Repression of CDKN2C caused by PML/RARα binding promotes the proliferation and differentiation block in acute promyelocytic leukemia

Abstract

Inappropriate cell proliferation during oncogenesis is often accompanied by inactivation of components involved in the cell cycle machinery. Here, we report that cyclin-dependent kinase inhibitor 2C (CDKN2C) as a member of the cyclin-dependent kinase inhibitors is a target of the PML/RARα oncofusion protein in leukemogenesis of acute promyelocytic leukemia (APL). We found that CDKN2C was markedly downregulated in APL blasts compared with normal promyelocytes. Chromatin immunoprecipitation combined with quantitative polymerase chain reaction demonstrated that PML/RARα directly bound to the CDKN2C promoter in the APL patient-derived cell line NB4. Luciferase assays indicated that PML/RARα inhibited the CDKN2C promoter activity in a dose-dependent manner. Furthermore, all-trans retinoic acid treatment induced CDKN2C expression by releasing the PML/RARα binding on chromatin in NB4 cells. Functional studies showed that ectopic expression of CDKN2C induced a cell cycle arrest at the G₀/G₁ phase and a partial differentiation in NB4 cells. Finally, the transcriptional regulation of CDKN2C was validated in primary APL patient samples. Collectively, this study highlights the importance of CDKN2C inactivation in the abnormal cell cycle progression and differentiation block of APL cells and may provide new insights into the study of pathogenesis and targeted therapy of APL.

Keywords

CDKN2C / acute promyelocytic leukemia / cell cycle arrest / differentiation

Introduction

Acute promyelocytic leukemia (APL) represents a remarkable cancer model that can be converted from highly fatal to nearly curable by targeted therapies [ 1– 4]. This malignancy is characterized by a typical t(15;17)(q22;q21) chromosomal translocation generating an oncogenic fusion gene between the promyelocytic leukemia (PML) gene and the retinoic acid receptor α (RARα) gene (PML/RARα). PML/RARα is believed to be the initiating factor for the leukemogenesis of APL through blocking differentiation at the promyelocytic stage and prompting inappropriate cell growth [ 4]. These differentiation and proliferation abnormalities are mostly ascribed to the transcriptional repressor role of PML/RARα by suppressing the expression of a series of target genes [ 5– 7]. Furthermore, the combination therapy with all-trans retinoic acid (ATRA) and arsenic trioxide effectively induces myeloid differentiation and cell cycle arrest of APL cells through reactivating these repressed genes. Therefore, the identification of PML/RARα target genes is helpful to elucidate important pathways involved in the pathogenesis and treatment of APL. However, the transcriptional deregulation mechanisms of PML/RARα to cell cycle regulators are yet to be clearly identified.

A hallmark of human malignancies, including leukemia, is uncontrolled cell proliferation because of abnormal cell cycle regulation. The regulation of cell cycle progression is strictly regulated by the activity of cyclins, cyclin-dependent kinases (CDKs), and CDK inhibitors (CKIs). The CDKs are negatively regulated by two families of CKIs, i.e., the INK4 family (CDKN2A, CDKN2B, CDKN2C, and CDKN2D) and the CIP/KIP family (CDKN1A, CDKN1B, and CDKN1C) [ 8]. Different members of CKIs can mediate separate pathways to negatively regulate CDKs to control the cell cycle progression [ 9– 11]. Accordingly, multiple components of CKIs are affected during the malignant transformation [ 12– 14]. CDKN1A has been reported to be a target gene of PML/RARα in the pathogenesis of APL [ 15]. The expression of CDNK1A is inactivated due to the repression of PML/RARα and its expression can be restored by ATRA treatment. Recently, we have shown that PML/RARα can directly bind to the promoter of CDKN2D to repress its transcription, and restoration of CDKN2D expression in APL cells induces cell cycle arrest at G₀/G₁ phase and a partial granulocytic differentiation [ 16]. These observations implicate that the deregulation of CKIs by PML/RARα might be important in the disruption of cell cycle progression in APL. Whether additional members of CKIs are dysregulated by PML/RARα in APL pathogenesis is yet to be clarified.

The genome-wide profiling of PML/RARα targets is a valuable resource to identify the potential important CKIs dysregulated by PML/RARα in APL. Our recent studies on the genome-wide analysis of PML/RARα target genes in APL cells implicate that CDKN2C is a particularly promising candidate [ 5]. CDKN2C (encoding p18INK4C) as one member of the INK4 family negatively regulates the cell cycle progression by inhibiting the kinase activities of CDK4 and CDK6 and blocking the G₁-S phase transition [ 17]. Thus, the loss of CDKN2C is generally associated with enhanced proliferation and increased cellularity affecting different tissue and organismal development (i.e., the spleen and thymus) [ 18]. CDKN2C is also recognized as a candidate tumor suppressor gene and its inactivation can increase the incidence of tumorigenesis [ 19, 20]. CDKN2C inactivation is critical for the initiation and progression of multiple myeloma because of the loss of its function in inhibiting cell cycle progression [ 21]. Therefore, the potential dysregulation of CDKN2C by PML/RARα may be involved in the pathogenesis of APL.

In this study, we investigated the transcriptional regulation and function of CDKN2C in the pathogenesis and treatment of APL. We found that CDKN2C was a direct target gene of PML/RARα. CDKN2C expression was inhibited by PML/RARα and ATRA treatment reactivatied CDKN2C expression in the APL patient-derived cell line NB4. Moreover, forced expression of CDKN2C in APL induced a partial cell differentiation and cell cycle arrest. Finally, these observations were validated in primary APL samples. Collectively, our findings suggest that CDKN2C inactivation contributes to the leukemogenesis in APL.

Materials and methods

Cell culture

HEK-293T (293T) cells were cultured in DMEM (Gibco, Carlsbad, CA, USA) containing 10% fetal bovine serum (Gibco). U937 and NB4 cells were cultured in RPMI 1640 (Gibco) containing 10% fetal bovine serum (Gibco) [ 16]. All cell lines were maintained at 37 °C in a humidified atmosphere with 5% CO₂. ATRA (Sigma, St. Louis, MO, USA) was used at a final concentration of 1 mmol/L. Cycloheximide (CHX) (Xiya Reagent, Chengdu, China) was used at a final concentration of 10 mg/ml.

Plasmid construction

Total RNA was isolated using the RNeasy Protect Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. Approximately 2 mg of total RNA was reversed into cDNA by using the SuperScript III Reverse Transcriptase Kit (Invitrogen, Carlsbad, CA, USA). We used the cDNA of NB4 cells to amplify the coding region of PML/RARα for constructing the MigR1-PML/RARα plasmid. We then cloned cDNA into the MigR1 vector between the BglII and EcoRI sites. We extracted the genomic DNA of NB4 using the Genomic DNA Kit (Tiangen, Beijing, China) according to the manufacturer’s instructions to construct the pGL3-CDKN2C plasmid. We amplified the promoter region of CDKN2C using genomic DNA of NB4 cells and then cloned into the pGL3-basic vector between the XhoI and HindIII sites. Primer sequences are as follows:

MigR1-PML/RARα forward: 5′ GAAGATCTATGGAGCCTGCACCCGCC 3′

MigR1-PML/RARα reverse: 5′ CGGAATTCTCACGGGGAGTGGGTGGC 3′

pGL3-CDKN2C forward: 5′ CCCTCGAGGAACTTGGCCTACGTTTCCC 3′

pGL3-CDKN2C reverse: 5′ CCAAGCTTTGAGGAGTGTGTGTGGAGAC 3′

Retroviral transfection

HEK-293T cells were transfected with the MigR1 empty vector or the MigR1-PML/RARα expression plasmid using Lipofectamine 2000 (Invitrogen). The medium was changed after 6 h. The supernatants containing the retrovirus were collected and titered using NIH-3T3 cells 48 h after transfection.

U937 cells were seeded at 2 × 10⁵ cells/well into a six-well plate. Appropriate amounts of viral supernatants and 8 mg/ml polybrene (Sigma) were added to U937 cells. Retroviral transfection was carried out by centrifuging the plate at 1200 ×g at 37 °C for 90 min. The green fluorescent protein (GFP)-positive cells were sorted by fluorescence-activated cell-sorting (FACS) five days after infection.

Reverse transcription polymerase chain reaction (RT-PCR) and quantitative RT-PCR (qRT-PCR)

RT-PCR was performed using the Phanta Max Super-Fidelity DNA polymerase (Vazyme, Nanjing, China) according to the manufacturer’s instructions. qRT-PCR assays were performed using the Power SYBR Green PCR Kit (Toyobo, Osaka, Japan) on ABI ViiA 7 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The relative expression level of each gene was calculated as 2^{−[Ct (Gene)−Ct (GAPDH)]}. Each assay was performed in triplicate. Primer sequences are as follows:

PML/RARα (for RT-PCR) forward: 5′ CCGATGGCTTCGACGAGTTC 3′

PML/RARα (for RT-PCR) reverse: 5′ CTCACAGGCGCTGACCCCAT 3′

CDKN2C (for RT-PCR) forward: 5′ ATGGCCGAGCCTTGGGG 3′

CDKN2C (for RT-PCR) reverse: 5′ TTATTGAAGATTTGTGGCTCCCCC 3′

GAPDH forward: 5′ CTGGGCTACACTGAGCACC 3′

GAPDH reverse: 5′ AAGTGGTCGTTGAGGGCAATG 3′

CDKN2C (for qRT-PCR) forward: 5′ AGTTTGTTGCAAAATAATGTAA 3′

CDKN2C (for qRT-PCR) reverse: 5′ AGTCTGTAAAGTGTCCAGGA 3′

Western blot

Total protein was extracted using the radioimmunoprecipitation assay lysis buffer (high) (Beyotime, Beijing, China). Then, the concentrations of total protein were detected by the Bio-Rad DC Protein Assay (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. Western blot was conducted as previously described [ 22] using anti-p18 (2896, Cell Signaling Technology, Beverly, MA, USA), anti-RARα (C-20X, Santa Cruz Biotechnology, Santa Cruz, CA, USA), and anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (60004-1-1g, Proteintech, Chicago, IL, USA) antibodies.

Transient transfection and luciferase reporter assays

HEK-293T cells were plated in 48-well plates at 0.5 × 10⁵ cells/well for 24 h before transfection. Lipofectamine 2000 (Invitrogen) was used for transfecting plasmids into HEK-293T cells. Cells were harvested two days after transfection for luciferase assays using the Dual-luciferase Reporter Assay System (Promega, Madison, WI, USA). The renilla luciferase pRL-SV40 plasmid was used as an internal control for transfection efficiency.

Chromatin immunoprecipitation combined with quantitative PCR (ChIP-qPCR)

ChIP was performed in NB4 cells according to the manufacturer’s protocol (Active Motif, Carlsbad, CA, USA) using anti-PML antibody (H-238X, Santa Cruz Biotechnology), anti-RARα antibody (C-20X, Santa Cruz Biotechnology), and normal rabbit IgG (2729, Cell Signaling Technology). Quantitative PCR was performed using the Power SYBR Green PCR Kit (Toyobo) on the ABI ViiA 7 Real-Time PCR System (Applied Biosystems). Each assay was performed in triplicate. Primer sequences are as follows:

CDKN2C (for ChIP-qPCR) forward: 5′ TGAACGAGCTCGGTCGTAGG 3′

CDKN2C (for ChIP-qPCR) reverse: 5′ AGCCCGAGGAAGGAGAGTGA 3′

Negative primers forward: 5′ TCTAAGGGGCAGCCTGATGT 3′

Negative primers reverse: 5′ TCCTTCGCAAGGAAAAGAGC 3′

Cell cycle and granulocytic differentiation analysis

The granulocytic differentiation of NB4 cell was performed as described previously [ 16]. For cell cycle analysis, GFP-positive NB4 cells were sorted by FACS three days after retroviral transduction and then cultured for another 24 h. The cell cycle analysis was performed as previously described [ 23].

Statistics

Two-tailed t-tests were used to validate the significance of the data.

Results

Repression of CDKN2C by PML/RARα in APL cells

To investigate the relationship of CDKN2C expression and the PML/RARa fusion protein, we first compared the expression level of CDKN2C between APL patient samples and normal granulocytes. Using the transcriptome data set performed by Payton et al. (GSE12662) [ 24], we compared CDKN2C expression between 14 APL patients and 5 normal promyelocytes. As shown in Fig. 1A, the expression level of CDKN2C was significantly lower in APL cells than that in normal promyelocytes.

The PML/RARα fusion protein is generally recognized as the initiating factor in the pathogenesis of APL by dysregulating its target genes. However, the downregulation of CDKN2C by PML/RARα needs to be clarified. Thus, we performed RT-PCR assays to compare the expression level of CDKN2C in the absence or presence of PML/RARα in U937 cells, a PML/RARα-negative leukemia cell line. We transduced U937 cells with a retrovirus PML/RARα expression plasmid or the retrovirus empty vector and detected the expression of PML/RARα and CDKN2C after transduction. As shown in Fig. 1B, we observed that the mRNA level of CDKN2C was severely reduced when PML/RARα was overexpressed in U937 cells. These results demonstrated that CDKN2C expression had an inversed relationship with PML/RARα expression, suggesting that PML/RARα might repress CDKN2C expression in APL cells.

CDKN2C being a direct target of PML/RARα in APL cells

To determine whether CDKN2C is a specific target gene bound by PML/RARα, we detected PML/RARα binding on the CDKN2C promoter using ChIP-seq analysis of PML/RARα in APL patient-derived cell line NB4 [ 25]. As shown in Fig. 2A, the regions ChIPed by anti-PML and anti-RARα antibodies were both significantly enriched on the promoter of CDKN2C in NB4 cells. This result indicated that PML/RARα might directly bind to the promoter of CDKN2C. To further verify this finding revealed by genome-wide profiling, we conducted ChIP-qPCR in NB4 cells using anti-PML and anti-RARα antibodies. Primers specific for the PML/RARα binding sites were designed to encompass both PML and RARα peaks. As we expected, a significant enrichment of PML/RARα was detected on the CDKN2C promoter, but not in the non-relevant region (Fig. 2B), which indicated that PML/RARα could directly bind to the CDKN2C promoter. The data demonstrated that CDKN2C was a direct target of PML/RARα in APL cells.

PML/RARα repressing the activity of the CDKN2C promoter

We cloned an 800 bp fragment (−774 to+25 bp) of the CDKN2C promoter into the empty luciferase reporter vector (pGL3-CDKN2C) to further determine the regulatory effect of PML/RARα on CDKN2C promoter activity. As illustrated in Fig. 3A, this cloned CDKN2C promoter contained two peak regions of PML/RARα in NB4 cells. The promoter activity of CDKN2C was strongly repressed by PML/RARα in a dose-dependent manner when the CDKN2C promoter (pGL3-CDKN2C) was cotransfected with increasing quantities of the PML/RARα expression plasmid into HEK-293T cells (Fig. 3B). These results indicated that CDKN2C expression was transcriptionally repressed by PML/RARα.

Restoration of the expression of CDKN2C by ATRA in APL cells through releasing PML/RARα binding on chromatin

APL cells are sensitive to physiological concentrations of ATRA, which can efficiently rescue the expression of PML/RARα-dysregulated target genes by degradation of the oncogenic fusion protein. Therefore, to investigate whether CDKN2C expression level can be increased in ATRA-treated NB4 cells, we performed qRT-PCR assays and Western blot to examine CDKN2C expression level before and after ATRA treatment. We found that the mRNA and protein levels of CDKN2C were indeed upregulated by ATRA in a time-dependent manner (Fig. 4A and 4B). Furthermore, whether the induction of CDKN2C expression correlated with the decrease of PML/RARα on its promoter needs verification. Thus, we performed ChIP-qPCR assays to investigate the binding capacity of PML/RARα on the CDKN2C promoter in NB4 cells after ATRA treatment for 24 h. We found that both the bindings of PML and RARα on the CDKN2C promoter severely decreased after ATRA treatment (Fig. 4C). To validate these findings, we further performed qRT-PCR in NB4 cells treated with a translation inhibitor CHX for 30 min before the addition of ATRA to interfere with the translation process of newly synthesized proteins. Since CDKN2C was a direct target of PML/RARα, it was deducible that the induction of CDKN2C upon ATRA treatment would be independent of de novo protein synthesis. As shown in Fig. 4D, we found that an increase in the mRNA level of CDKN2C induced by ATRA was detected in the presence of CHX, suggesting that the induction of CDKN2C by ATRA required no additional newly synthesized intermediate protein(s) and was the direct effect of PML/RARα degradation. These results demonstrated that ATRA reactivated CDKN2C expression in APL cells by releasing PML/RARα direct binding on the CDKN2C promoter.

Induction of cell cycle arrest and cell differentiation of APL cells by restored expression of CDKN2C

We investigated the biological effect of CDKN2C restoration on NB4 cells to further elucidate the function of CDKN2C in APL. We first detected the distribution of cell cycle after transfecting CDKN2C into NB4 cells with the retrovirus. As shown in Fig. 5A, the mRNA and protein levels of CDKN2C were dramatically increased after transduction. We observed that the percentage of G₀/G₁ phase was significantly increased upon forced expression of CDKN2C. This result indicated that CDKN2C restoration was able to induce G₀/G₁ phase arrest of NB4 cells (Fig. 5B). Moreover, we also found that restored CDKN2C expression significantly increased the expression of neutrophilic differentiation marker CD11b (Fig. 5C left). The Wright’s staining further supported the above finding (Fig. 5C right). The data suggested that CDKN2C was involved in the regulation of differentiation of APL cells. Taken together, we showed that CDKN2C was associated with both cell cycle arrest and granulocytic differentiation in APL cells.

Evidence for targeting and repression of CDKN2C by PML/RARα in primary APL patient cells

Our results in a series of cell lines demonstrated that PML/RARα repressed the expression of CDKN2C by directly binding to the CDKN2C promoter. In addition, ATRA restored the CDKN2C expression by relieving PML/RARα binding to the chromatin. To further verify these results in primary APL blast cells, we retrieved several sets of ChIP-seq and gene expression profiling [ 6, 26] to identify the PML/RARα binding and CDKN2C expression. As shown in Fig. 6A, we found similar PML/RARα peak regions at the CDKN2C locus in an APL sample as in NB4 cells. This result demonstrated that PML/RARα directly bound to the CDKN2C locus. Moreover, we examined the microarray gene expression data and compared the mRNA level of CDKN2C in an APL patient sample with 97% myeloblasts before and after ATRA treatment for five days. As expected, the expression level of CDKN2C was upregulated after ATRA treatment (Fig. 6B). Furthermore, our RNA-seq data from an additional APL patient revealed that the mRNA level of CDKN2C was increased after 24 h treatment with 1 mmol/L ATRA (Fig. 6C). In summary, these results obtained from primary APL patient cells confirmed that CDKN2C was repressed by PML/RARα by directly binding to its promoter. Moreover, the repression by PML/RARα was restored by ATRA treatment.

Discussion

Identification of cell cycle regulators dysregulated by PML/RARα is essential for elucidating inappropriate cell proliferation in APL pathogenesis. In this study, we found that CDKN2C was the direct target of the PML/RARα oncofusion protein in APL. CDKN2C expression was specifically repressed by PML/RARα through directly binding its promoter to reduce promoter activity in NB4 cells. ATRA can re-activate CDKN2C expression in NB4 cells by releasing PML/RARα binding on its promoter. Moreover, we showed that overexpression of CDKN2C induced a partial differentiation and cell cycle arrest of APL cells. Our data provide valuable insights into the inactivation of CDKN2C by PML/RARα.

CDKN2C combined with CDKN2A, CDKN2B, and CDKN2D consists of the INK4 family. These four members possess the evolutionary homology and biochemical similarities, and can compete with D-type cyclins to bind and inhibit CDK4/6. Despite the similarity and redundant roles in regulating cell cycle, their expression levels are not the same in tissue and malignancies. The possible reasons are probably due to distinct tissue expression patterns and different post-transcriptional regulations [ 27]. For example, CDKN2C and CDKN2D are both expressed during embryogenesis but CDKN2A and CDKN2B are not [ 28]. CDKN2C and CDKN2D are rarely deleted in T-ALL, but abnormalities of CDKN2A and CDKN2B for chromosome 9p exhibit an increased frequency in T-ALL [ 29, 30]. Our previous finding indicates that PML/RARα directly represses the expression of CDKN2D. This study provided further evidence that CDKN2C was also dysregulated by PML/RARα in APL.

As a typical member of the INK4 family, we found that CDKN2C exerted its function not only on regulating cell cycle but also on regulating cell differentiation in APL. CDKN2C has been involved in proliferation in gastric carcinogenesis and is induced during terminal differentiation of mouse myoblasts [ 23, 31]. CDKN2C regulation in G₁/S-phase transition is also important for hematopoietic progenitor cells to escape from the cell cycle and favor normal lineage development and terminal differentiation [ 32]. Indeed, inactivation of CDKN2C contributes to increase self-renewal of stem cells and block the lineage differentiation. For example, inactivation of CDKN2C efficiently block lymphopoiesis of B cells via inhibition of pRb phosphorylation by CDK6 [ 30]. pRb can exert a role in cellular differentiation by functioning as a coactivator for transcription regulators. Therefore, further study will be carried out to test whether the differentiation function of CDKN2C is related with the pRb phosphorylation in APL.

CDKN2C is also an important regulator in determining the cell fate of hematopoietic stem cells (HSCs) as CDKN2C exerts a critical role in the balance of self-renewal to differentiation. Increasing lines of evidence show that CDKN2C can strongly inhibit self-renewal and increase asymmetric division of HSCs, while loss of CDKN2C enhances the self-renewal potential of HSCs in vivo [ 33]. Inactivation of CDKN2C is also applied to improve long-term engraftment of hematopoietic transplants in recipients [ 34]. Thus, we postulate that the inactivation of CDKN2C may also increase the self-renewal potential of leukemia stem cells (LSCs). Overall, our data provide a promising target of PML/RARa in APL, CDKN2C, whose inactivation contributes to the leukemogenesis of APL.

References

[1] Lo-Coco F, Di Donato L; GIMEMA, Schlenk RF; German–Austrian Acute Myeloid Leukemia Study Group and Study Alliance Leukemia. Targeted therapy alone for acute promyelocytic leukemia. N Engl J Med 2016; 374(12): 1197–1198

[2] Burnett AK, Russell NH, Hills RK, Bowen D, Kell J, Knapper S, Morgan YG, Lok J, Grech A, Jones G, Khwaja A, Friis L, McMullin MF, Hunter A, Clark RE, Grimwade D; UK National Cancer Research Institute Acute Myeloid Leukaemia Working Group. Arsenic trioxide and all-trans retinoic acid treatment for acute promyelocytic leukaemia in all risk groups (AML17): results of a randomised, controlled, phase 3 trial. Lancet Oncol 2015; 16(13): 1295–1305

[3] Mi JQ, Chen SJ, Zhou GB, Yan XJ, Chen Z. Synergistic targeted therapy for acute promyelocytic leukaemia: a model of translational research in human cancer. J Intern Med 2015; 278(6): 627–642

[4] de Thé H, Chen Z. Acute promyelocytic leukaemia: novel insights into the mechanisms of cure. Nat Rev Cancer 2010; 10(11): 775–783

[5] Wang K, Wang P, Shi J, Zhu X, He M, Jia X, Yang X, Qiu F, Jin W, Qian M, Fang H, Mi J, Yang X, Xiao H, Minden M, Du Y, Chen Z, Zhang J. PML/RARalpha targets promoter regions containing PU.1 consensus and RARE half sites in acute promyelocytic leukemia. Cancer Cell 2010; 17(2): 186–197

[6] Martens JH, Brinkman AB, Simmer F, Francoijs KJ, Nebbioso A, Ferrara F, Altucci L, Stunnenberg HG. PML-RARα/RXR alters the epigenetic landscape in acute promyelocytic leukemia. Cancer Cell 2010; 17(2): 173–185

[7] Hoemme C, Peerzada A, Behre G, Wang Y, McClelland M, Nieselt K, Zschunke M, Disselhoff C, Agrawal S, Isken F, Tidow N, Berdel WE, Serve H, Müller-Tidow C. Chromatin modifications induced by PML-RARα repress critical targets in leukemogenesis as analyzed by ChIP-Chip. Blood 2008; 111(5): 2887–2895

[8] Lim S, Kaldis P. Cdks, cyclins and CKIs: roles beyond cell cycle regulation. Development 2013; 140(15): 3079–3093

[9] Franklin DS, Godfrey VL, O’Brien DA, Deng C, Xiong Y. Functional collaboration between different cyclin-dependent kinase inhibitors suppresses tumor growth with distinct tissue specificity. Mol Cell Biol 2000; 20(16): 6147–6158

[10] Ramsey MR, Krishnamurthy J, Pei XH, Torrice C, Lin W, Carrasco DR, Ligon KL, Xiong Y, Sharpless NE. Expression of p16Ink4a compensates for p18Ink4c loss in cyclin-dependent kinase 4/6-dependent tumors and tissues. Cancer Res 2007; 67(10): 4732–4741

[11] Franklin DS, Godfrey VL, Lee H, Kovalev GI, Schoonhoven R, Chen-Kiang S, Su L, Xiong Y. CDK inhibitors p18(INK4c) and p27(Kip1) mediate two separate pathways to collaboratively suppress pituitary tumorigenesis. Genes Dev 1998; 12(18): 2899–2911

[12] Drexler HG. Review of alterations of the cyclin-dependent kinase inhibitor INK4 family genes p15, p16, p18 and p19 in human leukemia-lymphoma cells. Leukemia 1998; 12(6): 845–859

[13] Guo SX, Taki T, Ohnishi H, Piao HY, Tabuchi K, Bessho F, Hanada R, Yanagisawa M, Hayashi Y. Hypermethylation of p16 and p15 genes and RB protein expression in acute leukemia. Leuk Res 2000; 24(1): 39–46

[14] Ragione FD, Iolascon A. Inactivation of cyclin-dependent kinase inhibitor genes and development of human acute leukemias. Leuk Lymphoma 1997; 25(1-2): 23–35

[15] Casini T, Pelicci PG. A function of p21 during promyelocytic leukemia cell differentiation independent of CDK inhibition and cell cycle arrest. Oncogene 1999; 18(21): 3235–3243

[16] Wang Y, Jin W, Jia X, Luo R, Tan Y, Zhu X, Yang X, Wang X, Wang K. Transcriptional repression of CDKN2D by PML/RARa contributes to the altered proliferation and differentiation block of acute promyelocytic leukemia cells. Cell Death Dis 2014; 5(10): e1431

[17] Thullberg M, Bartkova J, Khan S, Hansen K, Rönnstrand L, Lukas J, Strauss M, Bartek J. Distinct versus redundant properties among members of the INK4 family of cyclin-dependent kinase inhibitors. FEBS Lett 2000; 470(2): 161–166

[18] Pei XH, Bai F, Tsutsui T, Kiyokawa H, Xiong Y. Genetic evidence for functional dependency of p18Ink4c on Cdk4. Mol Cell Biol 2004; 24(15): 6653–6664

[19] Bai F, Pei XH, Godfrey VL, Xiong Y. Haploinsufficiency of p18(INK4c) sensitizes mice to carcinogen-induced tumorigenesis. Mol Cell Biol 2003; 23(4): 1269–1277

[20] Latres E, Malumbres M, Sotillo R, Martín J, Ortega S, Martín-Caballero J, Flores JM, Cordón-Cardo C, Barbacid M. Limited overlapping roles of P15(INK4b) and P18(INK4c) cell cycle inhibitors in proliferation and tumorigenesis. EMBO J 2000; 19(13): 3496–3506

[21] Leone PE, Walker BA, Jenner MW, Chiecchio L, Dagrada G, Protheroe RK, Johnson DC, Dickens NJ, Brito JL, Else M, Gonzalez D, Ross FM, Chen-Kiang S, Davies FE, Morgan GJ. Deletions of CDKN2C in multiple myeloma: biological and clinical implications. Clin Cancer Res 2008; 14(19): 6033–6041

[22] Jalili A, Wagner C, Pashenkov M, Pathria G, Mertz KD, Widlund HR, Lupien M, Brunet JP, Golub TR, Stingl G, Fisher DE, Ramaswamy S, Wagner SN. Dual suppression of the cyclin-dependent kinase inhibitors CDKN2C and CDKN1A in human melanoma. J Natl Cancer Inst 2012; 104(21): 1673–1679

[23] Cui H, Zhao C, Gong P, Wang L, Wu H, Zhang K, Zhou R, Wang L, Zhang T, Zhong S, Fan H. DNA methyltransferase 3A promotes cell proliferation by silencing CDK inhibitor p18INK4C in gastric carcinogenesis. Sci Rep 2015; 5: 13781

[24] Payton JE, Grieselhuber NR, Chang LW, Murakami M, Geiss GK, Link DC, Nagarajan R, Watson MA, Ley TJ. High throughput digital quantification of mRNA abundance in primary human acute myeloid leukemia samples. J Clin Invest 2009; 119(6): 1714–1726

[25] Qian M, Jin W, Zhu X, Jia X, Yang X, Du Y, Wang K, Zhang J. Structurally differentiated cis-elements that interact with PU.1 are functionally distinguishable in acute promyelocytic leukemia. J Hematol Oncol 2013; 6(1): 25

[26] Stegmaier K, Ross KN, Colavito SA, O’Malley S, Stockwell BR, Golub TR. Gene expression-based high-throughput screening (GE-HTS) and application to leukemia differentiation. Nat Genet 2004; 36(3): 257–263

[27] Forget A, Ayrault O, den Besten W, Kuo ML, Sherr CJ, Roussel MF. Differential post-transcriptional regulation of two Ink4 proteins, p18 Ink4c and p19 Ink4d. Cell Cycle 2008; 7(23): 3737–3746

[28] Zindy F, den Besten W, Chen B, Rehg JE, Latres E, Barbacid M, Pollard JW, Sherr CJ, Cohen PE, Roussel MF. Control of spermatogenesis in mice by the cyclin D-dependent kinase inhibitors p18(Ink4c) and p19(Ink4d). Mol Cell Biol 2001; 21(9): 3244–3255

[29] Kim WY, Sharpless NE. The regulation of INK4/ARF in cancer and aging. Cell 2006; 127(2): 265–275

[30] Ruas M, Peters G. The p16INK4a/CDKN2A tumor suppressor and its relatives. Biochim Biophys Acta 1998; 1378(2): F115–F177

[31] Phelps DE, Hsiao KM, Li Y, Hu N, Franklin DS, Westphal E, Lee EY, Xiong Y. Coupled transcriptional and translational control of cyclin-dependent kinase inhibitor p18INK4c expression during myogenesis. Mol Cell Biol 1998; 18(4): 2334–2343

[32] Morse L, Chen D, Franklin D, Xiong Y, Chen-Kiang S. Induction of cell cycle arrest and B cell terminal differentiation by CDK inhibitor p18(INK4c) and IL-6. Immunity 1997; 6(1): 47–56

[33] Yuan Y, Shen H, Franklin DS, Scadden DT, Cheng T. In vivo self-renewing divisions of haematopoietic stem cells are increased in the absence of the early G1-phase inhibitor, p18INK4C. Nat Cell Biol 2004; 6(5): 436–442

[34] Yu H, Yuan Y, Shen H, Cheng T. Hematopoietic stem cell exhaustion impacted by p18 INK4C and p21 Cip1/Waf1 in opposite manners. Blood 2006; 107(3): 1200–1206

RIGHTS & PERMISSIONS

Higher Education Press and Springer-Verlag Berlin Heidelberg