multidimensional regulation by OSI and encourage the further exploration of combining anti-CD47 antibody with OSI as a new strategy to enhance the anticancer efficacy in EGFR-mutant NSCLC with CD47 activation induced by OSI.

Keywords

osimertinib / anti-CD47 antibody / combination strategy / ADCP / EGFR

Cite this article

Download citation ▾
Wei-Bang Yu, Yu-Chi Chen, Can-Yu Huang, Zi-Han Ye, Wei Shi, Hong Zhu, Jia-Jie Shi, Jun Chen, Jin-Jian Lu. CD47 blockade improves the therapeutic effect of osimertinib in non-small cell lung cancer. Front. Med., 2023, 17(1): 105-118 DOI:10.1007/s11684-022-0934-1

登录浏览全文

4963

注册一个新账户 忘记密码

1 Introduction

Non-small cell lung cancer (NSCLC), which accounts for 85% of lung cancers, is the leading cause of all cancer death in the world [1,2]. Among them, activating epidermal growth factor receptor (EGFR) mutation is observed in ~15% of Caucasian patients and ~50% of Asian patients [3]. The tyrosine kinase inhibitors targeting mutant EGFR (EGFR-TKIs) have shown significant improvements in progression-free survival (~10 months) [46]. More recently, given the superior response compared with the first-generation EGFR-TKIs in FLAURA trial, osimertinib (OSI), which is a third-generation EGFR-TKI, has moved to the first-line setting for patients with TKI sensitive mutation and T790M resistance mutation [7]. However, the medium progression-free survival by OSI is still less than 2 years [8,9]. Given the fact that OSI is well tolerated in patients, a rational combination approach to enhance the initial efficacy of OSI has been warranted in the field.

The innate immune system keeps homeostasis in the body and can be activated rapidly in response to infections and malignancies [10]. Macrophages, which are one of the key effectors in the innate immune system, can distinguish and eliminate cancer cells through the procedure known as phagocytosis [11,12]. The transmembrane protein CD47 is a “don’t eat me” signal to prevent the cell phagocytosis upon interaction with the ligand signal regulatory protein α (SIRPα) on macrophages [13]. However, many types of cancers upregulate CD47 to inhibit the phagocytosis by macrophages and evade immune system surveillance for increasing the survival advantages [1416]. Some inhibitors such as sorafenib and cisplatin also induce higher CD47 expression on the cancer cells to suppress the phagocytosis and counteract their anticancer effects [1720]. Sorafenib induces higher CD47 expression and suppresses the tumor volume more effectively in combination with anti-CD47 antibody in the patient-derived HCC xenograft mice model [17]. Treatment of cisplatin causes higher CD47 protein levels, and the combination strategy of cisplatin with anti-CD47 antibody exhibits obvious tumor volume suppression in lung cancer [20]. Given the pivotal role of CD47 in cancer development and drug efficacy, the relationship between CD47 expression and OSI therapy in lung cancer was explored in the preliminary study. The OSI treatment upregulated CD47 expression significantly in EGFR mutant HCC827 and NCI-H1975 cells (Fig.1). EGFR mutation was also closely related to higher macrophage infiltration in human lung adenocarcinoma (Fig. S1). Therefore, we hypothesized that blocking CD47 might be an effective method to render cancer cells more susceptible to OSI.

In this study, treatment of OSI and B6H12 (anti-CD47 antibody) dramatically increased the phagocytosis in vitro. The combination therapy enhanced the anticancer effect significantly in vivo compared with the single OSI treatment. Our findings suggest that the combination strategy of OSI with anti-CD47 antibody might be a promising strategy to improve anticancer efficacy in EGFR mutant NSCLC with CD47 activation induced by OSI.

2 Methods and materials

2.1 Reagents

OSI was purchased from Selleck Chemicals (Houston, TX, USA). 2-(4-Amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI) was obtained from Beyotime (Shanghai, China). Dimethyl sulfoxide (DMSO) was obtained from Sigma (St. Louis, MO, USA). Carboxyfluorescein Diacetate Succinimidyl Ester (CFSE) was purchased from Invitrogen (Waltham, MA, USA).

2.2 Cell line and culture

NSCLC A549, NCI-H1299, and NCI-H1975 cells were purchased from ATCC (Rockville, MD, USA). NSCLC NCI-H358, NCI-H460, PC-9, and HCC827 cells were purchased from Shanghai Cell Band (Shanghai, China). All the cell lines were cultured with RPMI-1640 medium containing fetal bovine serum (10%) and penicillin–streptomycin (1%) in the 5% CO2 incubator at 37 °C.

2.3 CD47 knockout HCC827 (HCC827/CD47KO) cell line generation

HCC827/CD47KO cells were established using CRISPR-Cas9-mediated genome editing. Specifically, HCC827 cells were transfected with CD47KO Lenti-CRISPR v2 plasmid (Addgene, Watertown, MA, USA) encoding sgRNA targeting the CD47 gene (sequences: CACCGCTACTGAAGTATACGTAAAG) using TurboFect™ Transfection Reagent (Invitrogen, Waltham, MA, USA) according to the protocol of the manufacturer. A total of 48 h after plasmid transfection, the culture medium was replaced with RPMI-1640 medium containing 1 μg/mL puromycin (Beyotime, Shanghai, China) for another 72 h. Single-cell clones were selected with dilution method and expanded to obtain the CD47 knockout populations.

2.4 Mouse xenograft model

The treatment efficacy in vivo was evaluated using the anti-CD47 antibody B6H12 (BioXcell, West Lebanon, NH, USA), which could efficiently neutralize CD47 in human tumor xenograft models [18,21,22]. BALB/c nude mice were maintained in the animal facility of the Faculty of Health Science, University of Macau. After the injection of HCC827 cells (2 × 106 cells) into the right back of each mouse subcutaneously for about a week, the mice were randomly divided into indicated groups and kept with the similar body weight and initial tumor volume (8 mice per group): (1) control group, (2) OSI treatment group (0.5 mg/kg, gavage every other day), (3) anti-CD47 antibody (B6H12, BioXcell, West Lebanon, NH, USA) treatment group (250 µg per mouse, intraperitoneal injection every other day), and (4) combination group of OSI and B6H12. OSI was first dissolved in DMSO:Tween-80 (1:1, v/v) at a concentration of 2.5 mg/mL, followed by the dilution with double-distilled H2O to the final concentration of 0.05 mg/mL. The dose volumes for mice were 10 mL/kg. B6H12 was diluted with phosphate-buffered saline to achieve the final concentration of 2.5 mg/mL, and 0.1 mL was injected intraperitoneally into each mouse. Tumor sizes were detected with Vernier calipers every 2 days and calculated with the formula (width2 × length)/2. After the mice experiment, the tumor tissues were collected and harvested as previously described [23]. In brief, the tumors were excised and digested with collagenase IV (1 mg/mL) and deoxyribonuclease I (0.1 mg/mL) (Invitrogen, Waltham, MA, USA). After centrifugation, the fragments were ground and filtrated to create single-cell suspension, followed by LIVE/DEAD fixable dye staining overnight. After Fc receptors were blocked, suspended cells were incubated with specific diluted antibodies for another 30 min and analyzed by flow cytometry. CD47high tumor cells were gated as CD45CD47high positive cells. Macrophages were identified as CD45+CD11b+F4/80+ positive cells.

2.5 Quantitative real-time PCR

The quantitative real-time PCR (qRT-PCR) assay was conducted as previously described [24]. In short, HCC827 cells pretreated with OSI for 48 h were extracted with TRIzol (Life Technologies, Shanghai, China). The cDNA was synthesized with a Transcriptor First Strand cDNA Synthesis Kit (Roche, Germany) following the instructions of the manufacturer. The primers of CD47 and ATCB (internal control) are listed in Tab.1. qRT-PCR was performed using FastStart Universal SYBR Green Master (Roche, Germany), followed by the analysis on Stratagene Mx3005P multiplex quantitative PCR system. The CD47 mRNA expression was calculated by 2−ΔΔCT. The experiments were performed in triplicate.

2.6 Western blot

The Western blot assay was performed as previously described [24]. Concisely, after the seeding of HCC827 cells in 6-well plates for 24 h, the protein was extracted and evaluated with BCATM protein assay kit (Pierce, Rockford, IL, USA). Equal amounts of proteins were separated with sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to the PVDF membrane, and blocked with nonfat dry milk. Next, the membrane was probed with the primary antibodies for 24 h at 4 °C, followed by incubation with the secondary antibody for another 1.5 h. The specific protein bands were visualized with ECL advanced Western blot analysis detection kit (BD Biosciences, Bedford, MA, USA), and ACTB band was used as the internal control. The ratio of indicated protein/ACTB was calculated through ChemiDocTM MP imaging. Antibodies against the proteins indicated were as follows: p-EGFR (Y1068) (CST, #3777), EGFR (CST, #2232), GAPDH (CST, #5174), p65 (CST, #8242), p-p65 (CST, #3033), Calreticulin (CST, #12238), CD47 (CST, #63000), ACTB (CST, #3700), Histone H3 (CST, #4499), and PD-L1 (CST, #13684).

2.7 Immunofluorescence

The immunofluorescence was conducted following the instructions of the manufacturer. Briefly, after the OSI treatment for 48 h, HCC827 cells were fixed with 4% paraformaldehyde for 30 min, and then, they were treated with 0.5% Triton X-100 for 1 h at 25 °C. Next, the cells were blocked with 0.5% BSA containing 0.2% Triton X-100 for 1 h, incubated with the antibody against calreticulin overnight at 4 °C, followed by the staining with the anti-rabbit IgG (Alexa Fluor® 488 Conjugate) (#4412, CST, Beverly, MA, USA) for another 1 h. After washing with PBS for three times, the cells were further stained with DAPI for 10 min and photographed with Leica TCS SP8 microscope (Solms, Germany).

2.8 siRNA transfection

siRNAs targeting p65 and EGFR were obtained from Shanghai GenePharma (Shanghai, China), HCC827 cells were seeded in 6-well plates for 24 h, and specific siRNAs were added for transfection to knockdown the expression of the related genes with Lipofectamine® 2000 Reagent (Invitrogen, Waltham, MA, USA) in accordance with the protocols. The related sequences are listed in Tab.1. After 48 h, the specific proteins were determined through the same procedure as Western blot.

2.9 MTT assay

The cells were first seeded in 96-well plates with 6000 cells per well for 24 h. Then, OSI was added to the plates at different concentration levels (0, 0.001, 0.013, 0.125, 1.25, and 12.5 μmol/L) for another 48 h. Next, the cells were incubated with 1 mg/mL MTT for 4 h at 37 °C. Finally, the supernatant was removed and 100 μL DMSO was added to determine the cell viability under SpectraMax M5 microplate reader (Molecular Devices, Sunnyvale, CA, USA).

2.10 Phagocytosis assay

Human and mouse CD47 have similar affinity to SIRPα expressed on the mouse macrophage [25]. The coculture system of bone marrow-derived macrophages (BMDMs) from mice and human cancer cells has been widely used to detect the phagocytosis efficacy [26,27]. In brief, BMDMs from C57BL/6 mice femora and tibiae were produced with the culture with 10% FBS DMEM containing 25% L929 supernatant for 7 days (replacing with new medium after 3 days). Then, the macrophages were digested by trypsin and plated in 24-well plates (1 × 105 per well) overnight. HCC827 and NCI-H1975 cells pretreated with OSI were stained with 2.5 μmol/L CFSE at 37 °C for 10 min in accordance with the protocols. After ceasing with 10% medium, the cells were incubated with B6H12 (10 μg/mL, BioXcell, West Lebanon, NH, USA #BE0019-1) for 1 h under 4 °C, and then, they were added to the macrophages (cancer cells: macrophages = 3:1) for another 2 h at 37 °C. Finally, the macrophages were stained with APC-labeled anti-F4/80 (#123116, Biolegend, San Diego, USA) and detected by flow cytometry (BD LSRFortessa, Franklin Lakes, NJ, USA). CFSE+/F4/80+ double-positive cells were identified as the positive phagocytotic cells, and phagocytosis rate was calculated as (CFSE+F4/80+ cells/ F4/80+ cells) × 100% and standardized as the percentage of control.

2.11 Flow cytometry assay

Cancer cells pretreated with OSI were first digested with trypsin and incubated with the related antibody at room temperature in dark for 45 min. Then, the cells were washed with PBS three times and analyzed by flow cytometry. The used antibodies were as follows: PE-labeled mouse antihuman PD-L1 (#557924, BD Bioscience, Franklin Lakes, NJ, USA), recombinant PE-labeled human SIRPα Protein (#SIA-HP252, ACRO Biosystems, Beijing, China), Calreticulin (CST, #12238), Alexa Fluor 488 labeled goat anti-rabbit IgG (H + L) secondary antibody (#A-11008, Biolegend, San Diego, CA, USA), and FITC-labeled antihuman CD47 (#CC2C6, Biolegend, San Diego, CA, USA).

2.12 Statistical analysis

The data related to CD47 expression and macrophage infiltration in EGFR mutated lung adenocarcinoma was analyzed from the TCGA database with the software Timer2.0. The data related to CD47 mRNA expression before and after TKI treatment were from GSE165019. Student’s t-test and one-way ANOVA were used as the main method to calculate the statistical significance in GraphPad Prism 7 (Graph-Pad Software, Inc, California, USA). Each experiment has been repeated at least three times. Data were presented as mean ± SEM. P < 0.05 was regarded as the statistically significant difference. The note “*” was represented as P < 0.05, “**” as P < 0.01, and “***” as P < 0.001. “ns” was represented as no statistical significance.

3 Results

3.1 OSI induces higher CD47expression in HCC827 and NCI-H1975 cells

In our previous report, PD-L1, an important immune checkpoint related to adaptive immunity, was downregulated by OSI in NCI-H1975 cells [24]. Lung cancer cells with different mutations were treated with OSI to explore the CD47 expression for further determining the innate-related profile. OSI of 125 nmol/L significantly inhibited the proliferation with about 50% inhibition rate in EGFR mutant HCC827 (EGFR exon 19 deletion), NCI-H1975 (EGFR L858R/T790M mutation), and PC-9 (EGFR exon 19 deletion, CDKN2A mutation) cells, and no obvious suppression was detected under the same concentration of OSI in EGFR wildtype A549 (KRAS mutation) and NCI-H1299 (NRAS mutation) cells (Fig. S2). Meanwhile, treatment of OSI (125 nmol/L) upregulated CD47 expression obviously in HCC827 and NCI-H1975 cells, whereas significant difference was not observed in A549, NCI-H460 (KRAS mutation), NCI-H358 (KRAS mutation), and NCI-H1299 cells (Fig.1). Therefore, OSI-mediated effect on CD47 might be EGFR dependent. Notably, the upregulated CD47 was not obvious in EGFR mutant PC-9 cells (Fig.1). HCC827 cells were next treated with different concentrations of OSI ranging from 0.5 nmol/L to 125 nmol/L for 1 h and 48 h. As expected, p-EGFR was inhibited obviously at 1 h and 48 h, and CD47 expression was upregulated accordingly at 48 h (Fig.1 and 1D). Consistently, the CD47 expression level on the membrane was upregulated at 48 h, which indicated that upregulation of membrane CD47 was time dependent (Fig.1 and 1E). Notably, the expression of total EGFR during OSI treatment seemed to be unstable (Fig.1 and 1E). EGFR-TKIs have been reported to induce EGFR endocytosis and degradation [28], which might partially explain the unstable EGFR expression after OSI administration. HCC827 xenograft model was established and treated with OSI (0.5 mg/kg) to further verify the CD47 regulation by OSI in vivo. Consistent with the in vitro result, higher CD47 expression was also observed in tumors (Fig.1). According to the gene expression data from GSE 165019, the treatment of EGFR-TKIs (OSI or erlotinib) showed an increased trend of CD47 mRNA levels (P = 0.05) in human lung adenocarcinoma samples (EGFR exon 19 deletion or EGFR L858R mutation) (Fig. S1C). Collectively, the abovementioned findings indicated higher CD47 expression induced by OSI in vitro and in vivo.

3.2 OSI induces higher CD47 expression through NF-κB pathway

The CD47 mRNA level was detected by qRT-PCR after OSI treatment for 24 h and 48 h to determine whether the regulation of CD47 was involved in the transcriptional level. OSI increased the CD47 mRNA level significantly and reached the highest at 48 h in HCC827 cells (Fig.2). Other TKIs including erlotinib (first-line generation TKI) and afatinib (second-line generation TKI) also increased the CD47 expression obviously (Fig. S3), which suggested that the regulation of CD47 might be EGFR dependent. Recently, NF-κB has been identified as an important regulator for CD47 transcription via binding to the CD47-associated specific super-enhancer in different cancer cells [17,29]. In our previous report, OSI activated the NF-κB pathway in NCI-H1975 cells through the upregulation of transforming growth factor beta 2 [30]. Therefore, we hypothesized that OSI regulated CD47 expression through the NF-κB pathway. As expected, activation of p65 and higher CD47 expression were observed under OSI treatment or knockdown of EGFR (Fig.2 and 2C). Consistently, the upregulated CD47 was diminished by the knockdown of p65 (Fig.2). In addition, OSI induced more translocation of p-p65 in the nucleus (Fig.2). The upregulation of p-p65 was detected in HCC827 and NCI-H1975 but not in PC-9 cells after the treatment of OSI (125 nmol/L) (Fig. S4). Overall, the higher CD47 expression induced by OSI was partially dependent on the NF-κB pathway.

3.3 Anti-CD47 antibody (B6H12) strengthens the anticancer efficiency of OSI

CD47 functions as a “don’t eat me” signal upon the interaction of SIRPα on macrophages [31]. Thus, the binding of CD47 to recombinant human SIRPα protein was first detected. As shown in Fig.3, the SIRPα protein binding increased significantly in OSI treatment group, which suggested that CD47 exerted the function to bind to SIRPα on macrophages. In the coculture model of cancer cells and BMDMs, the combination of OSI and B6H12 exhibited dramatically increased phagocytosis capacity with the phagocytosis index from 3.9% to 50.2% and from 7.5% to 30.0% in HCC827 and NCI-H1975 cells, respectively, compared with the isotype group (Fig.3). Meanwhile, about twofold increase in the phagocytosis rate was observed in the combination group compared with that in the single B6H12 group. OSI treatment also induced slightly higher phagocytosis even though CD47 expression was higher (Fig.3). In consideration of the dramatically augmented phagocytosis effect in vitro, the combination efficacy was investigated in HCC827 xenograft mice model. The mice were randomly divided into four groups and treated with vehicle, OSI (0.5 mg/kg), B6H12 (200 μg per mouse), or the combination of OSI and B6H12 for about 3 weeks. The common dosage of OSI in vivo was about 3 mg/kg [32,33], while 0.5 mg/kg was selected since CD47 was dramatically upregulated after 8 nmol/L OSI treatment, which is a very low concentration, in HCC827 cells (Fig.1 and 1D). In addition, macrophage infiltration was increased obviously after 0.5 mg/kg OSI treatment in vivo (data not shown). Thus, the treatment efficacy, which was dependent on modulation to macrophage phagocytosis rather than direct cytotoxicity toward cancer cells by OSI, could be effectively observed at a low dosage. As shown in Fig.3 and 3D, even though no significant difference existed between the vehicle group and OSI or B6H12 group, combination therapy significantly suppressed the tumor growth with an inhibition rate of 64% compared with that in the vehicle group. All groups also showed no significant change in the body weight (Fig.3). Thus, the results above verified that CD47 blockade enhanced the phagocytosis in vitro and anticancer effect in vivo in combination with OSI.

3.4 OSI induces stronger antibody-dependent cellular phagocytosis effect of anti-CD47 antibody in HCC827 cells

Antibody-dependent cellular phagocytosis (ADCP) is a potent mechanism through which macrophages contribute to the anticancer effect of antibodies [34]. To achieve ADCP effect of the antibodies, the binding of Fc region to the Fc gamma receptors (FcγR) on macrophages is required besides the attachment of Fab region to a specific receptor on cancer cells [35]. Given the important role of CD47 in ADCP effect induced by B6H12, HCC827/CD47KO cell line was established. CD47 protein level was eliminated in HCC827/CD47KO cells (Fig.4) and slightly higher phagocytosis rate was observed in HCC827/CD47KO cells (6.1%) compared with that in normal HCC827 cells (3.7%) (Fig.4). In addition, the increased phagocytosis rate induced by the combination therapy declined to the same level as the OSI group (~11%) in HCC827/CD47KO cells (Fig.4), which indicated that the ADCP effect of B6H12 was abolished. Furthermore, blocking CD16/32 decreased the phagocytosis rate by 8.7% and 15.7% in B6H12 and combination groups, respectively (Fig.4). Thus, FcγR blockade partially reversed the phagocytosis effect induced by the combination treatment of B6H12 and OSI (Fig.4). The abovementioned results indicated that the dramatically increased phagocytosis induced by the combination treatment highly relied on the ADCP effect.

3.5 OSI induces higher calreticulin expression but downregulates PD-L1 expression

OSI alone induced slightly higher phagocytosis even though CD47 was upregulated (Fig.3). Calreticulin has been identified as an important “eat me” signal in increasing the phagocytosis rate [36]. As shown in Fig.5 and 5B, the expression of calreticulin was upregulated significantly in OSI treatment group. In addition, programmed death-ligand 1 (PD-L1) could bind to PD-1 on macrophages as a “don’t eat me” signal to escape the phagocytosis by macrophages [22]. Herein, OSI also decreased the PD-L1 expression in HCC827 cells (Fig.5 and 5D). The abovementioned results indicated that OSI might regulate the phagocytosis effect through multidimensional regulation including CD47, calreticulin, and PD-L1.

4 Discussion

Different combination approaches of OSI with different drugs including antibodies and chemotherapy have been under investigation in clinical trials to enhance the efficacy of OSI [37,38]. The comparison of carboplatin (or cisplatin) pemetrexed plus OSI with OSI alone is being explored in phase III trial FLAURA 2, which is based on the positive results in phase III NEJ009 trial that the combination of chemotherapy and gefitinib versus gefitinib showed longer PFS (20.9 versus 11.9 months). The combination of OSI and anti-angiogenetic drugs has also been investigated to enhance the OSI efficacy. The data from phase I/II clinical trials showed prolonged PFS (19 months) for OSI plus bevacizumab [38]. However, another combination therapy of OSI and anti-PD-1/PD-L1 antibodies showed severe interstitial lung disease in clinical trials [39,40], which resulted in the termination of the patient enrollment. In this study, CD47 blockade promoted the anticancer effect of OSI in vivo, while the mice body weight did not change significantly. In addition, the organs morphology seems to have no obvious change compared with the vehicle group (data not shown), which suggested that the combination therapy with CD47 blockade had minimal toxicity to the mice body and was a potential novel strategy to improve the OSI efficacy (Fig.6). However, further cytotoxicity assessment such as anemia is still necessary in clinical trials for the combination treatment considering that low affinity has been observed between B6H12 and murine erythrocytes [41]. Notably, p65 was not activated and membrane CD47 had no obvious increase in PC-9 cells during OSI treatment (Fig.1 and S4). Therefore, the activation of p65 by OSI might be an important marker for effective combination therapy of OSI and anti-CD47 antibody.

Previous studies have highlighted the ADCP effect for anti-CD47 antibodies [4244]. The Fc region of B6H12 used in this study was mouse IgG1, which could recognize the FcγR on mouse macrophages. The Fab fragment of B6H12 is insufficient to induce the maximum phagocytosis [42,43]. Here, the knockout of CD47 alone was also suboptimal for inducing the maximized phagocytosis compared with B6H12 (Fig.3 and 4B), which implied the crucial role of Fc–FcγR interaction. CD47 expression is positively correlated with the phagocytosis degree by anti-CD47 antibody [43,45]. Herein, OSI dramatically enhanced the ADCP effect by B6H12 through the augmentation of CD47 expression in cancer cells, which further supported the close relationship of CD47 expression and anti-CD47 antibody-mediated phagocytosis. Furthermore, higher constitutive CD47 expression was detected in HCC827 than in NCI-H1975 cells (data not shown), which may account for the higher ADCP effect in HCC827 cells (Fig.3).

NF-κB has been discovered as a pivotal transcription factor in regulating the CD47 expression [18,29,46]. Further CD47 regulatory genomic landscape analysis identified CD47-associated specific super-enhancer (long stretches of DNA (> 20 kb)) as NF-κB binding site [29]. Here, NF-κB pathway was activated by OSI, and CD47 was upregulated accordingly in NCI-H1975 and HCC827 cells as expected (Fig. S4). Increased TRAF2 ubiquitination by EGFR-TKIs (erlotinib or afatinib) was essential for the activation of IKKβ/γ and NF-κB in EGFR mutant lung adenocarcinoma [47]. In our previous study, the higher expression of transforming growth factor beta 2 induced by OSI was closely correlated with the activation of NF-κB pathway and cancer cell resistance [30]. However, which pathway was mainly involved in the CD47 regulation needs to be further explored. Notably, the knockdown of p65 could not reduce the CD47 expression upregulated by OSI to the same level as the control group (Fig.2). Thus, other pathways might be involved in the CD47 regulation besides NF-κB pathway, which suggested a multiple regulation by OSI in CD47 expression.

The potential role of CD47 in OSI acquired resistance was also explored. However, the OSI-resistant cell lines including NCI-H1975/OSIR and HCC827/OSIR clones established in our research group [30,48] did not show increased CD47 expression (data not shown) compared with the parent HCC827 and NCI-H1975 cells. Therefore, transient protein activation induced by OSI might be different from prolonged OSI stimulation. However, for the complicated mechanisms of OSI resistance [49], whether CD47 is upregulated in other OSI-resistant NSCLC is uncertain. Previous studies have reported that CD47 upregulation led to the sorafenib resistance in liver cancer, as well as the radiotherapy resistance in HER2+ breast cancer [18,50]. The clinical data (GSE165019) also showed an increasing trend of the CD47 mRNA level after short-term administration of OSI or erotinib (about 2 weeks) (Fig. S1C). Therefore, more OSI-resistant models and clinical data are urgently required to further verify whether CD47 upregulation contributes to OSI resistance.

Notably, OSI alone induced slightly higher phagocytosis than the control group even though CD47 was upregulated (Fig.3). As mentioned before, the knockout of CD47 alone was insufficient for maximized phagocytosis. Apart from FcγR on macrophages, other pro-phagocytic signals such as calreticulin and SLAMF7 on cancer cells were also involved in the phagocytosis efficacy [11]. Here, OSI also induced the exposure of calreticulin on HCC827 cells (Fig.5 and 5B). Calreticulin exposed on the surface of dying cells could enhance the prophagocytic vulnerability by macrophages and cross-activate the adaptive immune system [51]. Some chemotherapeutic drugs such as temozolomide induced higher expression of calreticulin on the surface of cancer cells through endoplasmic reticulum (ER) stress to initiate the phagocytosis and antigen presentation of macrophages and dendritic cells [36,52]. In this study, IRE1α (ER transmembrane sensor) inhibition reversed the upregulated calreticulin by OSI (data not shown), which implied that OSI might induce the membrane translocation of calreticulin through ER stress. In addition, the immune checkpoint PD-L1, known as a co-inhibitory signal by counteracting T cell activation [53], could bind to the ligand PD-1 on macrophages, which resulted in the phagocytosis disruption [22]. PD-1 positive macrophages showed weaker phagocytosis and predicted poor prognosis in human tumors [22]. Here, PD-L1 was significantly downregulated by OSI in HCC827 cells, which was in line with the previous report that OSI induced the PD-L1 mRNA downregulation and proteasomal degradation [24]. Overall, the multitude of signals related to phagocytosis were regulated by OSI, which might explain the increased phagocytosis. However, the detailed effect of regulated calreticulin and PD-L1 by OSI on phagocytosis needs to be further elucidated.

5 Conclusions

This study found for the first time that OSI upregulated the CD47 expression via the NF-κB pathway. Meanwhile, the combination therapy of OSI and the anti-CD47 antibody significantly promoted the phagocytosis in vitro and enhanced the anticancer effect in vivo, which provided a potential novel combination strategy to enhance the OSI efficacy in EGFR mutant NSCLC with CD47 activation induced by OSI.

References

[1]

Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2021; 71(3): 209–249

[2]

Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018; 68(6): 394–424

[3]

Govindan R. Overcoming resistance to targeted therapy for lung cancer. N Engl J Med 2015; 372(18): 1760–1761

[4]

Mok TS, Wu YL, Thongprasert S, Yang CH, Chu DT, Saijo N, Sunpaweravong P, Han B, Margono B, Ichinose Y, Nishiwaki Y, Ohe Y, Yang JJ, Chewaskulyong B, Jiang H, Duffield EL, Watkins CL, Armour AA, Fukuoka M. Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. N Engl J Med 2009; 361(10): 947–957

[5]

Rosell R, Carcereny E, Gervais R, Vergnenegre A, Massuti B, Felip E, Palmero R, Garcia-Gomez R, Pallares C, Sanchez JM, Porta R, Cobo M, Garrido P, Longo F, Moran T, Insa A, De Marinis F, Corre R, Bover I, Illiano A, Dansin E, de Castro J, Milella M, Reguart N, Altavilla G, Jimenez U, Provencio M, Moreno MA, Terrasa J, Muñoz-Langa J, Valdivia J, Isla D, Domine M, Molinier O, Mazieres J, Baize N, Garcia-Campelo R, Robinet G, Rodriguez-Abreu D, Lopez-Vivanco G, Gebbia V, Ferrera-Delgado L, Bombaron P, Bernabe R, Bearz A, Artal A, Cortesi E, Rolfo C, Sanchez-Ronco M, Drozdowskyj A, Queralt C, de Aguirre I, Ramirez JL, Sanchez JJ, Molina MA, Taron M, Paz-Ares L; Spanish Lung Cancer Group in collaboration with Groupe Français de Pneumo-Cancérologie, Associazione Italiana Oncologia Toracica. Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre, open-label, randomised phase 3 trial. Lancet Oncol 2012; 13(3): 239–246

[6]

Sequist LV, Yang JC, Yamamoto N, O’Byrne K, Hirsh V, Mok T, Geater SL, Orlov S, Tsai CM, Boyer M, Su WC, Bennouna J, Kato T, Gorbunova V, Lee KH, Shah R, Massey D, Zazulina V, Shahidi M, Schuler M. Phase III study of afatinib or cisplatin plus pemetrexed in patients with metastatic lung adenocarcinoma with EGFR mutations. J Clin Oncol 2013; 31(27): 3327–3334

[7]

Ramalingam SS, Yang JC, Lee CK, Kurata T, Kim DW, John T, Nogami N, Ohe Y, Mann H, Rukazenkov Y, Ghiorghiu S, Stetson D, Markovets A, Barrett JC, Thress KS, Jänne PA. Osimertinib as first-line treatment of EGFR mutation-positive advanced non-small-cell lung cancer. J Clin Oncol 2018; 36(9): 841–849

[8]

Soria JC, Ohe Y, Vansteenkiste J, Reungwetwattana T, Chewaskulyong B, Lee KH, Dechaphunkul A, Imamura F, Nogami N, Kurata T, Okamoto I, Zhou C, Cho BC, Cheng Y, Cho EK, Voon PJ, Planchard D, Su WC, Gray JE, Lee SM, Hodge R, Marotti M, Rukazenkov Y, Ramalingam SS; FLAURA Investigators. Osimertinib in untreated EGFR-mutated advanced non-small-cell lung cancer. N Engl J Med 2018; 378(2): 113–125

[9]

Ramalingam SS, Vansteenkiste J, Planchard D, Cho BC, Gray JE, Ohe Y, Zhou C, Reungwetwattana T, Cheng Y, Chewaskulyong B, Shah R, Cobo M, Lee KH, Cheema P, Tiseo M, John T, Lin MC, Imamura F, Kurata T, Todd A, Hodge R, Saggese M, Rukazenkov Y, Soria JC; FLAURA Investigators. Overall survival with osimertinib in untreated, EGFR-mutated advanced NSCLC. N Engl J Med 2020; 382(1): 41–50

[10]

Iwasaki A, Medzhitov R. Regulation of adaptive immunity by the innate immune system. Science 2010; 327(5963): 291–295

[11]

Feng M, Jiang W, Kim BYS, Zhang CC, Fu YX, Weissman IL. Phagocytosis checkpoints as new targets for cancer immunotherapy. Nat Rev Cancer 2019; 19(10): 568–586

[12]

Logtenberg MEW, Scheeren FA, Schumacher TN. The CD47-SIRPα immune checkpoint. Immunity 2020; 52(5): 742–752

[13]

Oldenborg PA, Zheleznyak A, Fang YF, Lagenaur CF, Gresham HD, Lindberg FP. Role of CD47 as a marker of self on red blood cells. Science 2000; 288(5473): 2051–2054

[14]

Yu WB, Ye ZH, Chen X, Shi JJ, Lu JJ. The development of small-molecule inhibitors targeting CD47. Drug Discov Today 2021; 26(2): 561–568

[15]

Majeti R, Chao MP, Alizadeh AA, Pang WW, Jaiswal S, Gibbs KD Jr, van Rooijen N, Weissman IL. CD47 is an adverse prognostic factor and therapeutic antibody target on human acute myeloid leukemia stem cells. Cell 2009; 138(2): 286–299

[16]

Willingham SB, Volkmer JP, Gentles AJ, Sahoo D, Dalerba P, Mitra SS, Wang J, Contreras-Trujillo H, Martin R, Cohen JD, Lovelace P, Scheeren FA, Chao MP, Weiskopf K, Tang C, Volkmer AK, Naik TJ, Storm TA, Mosley AR, Edris B, Schmid SM, Sun CK, Chua MS, Murillo O, Rajendran P, Cha AC, Chin RK, Kim D, Adorno M, Raveh T, Tseng D, Jaiswal S, Enger PO, Steinberg GK, Li G, So SK, Majeti R, Harsh GR, van de Rijn M, Teng NN, Sunwoo JB, Alizadeh AA, Clarke MF, Weissman IL. The CD47-signal regulatory protein alpha (SIRPα) interaction is a therapeutic target for human solid tumors. Proc Natl Acad Sci USA 2012; 109(17): 6662–6667

[17]

Zhang X, Wang Y, Fan J, Chen W, Luan J, Mei X, Wang S, Li Y, Ye L, Li S, Tian W, Yin K, Ju D. Blocking CD47 efficiently potentiated therapeutic effects of anti-angiogenic therapy in non-small cell lung cancer. J Immunother Cancer 2019; 7(1): 346

[18]

Lo J, Lau EY, Ching RH, Cheng BY, Ma MK, Ng IO, Lee TK. Nuclear factor kappa B-mediated CD47 up-regulation promotes sorafenib resistance and its blockade synergizes the effect of sorafenib in hepatocellular carcinoma in mice. Hepatology 2015; 62(2): 534–545

[19]

Liu F, Jiang CC, Yan XG, Tseng HY, Wang CY, Zhang YY, Yari H, La T, Farrelly M, Guo ST, Thorne RF, Jin L, Wang Q, Zhang XD. BRAF/MEK inhibitors promote CD47 expression that is reversible by ERK inhibition in melanoma. Oncotarget 2017; 8(41): 69477–69492

[20]

Cui Z, Xu D, Zhang F, Sun J, Song L, Ye W, Zeng J, Zhou M, Ruan Z, Zhang L, Ren R. CD47 blockade enhances therapeutic efficacy of cisplatin against lung carcinoma in a murine model. Exp Cell Res 2021; 405(2): 112677

[21]

Lee TK, Cheung VC, Lu P, Lau EY, Ma S, Tang KH, Tong M, Lo J, Ng IO. Blockade of CD47-mediated cathepsin S/protease-activated receptor 2 signaling provides a therapeutic target for hepatocellular carcinoma. Hepatology 2014; 60(1): 179–191

[22]

Gordon SR, Maute RL, Dulken BW, Hutter G, George BM, McCracken MN, Gupta R, Tsai JM, Sinha R, Corey D, Ring AM, Connolly AJ, Weissman IL. PD-1 expression by tumour-associated macrophages inhibits phagocytosis and tumour immunity. Nature 2017; 545(7655): 495–499

[23]

Chen X, Yang Y, Zhou Q, Weiss JM, Howard OZ, McPherson JM, Wakefield LM, Oppenheim JJ. Effective chemoimmunotherapy with anti-TGFβ antibody and cyclophosphamide in a mouse model of breast cancer. PLoS One 2014; 9(1): e85398

[24]

Jiang XM, Xu YL, Huang MY, Zhang LL, Su MX, Chen X, Lu JJ. Osimertinib (AZD9291) decreases programmed death ligand-1 in EGFR-mutated non-small cell lung cancer cells. Acta Pharmacol Sin 2017; 38(11): 1512–1520

[25]

Tsai RK, Rodriguez PL, Discher DE. Self inhibition of phagocytosis: the affinity of ‘marker of self’ CD47 for SIRPalpha dictates potency of inhibition but only at low expression levels. Blood Cells Mol Dis 2010; 45(1): 67–74

[26]

Lo J, Lau EY, So FT, Lu P, Chan VS, Cheung VC, Ching RH, Cheng BY, Ma MK, Ng IO, Lee TK. Anti-CD47 antibody suppresses tumour growth and augments the effect of chemotherapy treatment in hepatocellular carcinoma. Liver Int 2016; 36(5): 737–745

[27]

Wu Z, Weng L, Zhang T, Tian H, Fang L, Teng H, Zhang W, Gao J, Hao Y, Li Y, Zhou H, Wang P. Identification of glutaminyl cyclase isoenzyme isoQC as a regulator of SIRPα-CD47 axis. Cell Res 2019; 29(6): 502–505

[28]

Citri A, Alroy I, Lavi S, Rubin C, Xu W, Grammatikakis N, Patterson C, Neckers L, Fry DW, Yarden Y. Drug-induced ubiquitylation and degradation of ErbB receptor tyrosine kinases: implications for cancer therapy. EMBO J 2002; 21(10): 2407–2417

[29]

Betancur PA, Abraham BJ, Yiu YY, Willingham SB, Khameneh F, Zarnegar M, Kuo AH, McKenna K, Kojima Y, Leeper NJ, Ho P, Gip P, Swigut T, Sherwood RI, Clarke MF, Somlo G, Young RA, Weissman ILA. A CD47-associated super-enhancer links pro-inflammatory signalling to CD47 upregulation in breast cancer. Nat Commun 2017; 8(1): 14802

[30]

Jiang XM, Xu YL, Yuan LW, Zhang LL, Huang MY, Ye ZH, Su MX, Chen XP, Zhu H, Ye RD, Lu JJ. TGFβ2-mediated epithelial-mesenchymal transition and NF-κB pathway activation contribute to osimertinib resistance. Acta Pharmacol Sin 2021; 42(3): 451–459

[31]

Veillette A, Chen J. SIRPα-CD47 immune checkpoint blockade in anticancer therapy. Trends Immunol 2018; 39(3): 173–184

[32]

La Monica S, Minari R, Cretella D, Flammini L, Fumarola C, Bonelli M, Cavazzoni A, Digiacomo G, Galetti M, Madeddu D, Falco A, Lagrasta CA, Squadrilli A, Barocelli E, Romanel A, Quaini F, Petronini PG, Tiseo M, Alfieri R. Third generation EGFR inhibitor osimertinib combined with pemetrexed or cisplatin exerts long-lasting anti-tumor effect in EGFR-mutated pre-clinical models of NSCLC. J Exp Clin Cancer Res 2019; 38(1): 222

[33]

Cross DA, Ashton SE, Ghiorghiu S, Eberlein C, Nebhan CA, Spitzler PJ, Orme JP, Finlay MR, Ward RA, Mellor MJ, Hughes G, Rahi A, Jacobs VN, Red Brewer M, Ichihara E, Sun J, Jin H, Ballard P, Al-Kadhimi K, Rowlinson R, Klinowska T, Richmond GH, Cantarini M, Kim DW, Ranson MR, Pao W. AZD9291, an irreversible EGFR TKI, overcomes T790M-mediated resistance to EGFR inhibitors in lung cancer. Cancer Discov 2014; 4(9): 1046–1061

[34]

Kurdi AT, Glavey SV, Bezman NA, Jhatakia A, Guerriero JL, Manier S, Moschetta M, Mishima Y, Roccaro A, Detappe A, Liu CJ, Sacco A, Huynh D, Tai YT, Robbins MD, Azzi J, Ghobrial IM. Antibody-dependent cellular phagocytosis by macrophages is a novel mechanism of action of elotuzumab. Mol Cancer Ther 2018; 17(7): 1454–1463

[35]

Kamen L, Myneni S, Langsdorf C, Kho E, Ordonia B, Thakurta T, Zheng K, Song A, Chung S. A novel method for determining antibody-dependent cellular phagocytosis. J Immunol Methods 2019; 468: 55–60

[36]

von Roemeling CA, Wang Y, Qie Y, Yuan H, Zhao H, Liu X, Yang Z, Yang M, Deng W, Bruno KA, Chan CK, Lee AS, Rosenfeld SS, Yun K, Johnson AJ, Mitchell DA, Jiang W, Kim BYS. Therapeutic modulation of phagocytosis in glioblastoma can activate both innate and adaptive antitumour immunity. Nat Commun 2020; 11(1): 1508

[37]

Papadimitrakopoulou VA, Mok TS, Han JY, Ahn MJ, Delmonte A, Ramalingam SS, Kim SW, Shepherd FA, Laskin J, He Y, Akamatsu H, Theelen WSME, Su WC, John T, Sebastian M, Mann H, Miranda M, Laus G, Rukazenkov Y, Wu YL. Osimertinib versus platinum-pemetrexed for patients with EGFR T790M advanced NSCLC and progression on a prior EGFR-tyrosine kinase inhibitor: AURA3 overall survival analysis. Ann Oncol 2020; 31(11): 1536–1544

[38]

Yu HA, Schoenfeld AJ, Makhnin A, Kim R, Rizvi H, Tsui D, Falcon C, Houck-Loomis B, Meng F, Yang JL, Tobi Y, Heller G, Ahn L, Hayes SA, Young RJ, Arcila ME, Berger M, Chaft JE, Ladanyi M, Riely GJ, Kris MG. Effect of osimertinib and bevacizumab on progression-free survival for patients with metastatic EGFR-mutant lung cancers: a phase 1/2 single-group open-label trial. JAMA Oncol 2020; 6(7): 1048–1054

[39]

Oshima Y, Tanimoto T, Yuji K, Tojo A. EGFR-TKI-associated interstitial pneumonitis in nivolumab-treated patients with non-small cell lung cancer. JAMA Oncol 2018; 4(8): 1112–1115

[40]

Oxnard GR, Yang JC, Yu H, Kim SW, Saka H, Horn L, Goto K, Ohe Y, Mann H, Thress KS, Frigault MM, Vishwanathan K, Ghiorghiu D, Ramalingam SS, Ahn MJ. TATTON: a multi-arm, phase Ib trial of osimertinib combined with selumetinib, savolitinib, or durvalumab in EGFR-mutant lung cancer. Ann Oncol 2020; 31(4): 507–516

[41]

Subramanian S, Parthasarathy R, Sen S, Boder ET, Discher DE. Species- and cell type-specific interactions between CD47 and human SIRPalpha. Blood 2006; 107(6): 2548–2556

[42]

Jain S, Van Scoyk A, Morgan EA, Matthews A, Stevenson K, Newton G, Powers F, Autio A, Louissaint A Jr, Pontini G, Aster JC, Luscinskas FW, Weinstock DM. Targeted inhibition of CD47-SIRPα requires Fc-FcγR interactions to maximize activity in T-cell lymphomas. Blood 2019; 134(17): 1430–1440

[43]

Chao MP, Alizadeh AA, Tang C, Myklebust JH, Varghese B, Gill S, Jan M, Cha AC, Chan CK, Tan BT, Park CY, Zhao F, Kohrt HE, Malumbres R, Briones J, Gascoyne RD, Lossos IS, Levy R, Weissman IL, Majeti R. Anti-CD47 antibody synergizes with rituximab to promote phagocytosis and eradicate non-Hodgkin lymphoma. Cell 2010; 142(5): 699–713

[44]

Pietsch EC, Dong J, Cardoso R, Zhang X, Chin D, Hawkins R, Dinh T, Zhou M, Strake B, Feng PH, Rocca M, Santos CD, Shan X, Danet-Desnoyers G, Shi F, Kaiser E, Millar HJ, Fenton S, Swanson R, Nemeth JA, Attar RM. Anti-leukemic activity and tolerability of anti-human CD47 monoclonal antibodies. Blood Cancer J 2017; 7(2): e536

[45]

Métayer LE, Vilalta A, Burke GAA, Brown GC. Anti-CD47 antibodies induce phagocytosis of live, malignant B cells by macrophages via the Fc domain, resulting in cell death by phagoptosis. Oncotarget 2017; 8(37): 60892–60903

[46]

Huang CY, Ye ZH, Huang MY, Lu JJ. Regulation of CD47 expression in cancer cells. Transl Oncol 2020; 13(12): 100862

[47]

Blakely CM, Pazarentzos E, Olivas V, Asthana S, Yan JJ, Tan I, Hrustanovic G, Chan E, Lin L, Neel DS, Newton W, Bobb KL, Fouts TR, Meshulam J, Gubens MA, Jablons DM, Johnson JR, Bandyopadhyay S, Krogan NJ, Bivona TG. NF-κB-activating complex engaged in response to EGFR oncogene inhibition drives tumor cell survival and residual disease in lung cancer. Cell Rep 2015; 11(1): 98–110

[48]

Tang ZH, Su MX, Guo X, Jiang XM, Jia L, Chen X, Lu JJ. Increased expression of IRE1α associates with the resistant mechanism of osimertinib (AZD9291)-resistant non-small cell lung cancer HCC827/OSIR cells. Anticancer Agents Med Chem 2018; 18(4): 550–555

[49]

Passaro A, Jänne PA, Mok T, Peters S. Overcoming therapy resistance in EGFR-mutant lung cancer. Nat Can 2021; 2(4): 377–391

[50]

Candas-Green D, Xie B, Huang J, Fan M, Wang A, Menaa C, Zhang Y, Zhang L, Jing D, Azghadi S, Zhou W, Liu L, Jiang N, Li T, Gao T, Sweeney C, Shen R, Lin TY, Pan CX, Ozpiskin OM, Woloschak G, Grdina DJ, Vaughan AT, Wang JM, Xia S, Monjazeb AM, Murphy WJ, Sun LQ, Chen HW, Lam KS, Weichselbaum RR, Li JJ. Dual blockade of CD47 and HER2 eliminates radioresistant breast cancer cells. Nat Commun 2020; 11(1): 4591

[51]

Fucikova J, Spisek R, Kroemer G, Galluzzi L. Calreticulin and cancer. Cell Res 2021; 31(1): 5–16

[52]

Vanmeerbeek I, Sprooten J, De Ruysscher D, Tejpar S, Vandenberghe P, Fucikova J, Spisek R, Zitvogel L, Kroemer G, Galluzzi L, Garg AD. Trial watch: chemotherapy-induced immunogenic cell death in immuno-oncology. OncoImmunology 2020; 9(1): 1703449

[53]

Sun C, Mezzadra R, Schumacher TN. Regulation and function of the PD-L1 checkpoint. Immunity 2018; 48(3): 434–452

RIGHTS & PERMISSIONS

Higher Education Press

PDF (7197KB)

Supplementary files

FMD-22011-OF-LJJ_suppl_1

FMD-22011-OF-LJJ_suppl_1

5528

Accesses

0

Citation

Detail

Sections
Recommended

/