Gene silencing efficiency of shRNA expression vectors targeting Cx43 in vitro

Cuihong ZHENG , Yunxia WU , Guangying HUANG , Wei WANG

Front. Med. ›› 2009, Vol. 3 ›› Issue (2) : 130 -135.

PDF (308KB)
Front. Med. ›› 2009, Vol. 3 ›› Issue (2) :130 -135. DOI: 10.1007/s11684-009-0030-9
RESEARCH ARTICLE
RESEARCH ARTICLE
Gene silencing efficiency of shRNA expression vectors targeting Cx43 in vitro
Author information +
History +
PDF (308KB)

Abstract

Our previous studies showed that there were close relationships between connexin 43 (Cx43) and acupoints and meridians. In order to further investigate the effect of Cx43 in acupuncture treatment, RNA interference technique was used to construct small hairpin RNA (shRNA) expression vectors targeting Cx43 and identify the efficiency of RNA interference in NIH/3T3 cell lines for further use in vivo. Aiming directly at the two targets of Cx43 mRNA sequence of the rat and mouse homology region, we synthesized two pairs of complementary oligonucleotide strands in vitro. Double strands were formed after annealing, and then inserted into Pgenesil-1 plasmid expression vector. After identification by enzyme cutting and sequencing, the recombinant plasmids named P-Cx43-shRNA (1), P-Cx43-shRNA (2) and P-con-shRNA were transfected into the NIH/3T3 cells. Immunofluorescence and Western blot assays were used to detect the protein level of Cx43 after being screened by G418.The results of enzyme cutting and sequencing showed that we successfully constructed two shRNA expression vectors targeting Cx43, and a control expression vector for rat and mouse. Also, the Cx43 protein level was decreased by 73.5% (P< 0.01) and 10.8%, accordingly. The Cx43 protein level was not influenced by the transfection of P-con-shRNA. The outcomes demonstrate that the plasmid P-Cx43-shRNA (1) can specifically silence better the expression of Cx43 in NIH/3T3 cells, which offers an experimental evidence for further in vivo investigation.

Keywords

RNA interference / connexin 43 / small hairpin RNA (shRNA) / acupuncture

Cite this article

Download citation ▾
Cuihong ZHENG, Yunxia WU, Guangying HUANG, Wei WANG. Gene silencing efficiency of shRNA expression vectors targeting Cx43 in vitro. Front. Med., 2009, 3(2): 130-135 DOI:10.1007/s11684-009-0030-9

登录浏览全文

4963

注册一个新账户 忘记密码

Introduction

Gap junctions are hydrophilic pathways with low resistance, which ubiquitously exist between zooblasts. Gap junctional intercellular communication (GJIC) is one of the most important patterns for direct cell signaling, which is significant in cell growth, multicell organ coordination and self-stabilization control [1,2]. Connexins are elementary structure proteins of gap junctions [3]. Although there are more than 20 members in the connexin gene family, the main components of gap junctions between human keratinocytes are connexin 43 (Cx43) and Cx26 [4]. Moreover, immunostaining for Cx43 was observed in epidermal keratinocytes, sebaceous glands, eccrine sweat ducts, and hairs, while Cx26 was only detectable in the two latter epidermal adnexae [5]. Our previous research found that Cx43 located not only in the epithelium tissue of rat skin, but also in some scattered obese cells in the dermis and the subcutaneous layer. Moreover, there is a correlation between the expression of Cx43 and acupoints and meridians to a certain extent [6,7].

Thus, to further investigate the effect of Cx43 in the acupuncture treatment, we use RNA interference technique to construct small hairpin RNA (shRNA) expression vectors targeting Cx43 and identify the efficiency of RNA interference in NIH/3T3 cell lines to screen an effective shRNA plasmid targeting Cx43 for further use in vivo.

Methods

Analysis of target genes for shRNA selection

According to the Cx43 mRNA sequence of rats and mice and the principle of siRNA design [8,9], we selected two common targets in the homology region of rat and mouse for Cx43 gene. To ensure the specificity of RNA interference, the candidate shRNAs were subjected to basic local alignment search tool (BLAST) analysis on the Genbank. The finally determined targets were as follows: (1) AACAGTCTGCCTTTCGCTGTA; (2) TCGCTGTAACACTCAACAA. The loop sequence for the shRNA DNA template between corresponding sense and antisense strands was AAGTTCTGC, and GACTTCATAAGGCGCATGC was used as the sequence of negative control with limited homology to any known sequence.

Plasmid construction

The Pgenesil-1 siRNA expression vector was modified based on pEGFP-C1 vector, which was provided by Genesil and contained a U6 promoter and an enhanced green fluorescent protein gene (EGFP). The vector included a Kanamycin resistance gene for selection in prokaryocytes and G418 resistance in eukaryocytes. The multiple clone site (MCS) of the vector was as follows: -DraIII-XbaI-SalI-EcoRI-U6 Promotor-BamHI-PstI-SalI-XbaI-HindIII. The designed DNA oligonucleotides were chemically synthesized and annealed as an insert for ligation between the BamHI and HindIII restriction sites. The vector was linearized with BamHI and HindIII, which left overhangs for the cloning of selected siRNA inserts with the BamHI and HindIII restriction sites at the 5' and 3' end of the DNA. The ligation products were respectively transferred into competent cells (DH5а) for amplification. Then the recombinant plasmids were identified by enzyme cutting of PstI and SalI separately, and sequenced at Shanghai Sangon Company (China). The resulting vectors were accordingly named as P-Cx43-shRNA (1), P-Cx43-shRNA (2), and the control vector as P-con-shRNA, respectively.

Cell lines and stable transfection

NIH/3T3 cells (mouse embryonic fibroblast cell line, China Center for Type Culture Collection, CCTCC, China) were routinely cultured in high glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/mL penicillin-streptomycin in a humidified atmosphere of 5% CO2 at 37ºC. One day before transfection, the cells in logarithmic phase were seeded into 6-well plates at a density of (2-8) ´ 105 cells/well in 2 mL of growth medium without antibiotics so that they were 90%-95% confluent at the time of transfection. Coverslips were played into the plates beforehand for immunofluorescenc. The cells were divided into 4 groups: normal control, P-Cx43-shRNA (1), P-Cx43-shRNA (2), and P-con-shRNA groups. For the three latter groups, DNA-LipofectamineTM 2000 (Invitrogen, USA) complex was prepared and added to each well respectively according to the manufacturer’s instruction. Six hours after transfection, complete medium was renewed. Twelve hours after transfection, the transfection efficiency was observed under an inversion fluorescence microscope. Forty-eight hours after transfection, the cells were screened with 500 mg/mL G418 (Gibco, USA). When a majority of the cells in the normal control group died, the concentration of G418 was adjusted to 200 μg/mL to maintain the culture until resistance clone cells were obtained.

Immunocytochemistry

The cells on the coverslips experienced stable transfection and were fixed in a mixed solution of alcohol and acetone (1∶1) for 15 min, and washed twice in phosphate buffered solution (PBS). The sections were then incubated with a 1∶1000 dilution of Cx43 antibody (ADI, USA) for 12 h at 4ºC. The antibody was removed by washing 4 times in PBS prior to the addition of a secondary antibody (1∶200, SouthernBiotech, USA) conjugated to fluorescein isothiocyanate (FITC). After being incubated with the secondary antibody for 1 h at room temperature (RT) away from light, the sections were counterstained with propidium iodide (PI, Sigma, USA) for 12-15 min, and observed under a laser scanning confocal microscope (Olympus FV500, Germany). FITC and PI were both excited at 488 nm, and the emission filters were 525 and 610 nm barrier filters respectively.

Western blot

To quantify the level of gene expression preferably, the cells were harvested and lysed (50 mmol/L Tris·HCl pH 8.0, 150 mmol/L NaCl, 1% TritonX-100, 5 μg/mL aprotinin, 2 mmol/L ethylenediamine tetraacetic acid (EDTA), 100 μg/mL phenylmethyl sulfonylfluoride (PMSF)) for Western blot. Coomassie brilliant blue kit (Jiancheng Biotechnique Co., Ltd., China) was used to determine the protein concentration. Equal amounts of protein from each group were separated by 12% sodium dodecyl sulphate and polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred to nitrocellulose (NC) membrane (Pierce, USA). After being blocked in 25 mL of 7% degreased milk for 2 h at RT, the NC membrane was incubated with anti-Cx43, and anti-b-actin (1/2000, Sigma, USA) respectively in tris buffered solution (TBS)/Tween-20 containing 7% degreased milk with gentle shaking overnight at 4°C. After being washed 4 times each for 15 min with TBS/Tween-20, the membrane was incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody (1/5000 in TBS/Tween-20, Pierce, USA) with gentle shaking for 2 h at RT. An enhanced chemiluminesce detection reagent (ECL, Pierce, USA) was used to incubate the blot for 5 min. Excess reagent was drained, the blot covered with clear plastic wrap, and the blot exposed to x-ray film.

Statistical analysis

Experimental results were expressed as x ¯±s. We performed one-way analysis of variance (ANOVA), and S-N-K test using the software SPSS v.11.5 for all the measurement data. Statistical significance was set at the level of P < 0.05.

Results

Enzyme cutting and sequencing

According to the MCS, the plasmid Pgenesil-1 could be cut by PstI, while PstI could not cut the recombinant plasmid for the site having been replaced. Also, the siRNA inserts between BamHI and HindIII still contained a SalI restriction site, thus the constructed plasmid could be exactly cut out a 400 bp DNA fragment by SalI. For this reason, we selected the perfect recombinant plasmids, which were completely in accordance with the design for following experiments. The results of enzyme cutting and sequencing showed that we successfully constructed two shRNA expression vectors targeting Cx43 and a control expression vector for rat and mouse (Figs. 1, 2).

Stable transfection

The recombinant plasmids were successfully transfected into the NIH/3T3 cells using DNA-LipofectamineTM 2000. The transfection efficiency of the plasmids was observed under an inversion fluorescence microscope (Fig. 3). About 12 h after transfection, the cells began to express EGFP. The transfection efficiency was the ratio of the number of cells expressing EGFP to the number of the total cells per visual field, which was about 40%-50%. After being screened with G418, we obtained resistance clone cells.

Immunocytochemistry

As shown in Fig. 4, green fluorescence was FITC for Cx43 immunocytochemistry staining, and red for nuclear PI counterstaining. The immunostaining results showed that Cx43 was intensely expressed in the cytoplasm and plasma membrane of the NIH/3T3 cells in the normal control group. The green fluorescence intensities signifying the expression of Cx43 in the P-Cx43-shRNA (1) and the P-Cx43-shRNA (2) groups were weaker than those in the normal control group, especially for the former, while the expression of Cx43 in the P-con-shRNA group was similar to the normal control group.

Western blot

The immunoblotting results for semiquantitative comparison demonstrated that the protein level of Cx43 in P-Cx43-shRNA (1) group was significantly lower than that in normal control group with a decrease of 73.5% (P < 0.01, Fig. 5). Although there was also a decrease of 10.8% in P-Cx43-shRNA (2) group, the difference did not reach statistical significance. Likewise, there was no significant difference between P-con-shRNA and normal control groups.

Discussion

There are several techniques to down-regulate gene expression, such as antisense oligonucleotide, ribozyme, and so on, which have resulted in the degradation of target RNA for decades. Although these methods used in some simple experimental models can bring out satisfactory results, it was ubiquitous that the efficiency of gene silencing was not high in complicated mammalian systems. During the last several years, the techniques of gene silencing based on RNA interference (RNAi) have obtained remarkable development, which offers a very powerful tool for researchers to investigate gene function [10,11]. RNAi can be induced in mammalian cells by the introduction of small interfering RNA [12], double-stranded RNA molecules, 21-23 nucleotides in length resembling RNA cleavage products resulting from the action of the Dicer enzyme. The siRNAs can be prepared by chemical synthesis, in vitro transcription, RNase III cleaving long double-stranded RNAs, and delivery of siRNA expression vector [13-16]. The use of siRNA expression vector greatly increases the range of application for RNAi. Compared with viral vectors, using plasmid vectors is a cheaper and safer method of producing siRNA, because once the DNA template has been inserted into a plasmid vector, large quantities can be easily produced by growing it in bacteria. At present, a heartening performance has been derived from the application of RNAi in mammalian systems not only at the in vitro cellular level but also at the in vivo animal level, that siRNAs synthetically or siRNAs expression vectors can be successfully delivered into mammalian cells by electroporation, local injection or intravenous injection [17]. For example, siRNA could be delivered effectively into hepatocytes in vivo by rapid systemic injection of large volumes of physiological solutions [18,19]. Song reported a more dramatic delivery of siRNA into the hepatocytes (89%), which may be ascribed to three repeated applications [20,21].

In these experiments, the gene silencing efficiencies in vitro were not very ideal, although the shRNA plasmid expression vectors targeting Cx43, especially P-Cx43-shRNA (1), had a better gene silencing effect (73.5%) for the protein level of Cx43 in the NIH/3T3 cells. The reason might be that considering the range of application, the selection of target sites was limited to the homology region of rat and mouse for Cx43 gene. Otherwise, G418 is most commonly used in stable transfection for resistance screening, which belongs to aminoglycoside antibiotics, and is similar structurally to neomycin, gentamicin and kanamycin. However, after stable screening, the persister might occur and could influence the calculating of inhibition effect, resulting in a lower interference efficiency, which means that the plasmid P-Cx43-shRNA (1) might have a preferable gene silencing effect in service use.

In conclusion, the results demonstrate that the plasmid P-Cx43-shRNA (1) can specifically silence better the expression of Cx43 in the NIH/3T3 cells, which offers an experimental evidence for further in vivo investigation.

References

[1]

LairdD W. Life cycle of connexins in health and disease. Biochem J, 2006, 394 (Pt 3): 527-543

[2]

AnandR J, HackmD J. The role of gap junctions in health and disease. Crit Care Med, 2005, 33(12 Suppl): S535-538

[3]

EvansW H, MartinP E. Gap junctions: structure and function. Mol Membr Biol, 2002, 19(2): 121-136

[4]

AritaK, AkiyamaM, TsujiY, McMillanJ R, EadyR A, ShimizuH. Changes in gap junction distribution and connexin expression pattern during human fetal skin development. J Histochem Cytochem, 2002, 50(11): 1493-1500

[5]

SalomonD, MasgrauE, VischerS, UllrichS, DupontE, SappinoP, MedaP. Topography of mammalian connexins in human skin. J Invest Dermatol, 1994, 103(2): 240-247

[6]

ZhengC H, HuangG Y, ZhangM M, XiaoY L. Experimental study on expression of connexin 43 in meridians of rats. Zhongguo Zhen Jiu, 2005, 25(9): 629-632 (in Chinese)

[7]

HuangG Y, ZhengC H, ZhangM M. Effect of acupuncture on expression of connexion 43 in “Zusanli” (ST 36) of the rat. Zhongguo Zhen Jiu, 2005, 25(8): 565-568 (in Chinese)

[8]

ElbashirS M, HarborthJ, LendeckelW, YalcinA, WeberK, TuschlT. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature, 2001, 411(6836): 494-498

[9]

ElbashirS M, LendeckelW, TuschlT. RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev, 2001, 15(2): 188-200

[10]

McManusM T, SharpP A. Gene silencing in mammals by small interfering RNAs. Nat Rev Genet, 2002, 3(10): 737-747

[11]

DykxhoornD M, NovinaC D, SharpP A. Killing the messenger: short RNAs that silence gene expression. Nat Rev Mol Cell Biol, 2003, 4(6): 457-467

[12]

CaplenN J, ParrishS, ImaniF, FireA, MorganR A. Specific inhibition of gene expression by small double-stranded RNAs in invertebrate and vertebrate systems. Proc Natl Acad Sci USA, 2001, 98(17): 9742-9747

[13]

MicuraR. Small interfering RNAs and their chemical synthesis. Angew Chem Int Ed Engl, 2002, 41(13): 2265-2269

[14]

DonzeO, PicardD. RNA interference in mammalian cells using siRNAs synthesized with T7 RNA polymerase. Nucleic Acids Res, 2002, 30(10): e46

[15]

MyersJ W, JonesJ T, MeyerT, FerrellJ E Jr. Recombinant Dicer efficiently converts large dsRNAs into siRNAs suitable for gene silencing. Nat Biotechnol, 2003, 21(3): 324-328

[16]

MiyagishiM, TairaK. U6 promoter-driven siRNAs with four uridine 3' overhangs efficiently suppress targeted gene expression in mammalian cells. Nat Biotechnol, 2002, 20(5): 497-500

[17]

ScherrM, MorganM A, EderM. Gene silencing mediated by small interfering RNAs in mammalian cells. Curr Med Chem, 2003, 10(3): 245-256

[18]

McCaffreyA P, MeuseL, PhamT T, ConklinD S, HannonG J, KayM A. RNA interference in adult mice. Nature, 2002, 418 (6893): 38-39

[19]

LewisD L, HagstromJ E, LoomisA G, WolffJ A, HerweijerH. Efficient delivery of siRNA for inhibition of gene expression in postnatal mice. Nat Genet, 2002, 32(1): 107-108

[20]

SongE, LeeS K, WangJ, InceN, OuyangN, MinJ, ChenJ, ShankarP, LiebermanJ. RNAβinterferenceβtargetingβFasβprotectsβmiceβfromβfulminant hepatitis.ββNatβMed2003, 9(3): 347-351

[21]

ZenderL, HutkerS, LiedtkeC, TillmannH L, ZenderS, MundtB, WaltematheM, GoslingT, FlemmingP, MalekN P, TrautweinC, MannsM P, KuhnelF, KubickaS.βCaspaseβ8βsmallβinterferingβRNAβpreventsβacuteβliverβfailureβinβmice.ββProc Natl Acad Sci U S A2003, 100(13): 7797-7802

RIGHTS & PERMISSIONS

Higher Education Press and Springer-Verlag Berlin Heidelberg

PDF (308KB)

2865

Accesses

0

Citation

Detail

Sections
Recommended

/