Construction and identification of lentiviral RNA interference vector of rat leptin receptor gene

Abstract

Leptin resistance is a main mechanism of acquired childhood obesity, and the suppression of long form of leptin receptor (OBRb) gene expression in diet-induced obese rats indicates that the down-regulation of OBRb gene expression plays a pivotal role in the mechanism of leptin resistance. The aim of the present study was to construct the lentiviral RNA interference (RNAi) vector of rat OBRb gene and evaluate the effects of siRNA on silencing OBRb gene expression. The target sequence of siRNA-OBRb was designed, and the complementary DNA containing both sense and antisense oligonucleotides was synthesized. After phosphorylation and annealing, these double-stranded DNA was cloned to pRNA-lentivector-VGFP to construct pRNA-Lenti-OBRb-VGFP recombinants with U6-containing promoter, target sequence and Poly III terminator. Then, the products were confirmed by electrophoresis and sequencing analysis, and the effects of RNAi on reducing gene expression were further confirmed by real-time polymerase chain reaction in transfected rat glioma cells expressing OBRb. The target sequence of siRNA-OBRb was successfully cloned to pRNA-lentivector-VGFP, and the RNAi protocol specifically reduced the expression of OBRb mRNA by approximately 80% compared with controls in transfected rat glioma cells. The successful construction of rat lentivirus vectors expressing OBRb-specific shRNA may be useful for further investigation in vivo.

Keywords

receptors, leptin / RNA interference / lentivirus vector

Introduction

Acquired childhood obesity is becoming increasingly apparent with the changes of children’s life style and eating environment [1], which becomes a severe social and medical problem [2]. Our previous study have found that the levels of serum leptin were high in obese children [3], supporting the fact that leptin resistance is a main mechanism of childhood obesity [4, 5], and the expression of the long form of leptin receptor (OBRb) mRNA in the hypothalamus and liver was reduced significantly in diet-induced obese rats [6]. In vitro, leptin at high concentrations down-regulated the expression of OBRb mRNA in HepG2 cells [7], indicating that the silencing of OBRb gene expression played a pivotal role in the mechanism of leptin resistance. RNA interference (RNAi) technique is a useful tool to influence gene expression [8, 9], and lentivirus vectors can deliver shRNAs for post-transcriptional silencing of specific genes with high efficiency [10, 11]. This research was aimed at the construction of a rat lentivirus vector system expressing OBRb-specific shRNA and confirming its interference effects in rat glioma cells.

Methods

Selection of RNAi target site

A web-based program for designing siRNA targets (Promega, Madison, WI, USA), Block-iT RNAi Target Designer (Invitrogen, USA), and the National Center for Biotechnology Information Web site were referred for the selection of siRNA sequences, and for BLAST searches. According to OBRb mRNA sequence (AF287268), the target oligonucleotides were designed at the position in gene sequence from 854 gene site, two complementary DNA template chains were designed and BamH I, Xho I enzyme cleavage sites were introduced at the terminals. The sequences of the oligonucleotides for OBRb were as follows: sense oligonucleotide, 5'-GATCCC TCGTCTCGGATACATCTCTTTGATATCCGAGAGATGTATCCGAGACGATTTTTTCCAAC-3', antisense oligonucleotide, 5'-TCGAGTTGGAAAAAATCGTCTCGGATACATCTCTCGGATATCAAAGAGATGTATCCGAGACGA GG-3', and the sequences of oligonucleotides for control were: antisense oligonucleotide, 5'-GATCCCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTTCCAAA-3', antisense oligonucleotide, 5'- TCGATTTGGAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAACG-3'.

The construction of recombinant of rat OB-Rb shRNA

After phosphorylation at the 5' end and annealing of the oligonucleotides synthesis, double-stranded DNA containing BamH I and Xho I cleavage sites was produced and cloned to pRNA-lentivector-VGFP (Shanghai Kangcheng Biological Engineering Co., Ltd., China) according to the manufacturer’s instructions, and the corresponding target sequences were named pRNA-Lenti-OBRb-VGFP, and pRNA-Lenti-Control-VGFP. After the insertion of target genes, the connected products were transformed to competent E. coli. (Shanghai Kangcheng Biological Engineering Co., Ltd., China), and 8 clones were chosen for each plasmid and subjected to polymerase chain reaction (PCR) amplification (forward sequencing primer: 5'-GTGGAGCATCATACTGATCC-3'; reverse sequencing primer: 5'- ACACTCATCCTCACAGGTTCC-3'). The products were primarily identified by 2% agarose gel electrophoresis, and further determined by DNA sequence analysis (TaKaRa Biotechnology Co., Ltd., Japan).

Cell culture and transfection

To assess the effect of endogenous expression of OBRb siRNA, OBRb-expressing rat glioma cells (American Type Culture Collection, Manassas, VA) were cultured in six-well plates (six wells as one group) with Dulbecco's Modified Eagle’s Medium (DMEM) containing 10% Fetal Bovine Serum (FBS) in a 5% CO₂ incubator at 37°C (0.5×10⁵ cells/well), and transfected with either pRNA-Lenti-OBRb-VGFP, or pRNA-Lenti-Control-VGFP by Lipofectamine 2000 (Invitrogen, USA) after 70%-80% cell confluence. Green fluorescence was observed in the cells 24 hours after transfection under fluorescence microscope and the fluorescence became stable 48 hours after transfection.

RNA isolation and real-time RT-PCR

The cells were captured and the total RNA was isolated using the trizol method and purified with deoxyribonuclease according to the manufacturer’s instruction (Invitrogen, Carlsbad, California, USA) 48 h after transfection. A one-step real-time reverse transcription PCR was used to determine relative expression levels of OBRb mRNA. The primer sequences are: forward, 5'-TGTTCCTGGGCACAAGGACTTA-3', and reverse, 5'-ACCATAGCTGCTGGTACCATCTCA-3'. The reactions were performed using the Light Cycler real-time PCR analysis (Roche Diagnostics Company, USA), and all amplifications were carried out in a 20 µL total reaction system by using a One-Step RT-PCR kit (TaKaRa Company, Japan) with 40 pmol of forward and reverse primers and 2 µL of cDNA according to the manufacturer’s protocol. Cycle parameters for the one-step RT-PCR included a reverse transcription step at 95°C for 5 min, followed by 40 cycles of 95°C denaturation for 10 s, 64°C annealing for 15 s and 72°C extension for 30 s. The β-actin (forward: 5'-AGACTGTCAACGGTCACCTGG-3' and reverse: 5'-TATCTTCTGCTGGGCTAACTGG-3') was used for internal normalization. Expression levels were calculated by the standard curve method.

Statistical analysis

Data were presented as \overline{x}\pm s. Statistical analysis was performed by using SPSS 11.0 software. A P<0.05 was considered statistically significant.

Results

Identification of pRNA-Lenti-OBRb-VGFP by PCR and sequence analysis

The rat lentivirus vectors expressing OBRb-specific shRNA were synthesized, and the specificity of the designed target sequence was primarily identified by PCR and electrophoresis (Fig. 1). The product length was 302 bp. The results were further confirmed by gene sequence analysis (Fig. 2), and the lentiviral vectors of rat OBRb siRNA were synthesized correctly.

The silencing effects of pRNA-Lenti-OBRb-VGFP gene

The rat glioma cells were cultured to assess the effects of endogenous expression of OBRb siRNA, and the cells grew well and reached 70%-80% confluence before transfection. Green fluorescence was observed in the cells 24 h after transfection under fluorescence microscope, and the fluorescence became stable 48 h after transfection (Fig. 3). By a real-time RT-PCR technique, we observed that the level of OBRb mRNA was reduced significantly as compared with that of the control group, and suppressed by approximately 80% in cells transfected with pRNA-Lenti-OBRb-VGFP (Fig. 4).

Discussion

Leptin, the product of the obesity gene, is an adipocyte-derived hormone that plays a key role in the regulation of food intake, energy expenditure and whole-body energy balance in rodents and humans [12]. Leptin acts through the leptin receptor (OBR). There are two major isoforms. These are the long form (OBRb) and the short form (OBRa). OBRb is primarily expressed in specific nuclei of the hypothalamus, a key regulatory center for appetite control, and is considered to be the signaling-competent receptor isoform, having JAK and STAT proteins and activating through the JAK/STAT pathway [13,14]. The hyperleptinemia observed in obese children and rodents supports the hypothesis that leptin resistance or insensitivity to the action of leptin appears to be a common mechanism of human obesity [15]. One explanation for leptin resistance is that the transport system allowing leptin to enter the brain is saturable [16]. However, studies on rodents show that the inhibition of food intake after injection of leptin to the intracerebral ventricle was attenuated in rats with diet-induced obesity [17]. These studies indicated that the responsiveness to leptin might vary according to metabolic conditions and leptin resistance could be related with leptin receptors or their downstream signaling pathway [18]. Therefore, the present study constructed lentivirus shRNA expression vectors of rat OBRb gene, and evaluated the effects of suppression of OBRb gene expression by siRNA in rat glioma cell lines for future investigation of the possible mechanism of posttranscriptional gene silencing of OBRb invivo.

RNAi refers to the process by which 21- to 23-nucleotide short interfering RNAs (siRNAs) mediate post-transcriptional degradation of homologous mRNA transcripts. This process is carried out through an endogenous pathway that centers on the use of endogenously encoded small RNAs, and can be hijacked to knock down the expression of any target protein by introducing a specific siRNA into a cell. RNAi has been proven to be a useful tool for reducing target gene expression [19,20], and the lentivirus is an ideal vector for RNAi with the advantage of high transfection rate and a longer-term effect [10,11]. This research accomplished the objective of silencing OBRb gene by the integration of lentivirus-mediated OBRb shRNA into the host genome through the construction of OBRb shRNA expression recombinant. The siRNA targeting the 854 site of the OBRb gene was devised according to the RNAi design principle, and the siRNA sequences were cloned to lentivirus vectors (pRNA-lentivector-VGFP) to construct the OBRb shRNA expression recombinant pRNA-Lenti-OBRb-VGFP that could produce siRNA through transcription. The specificity of designed target sequence was primarily identified by PCR and electrophoresis, and further confirmed by gene sequence analysis.

Since rat glioma cells can express OBRb, we used this cell line as target cells to assess the gene silencing effect of RNAi, and the inhibition of OBRb gene expression by siRNA was compared through real-time PCR analysis. The result proved the interfering effect with OBRb gene downregulation (approximately 80%). The 80% decrease in expression levels is similar to previously reported effects of RNAi on reducing gene expression [9, 10].

In this study, we established a lentivirus vector system targeted OBRb gene sequences, and had shown that OBRb shRNA had a strong inhibitory effect on OBRb gene expression in transfected rat glioma cells, which may be useful for further investigation in vivo.

References

[1] RobbinsJ M, KhanK S, LisiL M, RobbinsS W, MichelS H, TorcatoB R. Overweight among young children in the Philadelphia health care centers: incidence and prevalence. Arch Pediatr Adolesc Med, 2007, 161(1): 17–20

[2] BuenoG, BuenoO, MorenoL A, GarciaR, TresacoB, GaragorriJ M, BuenoM. Diversity of metabolic syndrome risk factors in obese children and adolescents. J Physiol Biochem, 2006, 62(2): 125–133

[3] NakanishiT, LiR, LiuZ, YiM, NakagawaY, OhzekiT. Sexual dimorphism in relationship of serum leptin and relative weight for the standard in normal-weight, but not in overweight children as well as adolescents. Eur J Clin Nutr, 2001, 55(11): 899–993

[4] FleischA F, AgarwalN, RobertsM D, HanJ C, TheimK R, VexlerA, TroendleJ, YanovskiS Z, YanovskiJ A. Influence of serum leptin on weight and body fat growth in children at high risk for adult obesity. J Clin Endocrinol Metab, 2007, 92(3): 948–954

[5] AugustineR A, GrattanD R. Induction of central leptin resistance in hyperphagic pseudopregnant rats by chronic prolactin infusion. Endocrinology, 2008, 149(3): 1049–1055

[6] LiuZ J, BianJ, LiuJ, EndohA. Obesity reduced the gene expression of leptin receptors in hypothalamus and liver. Horm Metab Res, 2007, 39(7): 489–494

[7] LiuZ J, EndohA, LiR S, OhzekiT. Effects of leptin and dexamethasone on long and short leptin receptor mRNA. Pediatr Int, 2004, 6(5): 561–564

[8] LeungR K, WhittakerP A. RNA interference: from gene silencing to gene-specific therapeutics. Pharmacol Ther, 2005, 107(2): 222–239

[9] MäkinenP I, KoponenJ K, KärkkäinenA M, MalmT M, PulkkinenK H, KoistinahoJ, TurunenM P, Ylä-HerttualaS. Stable RNA interference: comparison of U6 and H1 promoters in endothelial cells and in mouse brain. J Gene Med, 2006, 8(4): 433–441

[10] NishitsujiH, IkedaT, MiyoshiH, OhashiT, KannagiM, MasudaY. Expression of small hairpin RNA by lentivirus-based vector confers efficient and stable gene-suppression of HIV-1 on human cells including primary non-dividing cells. Microbes Infect, 2004, 6(1): 76–85

[11] YamamotoT, MiyoshiH, YamaotoN, YamamotoN, InoueJ, Tsunetsugu-YokotaY. Lentivirus vectors expressing short hairpin RNAs against the U3-overlapping region of HIV nef inhibit HIV replication and infectivity in primary macrophages. Blood, 2006, 108(10): 3305–3312

[12] BaileC A, Bella-FeraM, MartinR J. Regulation of metabolism and body fat mass by leptin. Annu Rev Nutr, 2000, 20(1): 105–127

[13] BjorbaekC, KahnB B. Leptin signaling in the central nervous system and the periphery. Recent Prog Horm Res, 2004, 57(2): 305–331

[14] FunahashiH, YadaT, SuzukiR, ShiodaS. Distribution, function, and properties of leptin receptors in the brain. Int Rev Cytol, 2003, 224(1): 1–27

[15] El-HaschimiK, LehnertH. Leptin resistance—or why leptin fails to work in obesity. Exp Clin Endocrinol Diabetes, 2003, 111(1): 2–7

[16] BurgueraB, CouceM E, CurranG L, JensenM D, LloydR V, ClearyM P, PodusloJ F. Obesity is associated with a decrease leptin transport across the blood-brain barrier in rats. Diabetes, 2000, 49(7): 1219–1223

[17] WiddowsonP S, UptonR, BuckinghamR, ArchJ, WilliamsG. Inhibition of food response to intracerebroventricular injection of leptin is attenuated in rats with diet-induced obesity. Diabetes, 1997, 46(11): 1782–1785

[18] MartinR L, PerezE, HeY J, DawsonR Jr, MillardW J. Leptin resistance is associated with hypothalamic leptin receptor mRNA and protein down-regulation. Metabolism, 2000, 49(11): 1479–1484

[19] SchuberS, GrunertH P, ZeichhardtH, WerkD, ErdmannV A, KurreckJ. Maintaining inhibition: siRNA double expression vectors against coxsackieviral RNAs. J Mol Biol, 2005, 346(2): 457–465

[20] HaraguchiS, SagaY, NatioK, InoueH, SetoA. Specific gene silencing in the pre-implantation stage mouse embryo by an siRNA expression vector system. Mol Reprod Dev, 2004, 68(1): 17–24

RIGHTS & PERMISSIONS

Higher Education Press and Springer-Verlag Berlin Heidelberg