Abivertinib inhibits megakaryocyte differentiation and platelet biogenesis

Jiansong Huang , Xin Huang , Yang Li , Xia Li , Jinghan Wang , Fenglin Li , Xiao Yan , Huanping Wang , Yungui Wang , Xiangjie Lin , Jifang Tu , Daqiang He , Wenle Ye , Min Yang , Jie Jin

Front. Med. ›› 2022, Vol. 16 ›› Issue (3) : 416 -428.

PDF (1869KB)
Front. Med. ›› 2022, Vol. 16 ›› Issue (3) :416 -428. DOI: 10.1007/s11684-021-0838-5
RESEARCH ARTICLE
RESEARCH ARTICLE
Abivertinib inhibits megakaryocyte differentiation and platelet biogenesis
Author information +
History +
PDF (1869KB)

Abstract

Abivertinib, a third-generation tyrosine kinase inhibitor, is originally designed to target epidermal growth factor receptor (EGFR)-activating mutations. Previous studies have shown that abivertinib has promising antitumor activity and a well-tolerated safety profile in patients with non-small-cell lung cancer. However, abivertinib also exhibited high inhibitory activity against Bruton’s tyrosine kinase and Janus kinase 3. Given that these kinases play some roles in the progression of megakaryopoiesis, we speculate that abivertinib can affect megakaryocyte (MK) differentiation and platelet biogenesis. We treated cord blood CD34+ hematopoietic stem cells, Meg-01 cells, and C57BL/6 mice with abivertinib and observed megakaryopoiesis to determine the biological effect of abivertinib on MK differentiation and platelet biogenesis. Our in vitro results showed that abivertinib impaired the CFU-MK formation, proliferation of CD34+ HSC-derived MK progenitor cells, and differentiation and functions of MKs and inhibited Meg-01-derived MK differentiation. These results suggested that megakaryopoiesis was inhibited by abivertinib. We also demonstrated in vivo that abivertinib decreased the number of MKs in bone marrow and platelet counts in mice, which suggested that thrombopoiesis was also inhibited. Thus, these preclinical data collectively suggested that abivertinib could inhibit MK differentiation and platelet biogenesis and might be an agent for thrombocythemia.

Keywords

abivertinib / Btk inhibitor / platelet / megakaryocyte / megakaryopoiesis / thrombopoiesis

Cite this article

Download citation ▾
Jiansong Huang, Xin Huang, Yang Li, Xia Li, Jinghan Wang, Fenglin Li, Xiao Yan, Huanping Wang, Yungui Wang, Xiangjie Lin, Jifang Tu, Daqiang He, Wenle Ye, Min Yang, Jie Jin. Abivertinib inhibits megakaryocyte differentiation and platelet biogenesis. Front. Med., 2022, 16(3): 416-428 DOI:10.1007/s11684-021-0838-5

登录浏览全文

4963

注册一个新账户 忘记密码

1 Introduction

Platelets are small, enucleated cell fragments that circulate within the blood and play vital roles in hemostasis. Platelets are also implicated in other pathophysiological processes, including thrombosis, inflammation, immune response, and tumor cell proliferation [13]. Megakaryocytes (MKs), as platelet precursor cells, are responsible for releasing platelets from vascular sinusoids and lung capillaries [4]. Platelet biogenesis occurs in two steps, i.e., megakaryopoiesis and thrombopoiesis [5]. MKs develop from hematopoietic stem cells (HSCs) in bone marrow (BM) in a process called megakaryopoiesis. These HSCs sequentially transition through several developmental stages, including multipotent, common myeloid, bipotential MK–erythroid, and unipotent MK progenitors, which differentiate into MKs in response to thrombopoietin (TPO), chemokines, and other stimuli. During MK development, MKs undergo nuclear endomitosis to increase ploidy, organelle biosynthesis, and maturation of the demarcation membrane system. Finally, MKs generate platelets (a process known as thrombopoiesis) by remodeling their cytoplasm into long, branched cytoplasmic extensions named proplatelets, which serve as assembly lines for platelet production.

Clinically, some drugs, such as eltrombopag [6] and decitabine [7], promote human megakaryopoiesis and increase platelet counts, whereas anagrelide [8] selectively inhibits megakaryopoiesis and is used to lower platelet counts in patients with essential thrombocythemia (ET). These individuals are also treated with drugs, such as hydroxyurea, interferon, and Jak2 inhibitors, which can inhibit megakaryopoiesis to a certain extent.

Abivertinib, an irreversible and highly selective epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor, is originally designed to inhibit EGFR-activating mutations and the T790M-acquired resistance mutation but not the wild-type EGFR [9]. Xu et al. report that abivertinib is safe in patients with non-small-cell lung cancer (NSCLC) at a dosage ranging from 50 mg to 550 mg once per day [9], whereas Ma et al. have stated that abivertinib is well tolerated at daily doses ranging from 50 mg to 600 mg [10]. However, in a panel of kinase enzymatic assays, abivertinib exhibits a high inhibitory activity against Janus kinase (Jak) 3 and Tec family members, including Bruton’s tyrosine kinase (Btk) [9]. Previous studies have shown that Jak3 and Tec family members may be involved in platelet biogenesis [1114]. Jak3 is reported to play a role in IL-21-modulated megakaryopoiesis and platelet production [11], and Tec family members participate in regulating megakaryopoiesis and platelet production via the TPO/c-Mpl signaling pathway [1214]. When used as a single agent, ibrutinib, a Btk inhibitor, is associated with increased incidence of thrombocytopenia [15]. Previous studies demonstrate that abivertinib has promising activity against mantle cell lymphoma (MCL), diffuse large B cell lymphoma, and acute myeloid leukemia (AML) by inhibiting Btk activity [1619]. An ongoing phase I trial (NCT03060850) shows that abivertinib is safe and tolerable with clinical efficacy in patients with relapsed or refractory B cell malignancies [20]. However, the role of abivertinib in platelet biogenesis remains unclear.

In this study, we have investigated the role of abivertinib in platelet biogenesis by using human cord blood, Meg-01 cells, and C57BL/6 mice. We show that abivertinib (1) impairs the colony-forming unit MK (CFU-MK) formation and the proliferation of MK progenitor cells; (2) inhibits CD34+ HSC-derived MK differentiation, ploidy, proplatelet formation (PPF), and MK adhesion and spreading; (3) inhibits Meg-01-derived MK differentiation; and (4) decreases platelet counts in mice. Collectively, these preclinical data suggest that abivertinib inhibits MK differentiation and platelet biogenesis and may be an agent for thrombocythemia.

2 Materials and methods

2.1 Antibodies and reagents

Abivertinib (AC0010) was provided by Hangzhou ACEA Pharmaceuticals Research Co., Ltd. (Hangzhou, China). PE-conjugated mouse antihuman CD61 and APC-conjugated mouse antihuman CD41a were purchased from BD Biosciences (San Jose, USA). Carboxymethylcellulose (CMC) was purchased from Sangon Biotech Co., Ltd. (Shanghai, China). The Ficoll–Paque was obtained from GE Healthcare (Uppsala, Sweden). Magnetic CD34 microbeads were purchased from Miltenyi Biotec (Bergisch Gladbach, Germany). SCF, IL-9, IL-6, IL-3, and TPO were obtained from PeproTech Inc. (Rocky Hill, USA). Z-VAD-FMK and staurosporine were purchased from Selleck Chemicals (Hoston, USA). Purified human fibrinogen was purchased from Enzyme Research Laboratories (South Bend, USA). All other reagents were acquired from Sigma-Aldrich (St Louis, USA).

2.2 Cell culture and treatment conditions

The human megakaryoblastic cell line Meg-01 was provided by Junling Liu (Shanghai Jiao Tong University School of Medicine, Shanghai, China). The properties of Meg-01 cells have been described previously [21,22]. Meg-01 cells were cultured in the RPMI 1640 medium (Corning) containing 10% fetal bovine serum (Gibco), 100 U/mL penicillin, and 100 mg/mL streptomycin and maintained in a humidified atmosphere of 5% CO2 at 37 °C. Meg-01 cells were treated with 10 nmol/L phorbol 12-myristate 13-acetate (PMA) to induce differentiation. Dimethyl sulfoxide (DMSO) was used as a vehicle (control) in subsequent cell experiments.

2.3 Cytotoxicity of abivertinib

First, the cytotoxicity of abivertinib in MKs and platelets was determined by measuring the release of phosphatase from Meg-01 cells and platelets as described elsewhere [23]. Washed platelets (100 mL, 1 × 108/mL) in HEPES–Tyrode’s buffer or Meg-01 cells (100 mL, 1 × 107/mL) in phosphate-buffered saline (PBS) were incubated with different abivertinib concentrations at 37 °C for 30 min without stirring. Suspensions were centrifuged at 4000 rpm for 5 min, and the phosphatase activity of the supernatant or pellets was separately measured using p-nitrophenyl phosphate as substrate. Second, the cytotoxicity of abivertinib in erythrocytes was determined as described previously [24,25]. Briefly, 1% (v/v) suspensions of human erythrocytes were incubated with abivertinib in 4 mmol/L HEPES buffer (pH 7.4) containing 1 mmol/L MgCl2, 2.7 mmol/L KCl, 137 mmol/L NaCl, 3.3 mmol/L NaH2PO4, 5.6 mmol/L glucose, and 0.35 mg/mL bovine serum albumin (BSA) at 37 °C for 30 min. After centrifugation of the samples at 4000 rpm for 5 min, the extent of the hemoglobin released into the supernatant was measured at an absorbance of 405 nm. Erythrocytes treated with 0.5% Triton X-100 were established as the baseline of 100%.

2.4 Cell viability assay

Meg-01 cells were seeded into 96-well plates at 5 × 103 cells/well and treated with different doses of abivertinib for 24, 48, 72, or 96 h. Cell viability was measured using an MTS proliferation assay kit. Cell viability assay experiments were repeated thrice. Half-maximal inhibitory concentrations (IC50) were calculated as described previously [16].

2.5 CD34+ HSCs differentiated into MKs in vitro

Detailed methods regarding the isolation and culture of human cord blood HSCs are described previously [26,27]. After obtaining informed consent, the umbilical cord blood was processed from the placentas of full-term pregnancies after delivery at the First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, China. Mononuclear cells were isolated by the Ficoll-Paque density gradient centrifugation. CD34+ HSCs were then isolated from mononuclear cells with anti-CD34-coupled immunomagnetic microbeads in accordance with the manufacturer’s protocol. CD34+ HSCs were cultured for two days in StemSpan SFEM II medium supplemented with SCF (100 ng/mL) and IL-3 (2 ng/mL) to encourage proliferation in a 12-well plate at 37 °C in a 5% CO2 fully humidified atmosphere. IL-6 (20 ng/mL), IL-9 (10 ng/mL), and TPO (20 ng/mL) were then added to the medium to induce MK differentiation, which was designated as day 0. CD34+ HSCs were treated with abivertinib or DMSO continuously from days 0 to 12 of culture prior to the study to determine the effect of abivertinib on megakaryopoiesis.

2.6 CFU-MK assay

CD34+ HSCs (5 × 104) were seeded into 24-well plates in the semisolid MegaCultTM medium with cytokines and type I bovine collagen for 12 days. Culture slides were fixed and stained with anti-integrin aIIbb3 antibodies. Cells were assigned to one of three treatment groups: 0 (control), 2.5, and 5 mmol/L abivertinib. The total number of colonies visible under a microscope was scored by two independent evaluators. The CFU-MK-derived colony was defined as a cluster of five or more MKs in accordance with the manufacturer’s instructions.

2.7 MK adhesion, spreading, and morphology

MK adhesion, spreading, and morphology were assessed as previously described [28]. Briefly, 24-well plates were coated with 100 mg/mL fibrinogen overnight at 4 °C and blocked with 1% BSA for 1 h at 37 °C. Cells treated with abivertinib were allowed to adhere and spread on the immobilized fibrinogen for two days. Nonadherent MK cells were gently removed with PBS, whereas adherent MK cells were permeabilized with 0.5% Triton X-100. CD34+ HSC-derived MKs were labeled with FITC-conjugated CD41a antibody and TRITC–phalloidin. Meg-01 cells were stained with FITC-conjugated b-tubulin antibody. Nuclei were stained with DAPI. All images were analyzed using Image J software.

2.8 Flow cytometry of cell surface markers, apoptosis, MK ploidy, and the mitochondrial membrane potential (MMP)

In the cell surface marker assay, samples were fixed in 4% paraformaldehyde for 30 min and stained with PE-conjugated CD61 and APC-conjugated CD41a for 30 min. Samples were then analyzed in a Novocyte 3000 flow cytometer. In the apoptosis assay, cells were cos-tained with 5 mL propidium iodide (PI) and either 5 mL annexin V–FITC or 5 mL annexin V–APC as described [29]. PI-negative/annexin V-positive events were defined as early apoptosis, whereas PI-positive/annexin V-positive events were defined as late apoptosis. On day 12 of differentiation, the MK ploidy was determined in accordance with previously described methods [26]. In brief, cells were washed twice with PBS containing 0.5% BSA and 2 mmol/L EDTA; resuspended in hypotonic citrate buffer (2.5 mmol/L sodium chloride, 1.25 mmol/L sodium citrate, and 3.5 mmol/L dextrose) containing 20 mg/mL PI solution, APC-conjugated CD41a antibody, 10 U/mL RNase A, and 0.05% TritonX 100; and incubated for 20 min in the dark. The MMP was measured using the MMP assay kit with JC-1 in accordance with the manufacturer’s recommendations [30]. Cells were seeded into 24-well plates at a density of 5 × 105 cells/well and treated with the abivertinib, Z-VAD-FMK, or staurosporine for 48 h. Cells were then incubated with 5 mg/mL JC-1 at 37 °C for 20 min. The fluorescence signals of the JC-1 aggregates (red) and monomers (green) were measured using a flow cytometer, and the ratio of red to green fluorescence intensities was calculated.

2.9 Total RNA extraction and real-time quantitative PCR

The total RNA from Meg-01 cells was extracted using TRIzol reagent, and the cDNA was synthesized from 0.5 µg total RNA by using PrimeScriptTM RT Master Mix in accordance with the manufacturer’s protocol (TaKaRa Bio, Dalian, China). qPCR was carried out in 96-well PCR plates with a C1000TM Thermal Cycler (Bio-Rad, USA) in 10 mL reactions containing 5 µL SYBR Premix Ex Taq (TaKaRa Bio, Dalian, China), 0.25 µL forward primer (10 pmol/µL), 0.25 µL reverse primer (10 pmol/µL), 1 µL cDNA (100 ng/µL), and 3.5 µL RNase-free water. Thermocycler conditions were standard settings as follows: 95 °C (3 min), 40 cycles of 95 °C (5 s), and 60 °C (30 s). The mRNA expression levels of CD61 and CD41a and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were measured using the following primers: CD61 (forward, GGCTACTACTGCAACTGTAC; reverse, GGAATCTGACGACACAGTCA), CD41a (forward, GCTCCTGGCGGCTATTATTT; reverse, GTTGCTGGAGTCAAAGGAGAG), and GAPDH (forward, ACCACCCTGTTGCTGTAGCCAA; reverse, GTCTCCTCTGACTTCAACAGCG). The fluorescence intensity during the amplification process was monitored using the CFX96TM Real-Time System (Bio-Rad, USA). The relative amounts of CD41a and CD61 mRNA were normalized against that of GAPDH.

2.10 Animals

Five-week-old C57BL/6 mice were obtained from Shanghai SLRC Laboratory (Shanghai, China). All mice (three mice per cage) were allowed to adapt to the laboratory environment for one week. Mice were housed in a pathogen-free environment at standard temperature (22±2 °C) and humidity (50%–65%), and a 12 h dark/light cycle. Mice had free access to standard diet and sterile water and were randomly divided into four groups of six mice: low (80 mg/kg/day), medium (160 mg/kg/day), and high (320 mg/kg/day) doses of abivertinib and control (0.5% CMC). Abivertinib or CMC was administered daily by oral gavage for 11 consecutive days, at which point the mice were sacrificed through cervical dislocation. Blood, spleen tissue, and femurs were collected for further analysis. All animal experimental procedures were reviewed and approved by the Animal Ethics Committee of the First Affiliated Hospital, Zhejiang University School of Medicine.

2.11 Spleen and BM histology

The histology of the spleen and BM was performed as described previously with minor modifications [31]. Spleen and femurs were collected from mice at the end of treatment, fixed in 4% formaldehyde for 24 h, and submerged in 70% ethanol. Bones were further decalcified using the Kristensen’s decalcification solution. Spleen and bones were embedded in paraffin, and samples were sliced into 5 mm thick sections, which were then stained with hematoxylin and eosin (H&E). Ten images per mouse of random H&E slides were counted under a light microscope (20×) to count the number of MKs in femur and spleens.

2.12 TPO assays

The serum TPO concentrations in abivertinib- or CMC-treated mice were determined using commercial quantitative sandwich enzyme-linked immunosorbent assay kits (RayBiotech Inc., USA) in accordance with the manufacturer’s protocol.

2.13 Statistical analysis

All data were presented as mean ± standard deviation. The SPSS software 18 was used for statistical analysis. Differences between groups were assessed using the Student’s t test, whereas comparisons of three or more groups were assessed using the one-way analysis of variance. Differences between values were considered statistically significant at P<0.05 or clearly significant at P<0.01.

3 Results

3.1 Abivertinib impairs CFU-MK formation

We first tested whether abivertinib affected the colony-forming potential of CD34+ HSCs to determine the biological effect of abivertinib on megakaryopoiesis. CD34+ HSCs cultured in the presence or absence of abivertinib for 12 days were subjected to a CFU-MK assay (MegaCultTM-C, StemCell Technologies). Fig. 1A shows representative images illustrating the macroscopic and microscopic appearances of CFU-MKs. Abivertinib reduced the size and the number of CFU-MK colonies (Fig. 1A and 1B) in a dose-dependent manner. The numbers of large (>50 MKs), intermediate (10–50 MKs), and small (5–10 MKs) CFU-MK colonies per slide were 43±12, 20±9, and 8±3, respectively, at 0 mmol/L abivertinib; 26±6, 16±4, 11±5, respectively, at 2.5 mmol/L; and 6±3, 9±4, 28±8, respectively, at 5 mmol/L.

We studied the effects of abivertinib on the proliferation of MK progenitor cells to explore the mechanism involved in the abivertinib-mediated inhibition of the colony-forming ability of MKs. Our previous studies show that abivertinib (1.25–10 mmol/L) did not affect the viability of CD34+ HSCs from cord blood [19]. MK progenitor cells were differentiated from CD34+ HSCs cultured with SCF/IL-3/IL-6/IL-9/TPO. The proliferation of MK progenitor cells was inhibited by abivertinib in a dose-dependent manner (Fig. 1C). After six days of culture with 2.5 or 5 mmol/L abivertinib, the total cell numbers decreased by approximately 25% and 37%, respectively. We performed an apoptosis assay to study whether the abivertinib-mediated inhibition of proliferation could induce apoptosis. On day 12, cells were cos-tained with annexin V and PI, and apoptosis was detected using flow cytometry. Results showed an increase in the apoptosis of the total cell population as the concentration of abivertinib increased (Fig. 1D and 1E). Moreover, we found that the abivertinib-induced apoptosis could be slightly ameliorated by Z-VAD-FMK (Fig. S1A), an inhibitor of apoptosis [32], and remarkably enhanced by staurosporine (Fig. S1A), a well-known inducer of apoptosis [33]. A decline in the MMP is a marker of the early stage of apoptosis [34]. Thus, we further analyzed the MMP of the total cell population. As shown in Fig. S1B, the MMP, as reflected by the fluorescence intensity ratio of aggregate (red) and monomer (green) JC-1, decreased with increasing doses of abivertinib. However, this decline was slightly reversed by Z-VAD-FMK but enhanced by staurosporine (Fig. S1B). Similar results were also obtained with Meg-01 cells (Fig. S1C and S1D). The inhibition of MK colony formation by abivertinib was probably not caused by the cytotoxicity of abivertinib because neither the phosphatase from Meg-01 cells (Fig. 1F) and platelets (Fig. 1G) nor the hemoglobin from erythrocytes (Fig. 1H) was released by abivertinib. Results (Figs. 1 and S1) suggested that abivertinib decreased the CFU-MK formation by inducing apoptosis rather than by increasing cytotoxicity to disrupt the integrity of the cell membrane.

3.2 Abivertinib inhibits CD34+ HSC-derived MK differentiation and functions

MK differentiation was characterized using the CD41a and the CD61 expression levels on the cell membrane and increased DNA content (polyploidization). The levels of CD41a and CD61 on CD34+ HSC-derived MKs were analyzed using flow cytometry to investigate the effect of abivertinib on MK differentiation. CD34+ HSCs were cultured with SCF/IL-3/IL-6/IL-9/TPO in the presence or absence of abivertinib for 12 days. Flow cytometry results (Figs. 2A and S2) showed that abivertinib reduced the expression of CD41a and CD61. Approximately 85%, 75%, and 60% of cells were positive for CD41a and CD61 after treatment with 0, 2.5, and 5 mmol/L abivertinib, respectively (Figs. 2B and S2). We analyzed the MK ploidy by using flow cytometry to further determine whether the abivertinib could inhibit the polyploidization. Results (Fig. 2C and 2D) revealed that increased abivertinib doses increased the percentage of MKs with 2N ploidy and decreased the percentage of MKs with higher ploidy compared with the control, suggesting that the MK ploidy was inhibited by abivertinib. MK functions, including adhesion, spreading, and PPF, were crucial for MK maturation and platelet production. Therefore, we further analyzed the effects of abivertinib on MK adhesion and spreading on immobilized fibrinogen and found that stable adhesion and spreading of MK were inhibited by abivertinib in a dose-dependent manner (Figs. 2E, 3A, and 3B). In addition, microscopic data (Figs. 2E and S3) showed that CD34+ HSC-derived MKs had decreased the DNA content with increasing doses of abivertinib, as evidenced by the decreased nuclear area (Fig. 3C). Similarly, we found that compared with the control, abivertinib could strongly reduce PPF (Fig. 3D and 3E). These results (Figs. 2 and 3) suggested that the abivertinib inhibited MK differentiation and functions, and further analysis should be performed to investigate the mechanism involved in this inhibition.

3.3 Abivertinib inhibits Meg-01-derived MK differentiation

The differentiation of Meg-01 cells, a human megakaryoblastic cell line, can be induced by PMA, a TPO activator or protein kinase C signaling [35,36]. After PMA treatment, Meg-01 cells become larger, exhibit cytoplasmic extensions, and express the MK markers CD41a and CD61 [35]. Meg-01 cells were cultured with 10 nmol/L PMA in the presence or absence of abivertinib for four days to determine whether abivertinib could affect Meg-01-derived MK differentiation. We found that the morphologic features of Meg-01 cells became the most MK-like in the absence of abivertinib in a time-dependent manner. Morphologic features of MKs, such as cytoplasmic extensions and lobulated nuclei, were present in the absence of the abivertinib (Figs. 4A–4C, S4, and S5). MK-like cells were less common with increasing doses of abivertinib, which suggested that the abivertinib inhibited the Meg-01-derived MK differentiation. Notably, the IC50 values for abivertinib at 24, 48, 72, and 96 h in Meg-01 cells were 7.19, 1.605, 1.699, and 1.237 mmol/L, respectively.

We quantified the inhibitory effects of abivertinib on differentiation by assessing the expression levels of CD41a and CD61 via RT-qPCR. Results showed that the expression levels of CD41a and CD61 in PMA-induced Meg-01 cells was inhibited by abivertinib in a dose-dependent manner (Fig. 4D and 4E).

3.4 Abivertinib decreases MK and platelet counts in mice

Abivertinib or CMC was administered to mice via oral gavage daily for 11 consecutive days to further evaluate the effect of abivertinib on thrombopoiesis in vivo. First, we evaluated the effects of abivertinib on platelet production in mice. Abivertinib decreased platelet counts in a dose-dependent manner (Fig. 5A). We observed a 6%, 14%, and 19% decrease in platelet counts on day 11 in the low-, medium-, and high-dose groups, respectively, compared with the CMC control group. However, we found that the TPO concentrations in the plasma in mice were not altered by abivertinib (Fig. 5B). Second, the femurs and spleens of mice were collected for analysis. Consistent with low platelet counts, H&E staining of BM sections revealed that mice had a lower number of MKs in BM with increasing concentrations of abivertinib (Fig. 5C and 5D). However, no difference was observed in MK counts in spleen sections (Fig. 5E and 5F).

4 Discussion

Abivertinib is a third-generation pyrimidine-based EGFR tyrosine kinase inhibitor originally designed to overcome the resistance of EGFR-activating and T790M-acquired mutations [9]. In animal safety studies and a phase I dose escalation study of patients with NSCLC (NCT02274337), the abivertinib does not cause severe off-target effects [9,10]. However, abivertinib exhibits high inhibitory activity against Tec family members and Jak3 in kinase activity assays [9]. The IC50 values of abivertinib against EGFR, EGFR (L858R/T790M), Btk, and Jak3 from the enzyme activity assay are 7.68, 0.18, 0.40, and 0.09 nmol/L, respectively [9]. Our previous study shows that abivertinib can effectively inhibit MCL and AML cell growth by attenuating the BCR–Btk pathway [16,19]. Jak3 and Tec family members are essential for megakaryopoiesis and platelet production [1114]. Btk inhibitors, such as ibrutinib, induce grades 3 to 4 thrombocytopenia in 2% to 17% of ibrutinib-treated patients [15,3739], which may be through affecting megakaryopoiesis [27]. Therefore, this project aims to investigate whether abivertinib affects MK differentiation and platelet biogenesis. Our major findings are as follows: abivertinib (1) impairs CFU-MK formation, (2) inhibits the differentiation of CD34+ HSC- and Meg-01-derived MKs and the functions of CD34+ HSC-derived MKs, and (3) decreases MK and platelet counts in mice.

In addition to their roles in thrombosis and hemostasis, platelets are known as important players in other pathophysiological processes, including atherogenesis, inflammation, and tumor metastasis [40]. The platelet count is a contributor to these pathophysiological processes. The fine regulation of platelet production and sequestration/destruction is critical to maintain steady platelet counts. The processes of megakaryopoiesis and thrombopoiesis can affect platelet production. Megakaryopoiesis is a continuous process that starts with the commitment of HSCs to the MK lineage, involves the proliferation of progenitor cells and MK maturation, and ends with PPF and platelet release. Patients with myeloproliferative neoplasms, including ET and primary myelofibrosis, are frequently associated with upregulation or malignant activation of megakaryopoiesis/thrombopoiesis with alterations in the platelet count [41,42]. In addition to genetic alterations [43], external agents, such as eltrombopag [6], decitabine [7], ibrutinib [27], and anagrelide [8], have been reported to affect platelet biogenesis [44]. Here, we have found that abivertinib inhibits MK differentiation and decreases platelet biogenesis in MK and mouse models. However, the molecular mechanism by which abivertinib inhibits platelet biogenesis has not been elucidated yet. No EGFR-activating mutation is observed in cord blood CD34+ HSCs, Meg-01 cells, or C57BL/6 mice. Abivertinib has one high inhibitory activity against Btk and Jak3 [9]. Given that these kinases play some roles in platelet biogenesis [1114], we speculate that platelet biogenesis is impaired by abivertinib, which may be due to the inhibition of Jak3 and Tec family members.

Jak2, a member of the Jak family, is important in controlling platelet biogenesis [42]. Jak3, another member, has recently been shown to regulate megakaryopoiesis [11]. Tofacitinib, a Jak3 inhibitor, inhibits IL-21-induced megakaryopoiesis [11]. Btk is a promising therapeutic target for the treatment of autoimmune disorders and hematological malignancies [45,46]. However, the roles of Btk in platelet biogenesis remain controversial. Some studies demonstrate that normal numbers of platelets are present in Btk/Tec double-knockout mice [47] and in patients with XLA [48], suggesting that Btk is dispensable for MK development and maturation. Data from the International Mouse Phenotyping Consortium show increased platelet counts in female homozygous for a Btk knockout allele. MKs from Btk-deficient mice display reduced intracellular Ca2+ mobilization [49,50], and Btk inhibitors, such as ibrutinib and acalabrutinib, are associated with the incidence of thrombocytopenia and bleeding complications [15,51]. Recent studies have revealed that Btk inhibitors have off-target inhibitory effects on other kinases, including EGFR, ITK, Jak3, and Tec kinase, partially explaining the bleeding side effects seen with these drugs [52,53], but the cause of the decreased platelet count reported in patients on these inhibitors remains unresolved.

Ibrutinib, a first-generation inhibitor of Btk, is associated with an increased incidence of thrombocytopenia [54]. Acalabrutinib, a second-generation inhibitor of Btk, can also cause thrombocytopenia in patients with MCL [55]. However, to date, the mechanism of Btk inhibitor-related thrombocytopenia is unknown. In our previous study, we have demonstrated that early megakaryopoiesis, not proplatelet formation, is inhibited by ibrutinib [27]. To the best of our knowledge, reports about the effects of Btk inhibitors on MKs are unavailable. In this study, our results demonstrate that abivertinib, which is clinically used to treat patients with B cell-related malignancies and NSCLC [9,19,20], has three major effects on MKs. First, abivertinib induces apoptosis, inhibits MK progenitor proliferation, and reduces CFU-MK formation (Figs. 1 and S1). Second, abivertinib impairs MK differentiation and ploidy (Figs. 2 and S2–S5). Third, abivertinib inhibits the adhesion and spreading of MKs on fibrinogen and PPF (Figs. 2 and S3–S5). These results suggest that abivertinib inhibits megakaryopoiesis and MK differentiation. The decrease in platelet counts in mice treated with abivertinib suggests that thrombopoiesis is also inhibited by abivertinib (Fig. 5). The drop in platelet counts is modest but significant in mice that have received abivertinib (Fig. 5A). Nevertheless, a reduction of this nature is likely not a significant concern in patients treated with abivertinib. In a phase I study of abivertinib in patients with NSCLC, Ma et al. have reported that grade ≥3 thrombocytopenia does not occur in all patients treated with abivertinib (n = 52) [10]. In addition, MK numbers in the BM of mice treated with a high dose of abivertinib have decreased by almost 50% (Fig. 5D), but the maximum drop in platelet count is under 20% (Fig. 5A). Further investigation needs to be performed to explain the inconsistency in MK and platelet counts. MK lineage expansion with increased numbers of mature MKs and increased thrombopoiesis represent key features, leading to thrombocythemia in ET [56]. We show that abivertinib inhibits platelet biogenesis by inhibiting megakaryopoiesis and thrombopoiesis, which are deregulated in myeloproliferative disorders. Thus, these preclinical data collectively indicate that abivertinib may be an agent to combat thrombocythemia.

This study had several shortcomings. First, we were unable to address the effect of abivertinib on megakaryopoiesis in MKs from the BM of primates/humans, particularly from patients with thrombocythemia. Second, although we confirmed through light microscopy under static conditions that abivertinib decreased PPF, we were incapable of addressing PPF and platelet production under flow conditions and in three-dimensional systems in vitro or in vivo. Third, we could not investigate the effects of abivertinib on platelet function and lifespan. Fourth, the mechanism by which abivertinib inhibited MK differentiation and platelet biogenesis was not extensively addressed in this study. Proteomics, phosproteomics, and transcriptomics might provide tools to reveal the precise molecular mechanisms responsible for abivertinib-mediated inhibition of MK differentiation and platelet biogenesis. Dealing with these problems will be the goals of our future experiments.

References

[1]

Huang J, Li X, Shi X, Zhu M, Wang J, Huang S, Huang X, Wang H, Li L, Deng H, Zhou Y, Mao J, Long Z, Ma Z, Ye W, Pan J, Xi X, Jin J. Platelet integrin aIIbb3: signal transduction, regulation, and its therapeutic targeting. J Hematol Oncol 2019; 12(1): 26

[2]

van der Meijden PEJ, Heemskerk JWM. Platelet biology and functions: new concepts and clinical perspectives. Nat Rev Cardiol 2019; 16(3): 166–179

[3]

Zhang W, Zha C, Lu X, Jia R, Gao F, Sun Q, Jin M, Liu Y. Anti-b2GPI/b2GPI complexes induce platelet activation and promote thrombosis via p38MAPK: a pathway to targeted therapies. Front Med 2019; 13(6): 680–689

[4]

Lefrançais E, Ortiz-Muñoz G, Caudrillier A, Mallavia B, Liu F, Sayah DM, Thornton EE, Headley MB, David T, Coughlin SR, Krummel MF, Leavitt AD, Passegué E, Looney MR. The lung is a site of platelet biogenesis and a reservoir for haematopoietic progenitors. Nature 2017; 544(7648): 105–109

[5]

Espasandin YR, Glembotsky AC, Grodzielski M, Lev PR, Goette NP, Molinas FC, Marta RF, Heller PG. Anagrelide platelet-lowering effect is due to inhibition of both megakaryocyte maturation and proplatelet formation: insight into potential mechanisms. J Thromb Haemost 2015; 13(4): 631–642

[6]

Di Buduo CA, Currao M, Pecci A, Kaplan DL, Balduini CL, Balduini A. Revealing eltrombopag’s promotion of human megakaryopoiesis through AKT/ERK-dependent pathway activation. Haematologica 2016; 101(12): 1479–1488

[7]

Wang J, Yi Z, Wang S, Li Z. The effect of decitabine on megakaryocyte maturation and platelet release. Thromb Haemost 2011; 106(2): 337–343

[8]

Thiele J, Kvasnicka HM, Schmitt-Graeff A. Effects of anagrelide on megakaryopoiesis and platelet production. Semin Thromb Hemost 2006; 32(4 Pt 2): 352–361

[9]

Xu X, Mao L, Xu W, Tang W, Zhang X, Xi B, Xu R, Fang X, Liu J, Fang C, Zhao L, Wang X, Jiang J, Hu P, Zhao H, Zhang L. AC0010, an irreversible EGFR inhibitor selectively targeting mutated EGFR and overcoming T790M-induced resistance in animal models and lung cancer patients. Mol Cancer Ther 2016; 15(11): 2586–2597

[10]

Ma Y, Zheng X, Zhao H, Fang W, Zhang Y, Ge J, Wang L, Wang W, Jiang J, Chuai S, Zhang Z, Xu W, Xu X, Hu P, Zhang L. First-in-human phase I study of AC0010, a mutant-selective EGFR inhibitor in non-small cell lung cancer: safety, efficacy, and potential mechanism of resistance. J Thorac Oncol 2018; 13(7): 968–977

[11]

Benbarche S, Strassel C, Angénieux C, Mallo L, Freund M, Gachet C, Lanza F, de la Salle H. Dual role of IL-21 in megakaryopoiesis and platelet homeostasis. Haematologica 2017; 102(4): 637–646

[12]

Yamashita Y, Miyazato A, Shimizu R, Komatsu N, Miura Y, Ozawa K, Mano H. Tec protein-tyrosine kinase is involved in the thrombopoietin/c-Mpl signaling pathway. Exp Hematol 1997; 25(3): 211–216

[13]

Avraham H, Price DJ. Regulation of megakaryocytopoiesis and platelet production by tyrosine kinases and tyrosine phosphatases. Methods 1999; 17(3): 250–264

[14]

Sangkhae V, Saur SJ, Kaushansky A, Kaushansky K, Hitchcock IS. Phosphorylated c-Mpl tyrosine 591 regulates thrombopoietin-induced signaling. Exp Hematol 2014; 42(6): 477–486.e4

[15]

Wang ML, Blum KA, Martin P, Goy A, Auer R, Kahl BS, Jurczak W, Advani RH, Romaguera JE, Williams ME, Barrientos JC, Chmielowska E, Radford J, Stilgenbauer S, Dreyling M, Jedrzejczak WW, Johnson P, Spurgeon SE, Zhang L, Baher L, Cheng M, Lee D, Beaupre DM, Rule S. Long-term follow-up of MCL patients treated with single-agent ibrutinib: updated safety and efficacy results. Blood 2015; 126(6): 739–745

[16]

Yan X, Zhou Y, Huang S, Li X, Yu M, Huang J, Wang J, Ma Z, Jin J, Pan J, Li C, Li F, Jin J. Promising efficacy of novel BTK inhibitor AC0010 in mantle cell lymphoma. J Cancer Res Clin Oncol 2018; 144(4): 697–706

[17]

Huang S, Yu M, Shi N, Zhou Y, Li F, Li X, Huang X, Jin J. Apigenin and abivertinib, a novel BTK inhibitor synergize to inhibit diffuse large B-cell lymphoma in vivo and vitro. J Cancer 2020; 11(8): 2123–2132

[18]

Huang S, Li C, Zhang X, Pan J, Li F, Lv Y, Huang J, Ling Q, Ye W, Mao S, Huang X, Jin J. Abivertinib synergistically strengthens the anti-leukemia activity of venetoclax in acute myeloid leukemia in a BTK-dependent manner. Mol Oncol 2020; 14(10): 2560–2573

[19]

Huang S, Pan J, Jin J, Li C, Li X, Huang J, Huang X, Yan X, Li F, Yu M, Hu C, Jin J, Xu Y, Ling Q, Ye W, Wang Y, Jin J. Abivertinib, a novel BTK inhibitor: anti-leukemia effects and synergistic efficacy with homoharringtonine in acute myeloid leukemia. Cancer Lett 2019; 461: 132–143

[20]

Yang M, Qian J, Huang J, Jiao Y, Tang W, Xu X, Xu W, Luo FR, Jin J. A phase I study of the BTK inhibitor abivertinib (AC0010) in patients with relapsed or refractory B-cell lymphoma. HemaSphere 2019; 3(S1): 210 doi: 10.1097/01.HS9.0000560160.25056.77

[21]

Ogura M, Morishima Y, Ohno R, Kato Y, Hirabayashi N, Nagura H, Saito H. Establishment of a novel human megakaryoblastic leukemia cell line, MEG-01, with positive Philadelphia chromosome. Blood 1985; 66(6): 1384–1392

[22]

Hearn JI, Green TN, Chopra M, Nursalim YNS, Ladvanszky L, Knowlton N, Blenkiron C, Poulsen RC, Singleton DC, Bohlander SK, Kalev-Zylinska ML. N-methyl-D-aspartate receptor hypofunction in Meg-01 cells reveals a role for intracellular calcium homeostasis in balancing megakaryocytic-erythroid differentiation. Thromb Haemost 2020; 120(4): 671–686

[23]

Su X, Mi J, Yan J, Flevaris P, Lu Y, Liu H, Ruan Z, Wang X, Kieffer N, Chen S, Du X, Xi X. RGT, a synthetic peptide corresponding to the integrin b3 cytoplasmic C-terminal sequence, selectively inhibits outside-in signaling in human platelets by disrupting the interaction of integrin aIIbb3 with Src kinase. Blood 2008; 112(3): 592–602 doi:10.1182/blood-2007-09-110437

[24]

Yin H, Litvinov RI, Vilaire G, Zhu H, Li W, Caputo GA, Moore DT, Lear JD, Weisel JW, Degrado WF, Bennett JS. Activation of platelet αIIbβ3 by an exogenous peptide corresponding to the transmembrane domain of αIIb. J Biol Chem 2006; 281(48): 36732–36741

[25]

Liu D, DeGrado WF. De novo design, synthesis, and characterization of antimicrobial b-peptides. J Am Chem Soc 2001; 123(31): 7553–7559

[26]

Perdomo J, Yan F, Leung HHL, Chong BH. Megakaryocyte differentiation and platelet formation from human cord blood-derived CD34+ cells. J Vis Exp 2017; 130(130): e56420

[27]

Huang J, Huang S, Ma Z, Lin X, Li X, Huang X, Wang J, Ye W, Li Y, He D, Yang M, Pan J, Ling Q, Li F, Mao S, Wang H, Wang Y, Jin J. Ibrutinib suppresses early megakaryopoiesis but enhances proplatelet formation. Thromb Haemost 2021;121(2):192–205

[28]

Salzmann M, Hoesel B, Haase M, Mussbacher M, Schrottmaier WC, Kral-Pointner JB, Finsterbusch M, Mazharian A, Assinger A, Schmid JA. A novel method for automated assessment of megakaryocyte differentiation and proplatelet formation. Platelets 2018; 29(4): 357–364

[29]

Li X, Yin X, Wang H, Huang J, Yu M, Ma Z, Li C, Zhou Y, Yan X, Huang S, Jin J. The combination effect of homoharringtonine and ibrutinib on FLT3-ITD mutant acute myeloid leukemia. Oncotarget 2017; 8(8): 12764–12774

[30]

Du X, Yin S, Zhou F, Du X, Xu J, Gu X, Wang G, Li J. Reduction-sensitive mixed micelles for selective intracellular drug delivery to tumor cells and reversal of multidrug resistance. Int J Pharm 2018; 550(1-2): 1–13

[31]

Yang Y, Akada H, Nath D, Hutchison RE, Mohi G. Loss of Ezh2 cooperates with Jak2V617F in the development of myelofibrosis in a mouse model of myeloproliferative neoplasm. Blood 2016; 127(26): 3410–3423

[32]

Zheng J, Wang SS, Shen KP, Huang XW, Li M, Chen L, Peng X, An HM, Hu B. Ursolic acid potentiated oxaliplatin to induce apoptosis in colorectal cancer RKO cells. Pharmazie 2020; 75(6): 246–249 doi: 10.1691/ph.2020.0417

[33]

Belmokhtar CA, Hillion J, Ségal-Bendirdjian E. Staurosporine induces apoptosis through both caspase-dependent and caspase-independent mechanisms. Oncogene 2001; 20(26): 3354–3362

[34]

Zhang W, Lu Y, Zhen T, Chen X, Zhang M, Liu P, Weng X, Chen B, Wang Y. Homoharringtonine synergy with oridonin in treatment of t(8;21) acute myeloid leukemia. Front Med 2019; 13(3): 388–397

[35]

Miyashita N, Onozawa M, Yokoyama S, Hidaka D, Hayasaka K, Kunishima S, Teshima T. Anagrelide modulates proplatelet formation resulting in decreased number and increased size of platelets. Hemasphere 2019; 3(4): e268

[36]

Lopez JJ, Palazzo A, Chaabane C, Albarran L, Polidano E, Lebozec K, Dally S, Nurden P, Enouf J, Debili N, Bobe R. Crucial role for endoplasmic reticulum stress during megakaryocyte maturation. Arterioscler Thromb Vasc Biol 2013; 33(12): 2750–2758

[37]

Thorp BC, Badoux X. Atrial fibrillation as a complication of ibrutinib therapy: clinical features and challenges of management. Leuk Lymphoma 2018; 59(2): 311–320

[38]

Burger JA, Tedeschi A, Barr PM, Robak T, Owen C, Ghia P, Bairey O, Hillmen P, Bartlett NL, Li J, Simpson D, Grosicki S, Devereux S, McCarthy H, Coutre S, Quach H, Gaidano G, Maslyak Z, Stevens DA, Janssens A, Offner F, Mayer J, O’Dwyer M, Hellmann A, Schuh A, Siddiqi T, Polliack A, Tam CS, Suri D, Cheng M, Clow F, Styles L, James DF, Kipps TJ; RESONATE-2 Investigators. Ibrutinib as initial therapy for patients with chronic lymphocytic leukemia. N Engl J Med 2015; 373(25): 2425–2437

[39]

Treon SP, Tripsas CK, Meid K, Warren D, Varma G, Green R, Argyropoulos KV, Yang G, Cao Y, Xu L, Patterson CJ, Rodig S, Zehnder JL, Aster JC, Harris NL, Kanan S, Ghobrial I, Castillo JJ, Laubach JP, Hunter ZR, Salman Z, Li J, Cheng M, Clow F, Graef T, Palomba ML, Advani RH. Ibrutinib in previously treated Waldenström’s macroglobulinemia. N Engl J Med 2015; 372(15): 1430–1440

[40]

Gremmel T, Frelinger AL 3rd, Michelson AD. Platelet physiology. Semin Thromb Hemost 2016; 42(3): 191–204

[41]

Wen Q, Goldenson B, Crispino JD. Normal and malignant megakaryopoiesis. Expert Rev Mol Med 2011; 13: e32

[42]

Bianchi E, Norfo R, Pennucci V, Zini R, Manfredini R. Genomic landscape of megakaryopoiesis and platelet function defects. Blood 2016; 127(10): 1249–1259

[43]

Songdej N, Rao AK. Hematopoietic transcription factor mutations: important players in inherited platelet defects. Blood 2017; 129(21): 2873–2881

[44]

Roweth HG, Parvin S, Machlus KR. Megakaryocyte modification of platelets in thrombocytopenia. Curr Opin Hematol 2018; 25(5): 410–415

[45]

Akinleye A, Chen Y, Mukhi N, Song Y, Liu D. Ibrutinib and novel BTK inhibitors in clinical development. J Hematol Oncol 2013; 6(1): 59

[46]

Busygina K, Denzinger V, Bernlochner I, Weber C, Lorenz R, Siess W. Btk inhibitors as first oral atherothrombosis-selective antiplatelet drugs? Thromb Haemost 2019; 119(8): 1212–1221

[47]

Atkinson BT, Ellmeier W, Watson SP. Tec regulates platelet activation by GPVI in the absence of Btk. Blood 2003; 102(10): 3592–3599

[48]

Futatani T, Watanabe C, Baba Y, Tsukada S, Ochs HD. Bruton’s tyrosine kinase is present in normal platelets and its absence identifies patients with X-linked agammaglobulinaemia and carrier females. Br J Haematol 2001; 114(1): 141–149

[49]

Pasquet JM, Quek L, Stevens C, Bobe R, Huber M, Duronio V, Krystal G, Watson SP. Phosphatidylinositol 3,4,5-trisphosphate regulates Ca2+ entry via btk in platelets and megakaryocytes without increasing phospholipase C activity. EMBO J 2000; 19(12): 2793–2802

[50]

Bobe R, Wilde JI, Maschberger P, Venkateswarlu K, Cullen PJ, Siess W, Watson SP. Phosphatidylinositol 3-kinase-dependent translocation of phospholipase Cγ2 in mouse megakaryocytes is independent of Bruton tyrosine kinase translocation. Blood 2001; 97(3): 678–684

[51]

Markham A, Dhillon S. Acalabrutinib: first global approval. Drugs 2018; 78(1): 139–145

[52]

Series J, Garcia C, Levade M, Viaud J, Sié P, Ysebaert L, Payrastre B. Differences and similarities in the effects of ibrutinib and acalabrutinib on platelet functions. Haematologica 2019; 104(11): 2292–2299

[53]

Bye AP, Unsworth AJ, Vaiyapuri S, Stainer AR, Fry MJ, Gibbins JM. Ibrutinib inhibits platelet integrin aIIbb3 outside-in signaling and thrombus stability but not adhesion to collagen. Arterioscler Thromb Vasc Biol 2015; 35(11): 2326–2335

[54]

Lipsky AH, Lozier JN, Wiestner A. Response to comment on incidence and risk factors of bleeding-related adverse events in patients with chronic lymphocytic leukemia treated with ibrutinib. Haematologica 2016; 101(3): e124–e125

[55]

Kriegsmann K, Kriegsmann M, Witzens-Harig M. Acalabrutinib, a second-generation Bruton’s tyrosine kinase inhibitor. Recent Results Cancer Res 2018; 212: 285–294

[56]

Balduini A, Badalucco S, Pugliano MT, Baev D, De Silvestri A, Cattaneo M, Rosti V, Barosi G. In vitro megakaryocyte differentiation and proplatelet formation in Ph-negative classical myeloproliferative neoplasms: distinct patterns in the different clinical phenotypes. PLoS One 2011; 6(6): e21015

RIGHTS & PERMISSIONS

Higher Education Press

PDF (1869KB)

Supplementary files

FMD-20089-OF-JJ_suppl_1

2955

Accesses

0

Citation

Detail

Sections
Recommended

/