Gene therapy for hemophilia B mice with scAAV8-LP1-hFIX

Wei Lu , Qingzhang Zhou , Hao Yang , Hao Wang , Yexing Gu , Qi Shen , Jinglun Xue , Xiaoyan Dong , Jinzhong Chen

Front. Med. ›› 2016, Vol. 10 ›› Issue (2) : 212 -218.

PDF (1384KB)
Front. Med. ›› 2016, Vol. 10 ›› Issue (2) :212 -218. DOI: 10.1007/s11684-016-0438-y
RESEARCH ARTICLE
RESEARCH ARTICLE
Gene therapy for hemophilia B mice with scAAV8-LP1-hFIX
Author information +
History +
PDF (1384KB)

Abstract

Hemophilia B is a hemorrhagic disease caused by the deficiency of clotting factor IX (FIX). Gene therapy might be the ultimate strategy for the disease. However, two main problems that should be solved in gene therapy for hemophilia B are immunity and safety. Self-complementary adeno-associated virus serotype 8 (scAAV8), a non-human primate AAV featuring low immunogenicity and high transfection efficiency in liver cells, might be a potential vector for hemophilia B gene therapy. A strong liver-specific promoter-1 (LP1) was inserted and mutant human FIX Arg338Ala was introduced into plasmid scAAV8-LP1 to develop an optimized AAV8 vector that expresses human clotting factor FIX (hFIX). The efficiency of scAAV8-LP1-hFIX administered through normal systemic injection or hydrodynamic injection was compared. A high expression was achieved using hydrodynamic injection, and the peak hFIX expression levels in the 5×1011 and 1×1011 virus genome (vg) cohorts were 31.94% and 25.02% of normal level, respectively, at 60 days post-injection. From the perspective of long-term (200 days) expression, both injection methods presented promising results with the concentration value maintained above 4% of normal plasma. The results were further verified by enzyme-linked immunosorbent assay and activated partial thromboplastin time. Our study provides a potential gene therapy method for hemophilia B.

Keywords

hemophilia B / AAV8 / hFIX / gene therapy

Cite this article

Download citation ▾
Wei Lu, Qingzhang Zhou, Hao Yang, Hao Wang, Yexing Gu, Qi Shen, Jinglun Xue, Xiaoyan Dong, Jinzhong Chen. Gene therapy for hemophilia B mice with scAAV8-LP1-hFIX. Front. Med., 2016, 10(2): 212-218 DOI:10.1007/s11684-016-0438-y

登录浏览全文

4963

注册一个新账户 忘记密码

Introduction

Hemophilia B is a monogenetic bleeding disorder caused by mutation in the gene encoding FIX protein, a serine protease that is essential for normal blood clot formation [ 1]. Patients with normal circulating levels of FIX activity below 1% suffer from spontaneous bleeding episodes, which can be eliminated when the FIX level increases to 5% and above [ 2, 3]. Current treatment for Hemophilia B, i.e., FIX protein concentrate infusion, is effective at arresting bleeding episodes, but the half activity time is very short.

Gene therapy, which might provide a long-term relief from bleeding with a single injection, shows obvious advantages in long-term expression. The first gene therapy trial was conducted in 1990 when two patients with adenosine deaminase (ADA) deficiency were treated with retroviral vector, which encodes a functional ADA gene [ 4]. Recombinant adenoviral vectors [ 5], recombinant adeno-associated viral vectors [ 6], and lentiviral vectors [ 7] were used as gene carriers. Historically, retrovirus [ 8], lentivirus [ 9, 10], and adenovirus [ 11, 12] had been used as target gene carriers for hemophilia B treatment, but the efforts proved to be unsatisfactory. Utilization of live-directed AAV8 vector characterized by high hepatotropism and low immunogenicity shows a promising effect for the long-term and high-level expression of target genes [ 13, 14]. Nathwani et al. [ 15] conducted a five-year study that administrated macaques with scAAV2/8-LP1-hFIXco, during which the expression of hFIX retained>10% of normal level. Phase I clinical trials that used AAV8 to deliver the FIX gene by peripheral vein infusion [ 16, 17] were conducted, but much efforts devoted to this area are needed.

In this study, we constructed a novel viral vector, scAAV8-LP1-hFIX, and then evaluated its efficiency through the comparison of two injection methods, namely, normal systemic injection and hydrodynamic injection. Our results indicated that scAAV8-LP1-hFIX delivered by both injection methods had promising therapeutic results from the perspective of a long-term effect.

Materials and methods

Plasmid construction and AAV packaging

The AAV vector plasmid scAAV-LP1 with a strong liver-specific promoter-1 (LP1) was provided by Beijing Five Plus Molecular Medicine Institute. The LP1 promoter consisted of hepatic control region of human apolipoprotein E/C-I gene locus, hAAT promoter, and Mvm intron. Then, the mutant human FIX Arg338Ala [ 18] expression cassette LP1-hFIX-bGH polyA was cloned into plasmid scAAV-LP1 to generate plasmid scAAV-LP1-hFIX. The double-stranded recombinant adeno-associated virus scAAV8-LP1-hFIX was obtained using the three-plasmid cotransfection method as previously reported [ 19].

Southern blot analysis of the genomes of AAV vectors

After the genomes of AAV vectors were purified, the viral DNA was dissolved in 100 mM NaOH and 1 mM EDTA for denaturation. Then, the denatured viral DNA was loaded in an alkaline denaturing agarose gel (1%) for electrophoresis. Southern hybridization was performed with GeneScreen Plus member in accordance with the standard protocol (Molecular Clone, the third edition). The probe was a digoxin-labeled LP1 promoter fragment with the following sequence: atgccacctccaacatccactcgaccccttggaatttcggtggagaggagcagaggttgtcctggcgtggtttaggtagtgtgagaggggaatgactcctttcggtaagtgcagtggaagctgtacactgcccaggcaaagcgtccgggcagcgtaggcgggcgactcagatcccagccagtggacttagcccctgtttgctcctccgataactggg.

Animal procedures

Male hemophilia B mice (strain name: B6.129P2-F9tm1Dws) with the promoter through exon 3 of the factor IX gene replaced by neoDHPRT to reduce the production of the functional factor IX protein or induce the production of a defective protein [ 20] were purchased from the Jackson laboratory (Bar Harbor, Maine, USA) and housed under specific pathogen-free conditions. All animal procedures were performed in accordance with institutional guidelines under protocols approved by the Animal Care and Use Committee of Fudan University. The mice used for the experiments were all male aged approximately 9–12 weeks with a weight of approximately 20–25 g. In the animal cohorts following hydrodynamic injection, the scAAV8-LP1-hFIX vector was dissolved in 2 ml of PBS and was administered into the tail vein of hemophilia B mice within 8 s [ 21, 22]. Another cohort injecting PBS was used as a negative control. As for the cohorts following normal systemic injection, the scAAV8-LP1-hFIX vector was dissolved in 500 µl of PBS and was slowly administered into the tail vein. Each cohort had four animals. A control was also established. At indicated time points post-injection, the blood samples were collected from the retro-orbital venous plexus of the experimental animals. Citrated plasma was then centrifuged at 5000 g for 5 min, and the supernatant was stored at -80 °C for further assays.

Human FIX and anti-hFIX antibody assessment

Plasma levels of hFIX in mice and anti-hFIX antibody were detected by ELISA as described by Kim [ 23]. After 100 days administration, an animal was sacrificed. Immunohistochemistry of hepatocytes was performed as described by Herzog [ 24].

Human FIX activity assessment

After cutting the tail of the experimental mice by 1 cm, the wound on the tail was touched slightly by a filter paper once per 20 s until blood spots became invisible in the paper, and then the clotting time was recorded. Activated partial thromboplastin time (APTT) was also conducted as described by Kim [ 23].

Liver toxicity assays

Animals following the hydrodynamic injection of 5 × 1011 vg were sacrificed on days 1, 10, and 30. Histopathological examination of mouse liver was conducted with standard hematoxylin-eosin procedures [ 25].

Immunohistochemistry of hepatocytes

Animals following the hydrodynamic injection of 5 × 1011 vg and PBS were sacrificed on day 100. The immunohistochemistry of hepatocytes was completed by Wuhan Goodbio Technology Co., Ltd.

Results

Identity of scAAV8-LP1-hFIX

SDS-PAGE results revealed that the proportion of VP1, VP2, and VP3 of purified scAAV8-LP-hFVIII was about 1:1:10 (not showed). VP1, VP2, and VP3 are proteins composed of the AAV viral capsid. In natural AAV vectors, the ratio of vp1, vp2, and vp3 was approximately 1:1:10. The titer of scAAV8-LP-hFIX was determined as 1.0 × 1012 vg/ml through DNA dot blotting. We further detected the genomic integrality of scAAV8-LP1-hFIX through Southern blot. As shown in Fig. 1, a vector genomic DNA of approximately 4750 nt was shown next to a 4900 nt ssDNA marker. More than 80% genomes of scAAV8-LP1-hFIX were in double-strand form. The band of viral DNA was clear with no smear in the alkaline agarose gel, suggesting that the viral genome was homogeneous and integral.

Expression of hFIX in hemophilia B mice

To confirm whether or not the novel viral vector we constructed can improve hFIX expression efficiency, hFIX-plasma level was detected after hydrodynamic injection and normal systemic injection at indicated time points (Fig. 2).

Seven days after the hydrodynamic injection of the 1 × 1011 and 5 × 1011 vg vectors into the tail vein of the experimental animals, hFIX expression was detectable at the levels of 0.47 and 0.53 µg/ml, and their peak levels of 1.3 and 1.6 µg/ml appeared on day 60 post-injection, respectively. The expression of hFIX suffered from a continuous drop to the levels of 0.22 and 0.19 µg/ml by the end of the study (200 days).

The hFIX expression in the two clinical dose cohorts showed no significant difference. The hFIX expression levels were steady during the entire study period with the peak value at 0.39–0.42 µg/ml on day 60 post-injection. By the end of the experiment, the expression level still sustained approximately 0.22–0.26 µg/ml. The animals injected with PBS using the two methods did not result in any detectable hFIX over the study period.

hFIX antibody level after transferring scAAV8-LP1-hFIX vector

As an alien antigen, the hFIX produced from the scAAV8-LP1-hFIX vector stimulated the generation of antibody against hFIX in hemophilia B mice after gene transfer. Analysis of the dynamic change of anti-hFIX antibody is necessary.

The anti-hFIX antibody titers in the experimental mice following the hydrodynamic injection of scAAV8-LP1-hFIX were detectable at the level below 1.3 ng/ml from day 1 to day 90 and declined to undetectable levels over time on day 90, whereas those in the mice following normal systemic injection were almost undetected (Fig. 3).

Clotting time and APTT test after hydrodynamic injection

To verify whether or not the hFIX produced by the exogenous transgene exerts a physiologic activity that accelerates clotting, the tail of the experimental mice was cut by 1 cm to assess their clotting time.

At 30 days after injection, the clotting times of both hydrodynamic injection cohorts and normal systemic injection of 5 × 1011 vg cohort were the same as that of the wild-type mice (shorter than 240 s). Meanwhile, the clotting time of the mice following the normal systemic injection of 1 × 1011 vg was slightly (about 60 s) longer than that of the wild-type ones but much shorter than that of the hemophilia B mice. The result indicated that the administration of the 5 × 1011 and 1 × 1011 vg vectors could exert therapeutic effects from the perspective of pathology (Fig.4).

The APTT test was further performed to convince the hFIX physiologic activity and speculate the expression level of active hFIX. On day 30, the mean level in the four animals that received the hydrodynamic injection of the 5 × 1011 vg vector reached 156%±24% of normal level. Meanwhile, the mean level in the animals that received 1 × 1011 vg was slightly above 100% of normal level. In the normal systemic injection cohorts, the mean level of the mice that received 5 × 1011 vg was 122%±27%, and that of the animals that received 1 × 1011 vg was slightly below 100% of normal level.

Immunohistochemistry of hepatocytes expressing hFIX

To confirm whether or not the exogenous transgene can perform normal translation in vivo, immunohistochemistry of hepatocytes in the animals that received 5 × 1011 vg was conducted 100 days post-injection. Paraffin sections (Fig. 5) were prepared, and positive hepatocytes were stained with brown, indicating that positive hepatocytes were mainly distributed in the area around the central veins.

Liver toxicity assay

Hydrodynamic injection could damage the liver. Histological examination of liver tissue was conducted to illustrate the damaging effect of hydrodynamic injection and the scAAV8-LP1-hFIX vector. On day 1, hepatic lobules of the animals administered with scAAV8-LP1-hFIX (Fig. 6A) and PBS (Fig. 6B) were slightly edematous, and inflammatory cell invasion was noted in the hepatic cord section. On day 100, no fiber separation was observed in both groups (Fig. 6C and 6D), indicating that virus injection, i.e., hydrodynamic injection, would induce inflammation, but it was recovered soon.

Discussion

In this study, we used AAV8 characterized by low immunogenicity and high transfection efficiency in liver cells to develop an scAAV8-LP1-hFIX vector and compare the effect of normal systemic injection and hydrodynamic injection.

Hydrodynamic-based transfection that allowed efficient gene transfer in vivo had been developed, and marked improvements had been achieved using this method in plasmid DNA transfection [ 23, 26, 27]. Normal systemic injection was also used in various research, and the results proved it to be effective. We performed normal systemic injection and hydrodynamic injection to compare their effect and thus achieve optimal hFIX expression with the novel viral vector. The peak FIX expression level achieved by hydrodynamic injection was much higher than that by normal systemic injection. The data indicated a relationship between peak FIX expression level and hydrodynamic procedure, which provides the pressure that may increase the permeability of liver fenestra to push the viral vector to the hepatocytes. Meanwhile, the hFIX expression after normal systemic injection or hydrodynamic injection sustained approximately 4%–5% of normal level at the end of the experimental period. This result indicates that hFIX translated from scAAV8-LP1-hFIX had promising therapeutic results by both injection methods.

Two clinical grades were tested to analyze the ideal injection dosage. The FIX expression level of the mice administered with 5 × 1011 vg was higher than that of the mice administered with 1 × 1011 vg within the first 150 days after hydrodynamic injection. However, these two injection dosages only slightly influenced FIX expression in the normal systemic injection group. After the experiment, the four groups showed similar FIX expression levels, indicating that the injection dosages of 1 × 1011 and 5 × 1011 vg exerted similar long-term therapeutic results (200 days). Endogenous antibody is an important factor influencing the expression of alien antigen. The AAV8 used in this study features low immunogenicity and high transfection efficiency in liver cells. Moreover, the utilization of a live-directed promoter further regulated and controlled the expression in the liver, which led to low immune responses to hFIX. The result suggests that the administration of scAAV8-LP1-hFIX did not induce markedly the production of hFIX antibody and that the hFIX expressed by scAAV8-LP1-hFIX had a low immunogenicity.

FIX proteins are mainly produced in the liver. Thus, the liver is the major target organ in immunohistochemistry. Positively stained hepatocytes confirmed that the exogenous transgene was able to perform normal translation in the liver.

After detecting the expression of hFIX in the plasma and distributed tissue, we verified the therapeutic effect of hFIX from the perspective of pathology. Clotting time assay confirmed that the hFIX produced by the exogenous transgene demonstrated a normal physiologic activity.

Liver toxicity assay further illustrated the damaging effect of hydrodynamic injection and the scAAV8-LP1-hFIX vector. The damage was mainly caused by the fluid bolus instead of the virus vector or its production.

The hFIX expression level from our new vector was not as high as that reported by Nathwani et al. [ 15] possibly because they used macaques in their experiments. The period of our study lasted 200 days, and the hFIX expression level of all experimental cohorts was satisfactory enough to reach therapeutic level. This result indicates that our new virus vector system was different from that in a previous report [ 28]. Moreover, we compared two methods to explore a new way to improve expression efficiency.

In conclusion, we constructed a new virus vector system, scAAV8-LP1-hFIX, which would rapidly and efficiently express active hFIX with a concentration above 4% of normal hFIX expression within 200 days after normal systemic injection and hydrodynamic injection. APTT and clotting time experiments further confirmed the acceleration of the clotting event. Our study suggests that the new virus vector system could improve the expression of hFIX and provide a potential gene therapy method for hemophilia B.

References

[1]

Nathwani AC, Tuddenham EG. Epidemiology of coagulation disorders. Baillieres Clin Haematol 1992; 5(2): 383–439

[2]

Löfqvist T, Nilsson IM, Berntorp E, Pettersson H. Haemophilia prophylaxis in young patients—a long-term follow-up. J Intern Med 1997; 241(5): 395–400

[3]

Ljung RC. Can haemophilic arthropathy be prevented? Br J Haematol 1998; 101(2): 215–219

[4]

Miller AD. Human gene therapy comes of age. Nature 1992; 357(6378): 455–460

[5]

Crystal RG, McElvaney NG, Rosenfeld MA, Chu CS, Mastrangeli A, Hay JG, Brody SL, Jaffe HA, Eissa NT, Danel C. Administration of an adenovirus containing the human CFTR cDNA to the respiratory tract of individuals with cystic fibrosis. Nat Genet 1994; 8(1): 42–51

[6]

Flotte T, Carter B, Conrad C, Guggino W, Reynolds T, Rosenstein B, Taylor G, Walden S, Wetzel R. A phase I study of an adeno-associated virus-CFTR gene vector in adult CF patients with mild lung disease. Hum Gene Ther 1996; 7(9): 1145–1159

[7]

Levine BL, Humeau LM, Boyer J, MacGregor RR, Rebello T, Lu X, Binder GK, Slepushkin V, Lemiale F, Mascola JR, Bushman FD, Dropulic B, June CH. Gene transfer in humans using a conditionally replicating lentiviral vector. Proc Natl Acad Sci USA 2006; 103(46): 17372–17377

[8]

Qiu X, Lu D, Zhou J, Wang J, Yang J, Meng P, Hsueh JL. Implantation of autologous skin fibroblast genetically modified to secrete clotting factor IX partially corrects the hemorrhagic tendencies in two hemophilia B patients. Chin Med J (Engl) 1996; 109(11): 832–839

[9]

Tsui LV, Kelly M, Zayek N, Rojas V, Ho K, Ge Y, Moskalenko M, Mondesire J, Davis J, Roey MV, Dull T, McArthur JG. Production of human clotting factor IX without toxicity in mice after vascular delivery of a lentiviral vector. Nat Biotechnol 2002; 20(1): 53–57

[10]

Brown BD, Cantore A, Annoni A, Sergi LS, Lombardo A, Della Valle P, D’Angelo A, Naldini L. A microRNA-regulated lentiviral vector mediates stable correction of hemophilia B mice. Blood 2007; 110(13): 4144–4152

[11]

Ehrhardt A, Kay MA. A new adenoviral helper-dependent vector results in long-term therapeutic levels of human coagulation factor IX at low doses in vivo. Blood 2002; 99(11): 3923–3930

[12]

Ehrhardt A, Xu H, Dillow AM, Bellinger DA, Nichols TC, Kay MA. A gene-deleted adenoviral vector results in phenotypic correction of canine hemophilia B without liver toxicity or thrombocytopenia. Blood 2003; 102(7): 2403–2411

[13]

Cooper M, Nayak S, Hoffman BE, Terhorst C, Cao O, Herzog RW. Improved induction of immune tolerance to factor IX by hepatic AAV-8 gene transfer. Hum Gene Ther 2009; 20(7): 767–776

[14]

Allay JA, Sleep S, Long S, Tillman DM, Clark R, Carney G, Fagone P, McIntosh JH, Nienhuis AW, Davidoff AM, Nathwani AC, Gray JT. Good manufacturing practice production of self-complementary serotype 8 adeno-associated viral vector for a hemophilia B clinical trial. Hum Gene Ther2011; 22(5):595-604

[15]

Nathwani AC, Rosales C, McIntosh J, Rastegarlari G, Nathwani D, Raj D, Nawathe S, Waddington SN, Bronson R, Jackson S, Donahue RE, High KA, Mingozzi F, Ng CY, Zhou J, Spence Y, McCarville MB, Valentine M, Allay J, Coleman J, Sleep S, Gray JT, Nienhuis AW, Davidoff AM. Long-term safety and efficacy following systemic administration of a self-complementary AAV vector encoding human FIX pseudotyped with serotype 5 and 8 capsid proteins. Mol Ther 2011; 19(5): 876–885

[16]

Nathwani AC, Tuddenham EG, Rangarajan S, Rosales C, McIntosh J, Linch DC, Chowdary P, Riddell A, Pie AJ, Harrington C, O’Beirne J, Smith K, Pasi J, Glader B, Rustagi P, Ng CY, Kay MA, Zhou J, Spence Y, Morton CL, Allay J, Coleman J, Sleep S, Cunningham JM, Srivastava D, Basner-Tschakarjan E, Mingozzi F, High KA, Gray JT, Reiss UM, Nienhuis AW, Davidoff AM. Adenovirus-associated virus vector-mediated gene transfer in hemophilia B. N Engl J Med 2011; 365(25): 2357–2365

[17]

Nathwani AC, Reiss UM, Tuddenham EG, Rosales C, Chowdary P, McIntosh J, Della Peruta M, Lheriteau E, Patel N, Raj D, Riddell A, Pie J, Rangarajan S, Bevan D, Recht M, Shen YM, Halka KG, Basner-Tschakarjan E, Mingozzi F, High KA, Allay J, Kay MA, Ng CY, Zhou J, Cancio M, Morton CL, Gray JT, Srivastava D, Nienhuis AW, Davidoff AM. Long-term safety and efficacy of factor IX gene therapy in hemophilia B. N Engl J Med 2014; 371(21): 1994–2004

[18]

Chang J, Jin J, Lollar P, Bode W, Brandstetter H, Hamaguchi N, Straight DL, Stafford DW. Changing residue 338 in human factor IX from arginine to alanine causes an increase in catalytic activity. J Biol Chem 1998; 273(20): 12089–12094

[19]

Haberman RA, Kroner-Lux G, McCown TJ, Samulski RJ. Current protocols in neuroscience. New York, N.Y.: John Wiley and Sons, 1999

[20]

Lin HF, Maeda N, Smithies O, Straight DL, Stafford DW. A coagulation factor IX-deficient mouse model for human hemophilia B. Blood 1997; 90(10): 3962–3966

[21]

Zhang G, Budker V, Wolff JA. High levels of foreign gene expression in hepatocytes after tail vein injections of naked plasmid DNA. Hum Gene Ther 1999; 10(10): 1735–1737

[22]

Liu F, Song Y, Liu D. Hydrodynamics-based transfection in animals by systemic administration of plasmid DNA. Gene Ther 1999; 6(7): 1258–1266

[23]

Kim HS, Kim JC, Lee YK, Kim JS, Park YS. Hepatic control elements promote long-term expression of human coagulation factor IX gene in hydrodynamically transfected mice. J Gene Med 2011; 13(7-8): 365–372

[24]

Herzog RW, Hagstrom JN, Kung SH, Tai SJ, Wilson JM, Fisher KJ, High KA. Stable gene transfer and expression of human blood coagulation factor IX after intramuscular injection of recombinant adeno-associated virus. Proc Natl Acad Sci USA 1997; 94(11): 5804–5809

[25]

Miao CH, Thompson AR, Loeb K, Ye X. Long-term and therapeutic-level hepatic gene expression of human factor IX after naked plasmid transfer in vivo. Mol Ther 2001; 3(6): 947–957

[26]

Xu ZX, Chen JZ, Yue YB, Zhang JQ, Li ZH, Feng DM, Ruan ZC, Tian L, Xue JL, Wang QJ, Jia W. A 16-bp RBE element mediated Rep-dependent site-specific integration in AAVS1 transgenic mice for expression of hFIX. Gene Ther 2009; 16(5): 589–595

[27]

Xu Z, Ye J, Zhang A, Xie L, Shen Q, Xue J, Chen J. Gene therapy for hemophilia B with liver-specific element mediated by Rep-RBE site-specific integration system. J Cardiovasc Pharmacol 2015; 65(2): 153–159

[28]

Graham T, McIntosh J, Work LM, Nathwani A, Baker AH. Performance of AAV8 vectors expressing human factor IX from a hepatic-selective promoter following intravenous injection into rats. Genet Vaccines Ther 2008; 6(1): 9

RIGHTS & PERMISSIONS

Higher Education Press and Springer-Verlag Berlin Heidelberg

PDF (1384KB)

5354

Accesses

0

Citation

Detail

Sections
Recommended

/