Introduction
Defects of craniofacial and alveolar bone have a direct impact on the stability of dental implants. The development of gene therapies for bone regeneration is one of the most important long-term goals of research in the mineralized tissue field. New vessels transport oxygen, nutrients, soluble factors and numerous cell types to tissues of the bone defect area. Angiogenesis thus plays a pivotal role at the early stage of bone regeneration [
1]. Basic fibroblast growth factor (bFGF) is one of the most important factors involved in neoangiogenesis [
2]. In our previous studies, bFGF gene mediated by adeno-associated virus (AAV) was used in the treatment of cranial bone defects, and plenty of vascular plexuses were observed at the early stage of bone regeneration. The regulation of exogenous bFGF is most important at the early stage of bone regeneration in further researches in genetic bone engineering. In this study, a tetracycline (Tet)-regulated system in combination with the AAV system was used to regulate the expression of exogenous bFGF, and the effect of this recombinant system was evaluated
in vitro.
Materials and methods
Cells
MC3T3-E1 osteoblast-like cells, BHK-21 cells and HEK293 cell line were purchased from ATCC Co. (USA). MC3T3-E1 cells were cultured in α-modified Eagle’s medium (α-MEM) (Gibco, USA) containing 10% fetal calf serum (Gibco, USA) and penicillin/streptomycin at 37°C in a humidified 5% CO2 atmosphere. BHK-21 cells and HEK293 cell line were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, USA) containing 10% newborn calf serum (Gibco, USA) and penicillin/streptomycin at 37°C in a humidified 5% CO2 atmosphere.
Plasmids
Plasmid pBluescript SKII-bFGF, containing mouse bFGF complete coding sequence (CDS) (465 bp), was purchased from RIKEN BioResource Center (Japan). Plasmids pAAV-S3-KzkhrGFP and pSVneo were purchased from AGTC Gene Technology Company (China). The plasmid pAAV-S3-KzkhrGFP contained the major components of the AAV system and the elements of the Tet-regulated system. In this plasmid, the expression of green fluorescence protein (GFP) was turned on when tetracycline or doxycycline (Dox, tetracycline derivative) was removed from the culture medium. According to this principle, the sequence of bFGF was designed to replace the sequence of GFP for the gene regulation.
Dox-regulation of the plasmid pAAV-S3-KzkhrGFP
HEK293 cells were cultured to 85% confluence on a 6-well tissue culture plate, and then transfected with pAAV-S3-KzkhrGFP using a calcium phosphate transfection kit (Beyotime, China). The media were removed from the plate and replaced with fresh DMEM growth medium after 8 h. At the same time, Dox (Sigma. Cat. No. D9891, USA) at differential concentrations (0.5, 1 and 2 μg/mL) was added into the fresh culture medium to terminate the expression of GFP. The regulatory effect of Dox was determined by fluorescence microscopy after 72 h.
Construction of recombinant plasmid pAAV-S3-bFGF
The plasmid pBluescript SKII-bFGF was taken as a template for PCR amplification of bFGF complete CDS region by primer 1. The primer 1 of bFGF for complete CDS was as follows: 5' CCAGATATCGCCACC ATGGCTGCCAGCGGCATCAC 3' (sense) (Cleavage site of Eco RV was added to 5'), 5' CTGGCGGCCGCTCAGCTCTTAGCAGACATTG 3' (anti-sense) (Cleavage site of Not I was added to 5'), and the product segment was 480 bp. A sequence of Korak was inserted ahead the ATG of the sense primer to enhance the expression of bFGF. The PCR products were separated by 0.8% low melting temperature agarose gel electrophoresis containing ethidium bromide (0.5 mmol/L), then recovered from the gel using an agarose gel DNA purification kit (Axygen, USA). The purified fragments and pAAV-S3-KzkhrGFP were digested by EcoRV and Not I (TaKaRa, Japan) respectively, and then the digestion products were purified by using a DNA fragment purification kit (Axygen, USA). The fragments and plasmid vector were ligated in a mole ratio of 1.5∶1 by T4 DNA ligase (TaKaRa, Japan) at 25°C for 3 h. The products of ligation were transformed to DH5α chemically competent cells for amplification. The recombinant plasmids pAAV-S3-bFGF which were extracted from the bacterial liquid were identified by PCR amplification with primer 1 and separated using 1.2% agarose gel electrophoresis. After identification by digestion, the positive clones were submitted for sequence analysis to Shanghai Bioengineering Co. Ltd. (China).
Production of recombinant virus rAAV-tet-off-bFGF
BHK-21 cells were plated onto a 6-well tissue culture plate. After 24 h the cells were confluent to 80%/well, cells were co-transfected with a combination of pAAV-S3-bFGF and pSVneo plasmids (at a 9∶1 ratio) using Lipofectamine 2000 (Invitrogen, USA). Twenty-four hours post-transfection, they were subcultured into selection media containing 800 μg/mL G418 (Gibco/BRL, USA). G418-resistant BHK-21 cell clones were isolated after 10 days. For large-scale recombinant AAV production and purification, BHK-21 cells were incubated in roller bottles (Ø 110 mm×480 mm; Wheaton, Millville, NJ, USA) at 37°C. After the cells were confluent to 100% (8×10
8 cells), confluent cells were infected with helper virus HSV1-rc/ΔUL2 at multiplicities of infection (MOI) of 0.1. After 48 h, the infected cells were eluted into the culture medium for the next purification. The collected cells were processed by chloroform treatment, PEG8000/NaCl precipitation and chloroform extraction for purification [
3]. Recombinant AAV-EGFP was also produced with the same procedure.
Determination of recombinant virus titer
The dot-blot assay [
4] was used respectively to determine the titer of rAAV2-tet-off-bFGF and rAAV2-EGFP containing vector genomes. The recombinant viruses were digested for 1 h at 37°C in a final volume of 200 μL containing 5UDNase I (Sigma, USA), 10 mmol/L Tris-Cl (pH 7.5), and 1 mmol/L MgCl
2. Plasmid pSNAV including CMV promoter was selected as the standard for the dot-blot assay. One μL denatured virus and 1 μL standard plasmid were immobilized onto a nylon membrane at 120°C for 30 min, and then prehybridized at 65°C for 4-5 h. Each digoxigenin-labeled probe (Roche, Switzerland) was hybridized overnight. After washing twice with 2×SSC/0.1% (W/V) SDS at 25°C for 5 min each time, and twice with 0.1×SSC/0.1% SDS at 68°C for 15 min each time, the membranes were visualized in a solution of nitro blue tetrazolium plus X-phosphate (Boehringer Mannheim, Germany).
Dox-regulation of osteogenic genes expressions in MC3T3-E1 cells infected with recombinant rAAV2-tet-off-bFGF
MC3T3-E1 cells were cultured to 90% confluence at several 6-well tissue culture plates. Then the MC3T3-E1 cells were transduced by rAAV2-tet-off-bFGF at a MOI of 1×105. At the same time, Dox at different concentrations (0.5, 1, and 2 μg/mL) was added into the fresh culture medium to inhibit the expression of bFGF. The control group was transduced by rAAV2-EGFP as the negative control. Then the total RNA and protein were isolated, and the expression of bFGF, osteocalcin and Cbfal mRNA was detected by using real time RT-PCR, and that of bFGF protein by using Western blot. The primer 2 of bFGF for partial CDS was as follows: 5' GGACGGCTGCTGGCTTCTAA3' (sense) and 5' CCAGTTCGTTTCAGTGCCACATAC3' (anti-sense), and the product segment was 128 bp. Primers of osteocalcin were as follows: 5' AGGACCCTCTCTCTGCTCAC 3' (sense) and 5' AACGGTGGTGCCATAGATGC 3' (anti-sense), and the expected product size was 310 bp. Primers of Cbfal were as follows: 5' TGCTTCATTCGCCTCACAAA 3' (sense) and 5' TGCTGTCCTCCTGGAGAAAGTT 3' (anti-sense), and the expected product size was 110 bp. Primers of GAPDH were as follows: 5' TGAACGGGAAGCTCACTGG 3' (sense) and 5' TCCACCACCCTGTTGCTGTA 3' (anti-sense), and the expected product size was 324 bp.
Meanwhile, transduced MC3T3 cells were collected into 100 μL phosphate buffered saline. The cell suspension was sonicated on ice for 30 s and centrifuged for 5 min at 4°C. Aliquots of supernatants were subjected to both protein assay with Coomassie Plus assay reagent (Nanjing Jiancheng Bioengineering Institute, China) and ALP activity measurement with an ALP assay kit (Nanjing Jiancheng Bioengineering Institute, China). The enzyme activity was normalized against the protein concentration and expressed as U/g protein.
Statistical analysis
Statistical analyses were performed using SPSS software (SPSS for Windows 13.0; SPSS, Chicago, IL, USA). All data represented at least 3 independent experiments and were expressed as ±s. Data were analyzed by one-way ANOVA and least significant difference procedure (LSD). Differences were considered significant when P values were less than 0.05. Obvious differences were considered significant when P values were less than 0.01.
Results
Dox-regulation of the plasmid pAAV-S3-KzkhrGFP
The expression of GFP was visualized to identify the regulatory effect of Dox in vitro. A gradual decrease in the viability of the fluorescence level was found with increased doses of Dox (Fig. 1). The results showed that 1 μg/mL Dox could greatly reduce the expression of GFP of pAAV-S3-KzkhrGFP.
Identification of the recombinant plasmids
The complete CDS region of mouse bFGF gene was amplificated from the plasmid pBluescript SKII-bFGF. A 480 bp specific band was obtained by PCR amplification and the result was consistent with what had been expected (Fig. 2a). Recombinant plasmid pAAV-S3-bFGF was taken as a template for PCR amplification. In the agarose gel electrophoresis, a 480 bp specific band was obtained (Fig. 2b), indicating that the complete CDS of mouse bFGF was constructed on the plasmid successfully. The recombinant plasmids were digested with EcoR V and Not I. Two specific bands (480 bp and 6.9 kb) were obtained in the agarose gel electrophoresis (Fig. 2c). The results of gel electrophoresis were completely consistent with our hypothesis. The sequencing results of the recombinant plasmids matched the sequence of GenBankTM.
Determination of the titer of recombinant virus
The dot-blot assay was used to determine the titer of recombinant virus containing vector genomes. The physical particle titer of rAAV2-EGFP and rAAV2-tet-off-bFGF was 2×1012 and 1.8×1012 vector genomes/mL, respectively (Fig. 3).
Determination of osteogenic genes in Dox-regulated MC3T3-E1 cells
From results of real time PCR (Fig. 4) and Western blot (Fig. 5), there was weak expression of bFGF, Cbfa1 and osteocalcin in MC3T3-E1 cells. The expression levels of these osteogenic genes were increased obviously after rAAV2-tet-off-bFGF transduction. rAAV2-tet-off-bFGF-infected MC3T3-E1 cells treated with Dox exhibited a significant gradual decrease in the mRNA expression levels of osteogenic genes. The levels of ALP, a marker mirroring increased osteogenic differentiation, were reduced in MC3T3-E1 cells. A significant increase in ALP activity was observed in rAAV2-tet-off-bFGF-infected cells. In Dox-treated groups, a gradual decrease in ALP activity was found with increased doses of Dox (Fig. 6).
Discussion
Gene therapy may represent an ideal approach towards augmenting bone regeneration [
5]. Thus, many strengths of gene therapy are especially relevant to bone regeneration. Tissue repair requires a proportionate expression of genes, initiating a cascade of events directing a self-maintained process, while a longer or even persisting action of the same factors could lead to excessive and abnormal bone formation. This will be accomplished by the use of regulated gene expression systems for the controlled delivery of regenerative factors in the gene therapy [
6]. Controlling gene expression
in vivo is a desired goal of gene therapy [
7]. Such control can potentially monitor the therapeutic effect of the transgene
in vivo. In particular, it would be advantageous for monitoring tissue repair and the regeneration process. In the present study, an efficient and biosafe gene delivery system was used. AAV-2 was selected as the carrier to deliver bFGF, and a Tet-responsive promoter was used to control the expression of the transgene, thus establishing a gene therapy model for our further bone regeneration study.
The Tet-Off system exhibits tight off-regulation, absence of pleiotropic effects, high induction levels, high absolute expression, and rapid induction time. It has two critical components: tet-controlled transcriptional activator (tTA) and tetracycline responsive element (TRE) [
8]. In the Tet-Off system, tTA binds the TRE and activates the transcription of exogenous genes in the absence of Dox. In our expression system, plasmid pAAV-S3-KzkhrGFP not only contained the AAV major components, but also had critical components of the Tet-Off system. Through fluorescence microscopy, it was found that the expression of GFP in HEK293 cells declined with the administration of Dox, and the lowest expression of the GFP was gotten while the concentration of Dox was 1 μg/mL. This result showed that plasmid pAAV-S3-KzkhrGFP could be regulated by Dox succesfully, and it could be used as a carrier to deliver exogenous genes for gene regulation.
Our previous study reported that by using the AAV Helper-Free system (Stratagene, USA) [
9], the recombinant AAV2-based human BMP7 was constructed and regenerative bone was formed in a segmental defect of the rabbit’s radius. However, the AAV Helper-Free system could only accommodate the transgene of 3 kb. The sequence length of the transgene was closely related to the titer of the recombinant virus. In our present study, the sequence length of the insert including the mouse bFGF CDS and the components of the tet-off system greatly exceeded 3 kb, which would seriously affect the titer of the recombinant virus. Therefore, a new system, rHSV-1/AAV hybrid helper viral system, was chosen to produce the virus [
10,
11]. In this new system, BHK-21 cells were cultured in a roller bottle cell culture apparatus, and infected with the helper virus HSV1-rc/ΔUL2 that could increase efficiently the quantity of the virus, and provide us with a high-titer purified recombinant virus for further experiments. In fact, the physical particle titer of rAAV2-tet-off-bFGF and rAAV2-EGFP was 1.8×10
12 and 2×10
12 vector genomes/mL, respectively, which was similar to the results of other researchers who had used this system [
12-
15]. That should be sufficient for our further
in vitro and
in vivo experiments.
FGFs are potent mitogens for a wide variety of cells of mesenchymal and neuroectodermal origin [
16]. Among FGFs, bFGF (FGF-2) is one of the most important factors involved in neoangiogenesis [
2], and has the ability to stimulate the proliferation and differentiation of osteoblasts, vascular endothelial cells and mesenchymal cells [
17,
18]. In our projects, a regeneration strategy might be envisioned where early bFGF expression could be used to expand precursor cells in a bone defect model, followed by induction of other osteogenic growth factors to stimulate the osteoblast differentiation. In this study, a Dox-regulated rAAV2-bFGF was constructed, and the Dox-regulation of the recombinant virus rAAV2-tet-off-bFGF was identified in the MC3T3-E1 cells. While MC3T3-E1 cells were transduced by rAAV2-tet-off-bFGF, the expression of bFGF was increased greatly; meanwhile the expression of osteogenic genes (osteocalcin and Cbfa1) and ALP activity had an obviously increase in comparison to control group. Then, the expression of those genes had a gradual decrease with increasing doses of Dox. Furthermore, the osteogenic function of MC3T3-E1 cells was regulated effectively by exogenous bFGF through the Dox administration.
Higher Education Press and Springer-Verlag Berlin Heidelberg
PDF
(237KB)
