Genomic and metabolomic analysis of Bacillus licheniformis with enhanced poly-γ-glutamic acid production through atmospheric and room temperature plasma mutagenesis

Abstract

Poly-γ-glutamic acid is an extracellular polymeric substance with various applications owing to its valuable properties of biodegradability, flocculating activity, water solubility, and nontoxicity. However, the ability of natural strains to produce poly-γ-glutamic acid is low. Atmospheric and room temperature plasma was applied in this study to conduct mutation breeding of Bacillus licheniformis CGMCC 2876, and a mutant strain M32 with an 11% increase in poly-γ-glutamic acid was obtained. Genome resequencing analysis identified 7 nonsynonymous mutations of ppsC encoding lipopeptide synthetase associated with poly-γ-glutamic acid metabolic pathways. From molecular docking, more binding sites and higher binding energy were speculated between the mutated plipastatin synthase subunit C and glutamate, which might contribute to the higher poly-γ-glutamic acid production. Moreover, the metabolic mechanism analysis revealed that the upregulated amino acids of M32 provided substrates for glutamate and promoted the conversion between L- and D-glutamate acids. In addition, the glycolytic pathway is enhanced, leading to a better capacity for using glucose. The maximum poly-γ-glutamic acid yield of 14.08 g·L^–1 was finally reached with 30 g·L^–1 glutamate.

Graphical abstract

Keywords

ARTP mutagenesis / Bacillus licheniformis / poly-γ-glutamic acid / metabolomics

References

[1] LiD, HouL, GaoY, TianZ, FanB, WangF, LiS. Recent advances in microbial synthesis of poly-γ-glutamic acid: a review. Foods, 2022, 11( 5): 1– 19

[2] CaoM, FengJ, SirisansaneeyakulS, SongC, ChistiY. Genetic and metabolic engineering for microbial production of poly-γ-glutamic acid. Biotechnology Advances, 2018, 36( 5): 1424– 1433

[3] ZhanY Y, ZhuC J, ShengB J, CaiD B, WangQ, WenZ Y, ChenS W. Improvement of glycerol catabolism in Bacillus licheniformis for production of poly-γ-glutamic acid. Applied Microbiology and Biotechnology, 2017, 101( 19): 7155– 7164

[4] TianG, FuJ, WeiX, JiZ, MaX, QiG, ChenS. Enhanced expression of pgdS gene for high production of poly-γ-glutamic aicd with lower molecular weight in Bacillus licheniformis WX-02. Journal of Chemical Technology and Biotechnology (Oxford, Oxfordshire), 2014, 89( 12): 1825– 1832

[5] LiB C, CaiD B, HuS Y, ZhuA T, HeZ L, ChenS W. Enhanced synthesis of poly gamma glutamic acid by increasing the intracellular reactive oxygen species in the Bacillus licheniformis 1-pyrroline-5-carboxylate dehydrogenase gene ycgN-deficient strain. Applied Microbiology and Biotechnology, 2018, 102( 23): 10127– 10137

[6] CaiD B, ChenY Z, HeP H, WangS Y, MoF, LiX, WangQ, NomuraC T, WenZ Y, MaX, ChenS. Enhanced production of poly-γ-glutamic acid by improving ATP supply in metabolically engineered Bacillus licheniformis. Biotechnology and Bioengineering, 2018, 115( 10): 2541– 2553

[7] OttenheimC, NawrathM, WuJ C. Microbial mutagenesis by atmospheric and room-temperature plasma (ARTP): the latest development. Bioresources and Bioprocessing, 2018, 5( 12): 1– 12

[8] JiangT, QiaoH, ZhengZ J, ChuQ L, LiX, YongQ, OuyangJ. Lactic acid production from petreated hydrolysates of corn stover by a newly developed Bacillus coagulans strain. PLoS One, 2016, 11( 2): e0149101

[9] QiuC G, ZhangA, TaoS, LiK, ChenK Q, OuyangP K. Combination of ARTP mutagenesis and color-mediated high-throughput screening to enhance 1-naphthol yield from microbial oxidation of naphthalene in aqueous system. Frontiers of Chemical Science and Engineering, 2020, 14( 5): 793– 801

[10] QiuY B, ZhangY T, ZhuY F, ShaY Y, XuZ Q, FengX H, LiS, XuH. Improving poly-(γ-glutamic acid) production from a glutamic acid-independent strain from inulin substrate by consolidated bioprocessing. Bioprocess and Biosystems Engineering, 2019, 42( 10): 1711– 1720

[11] YuW, ChenZ, YeH, LiuP, LiZ, WangY, LiQ, YanS, ZhongC J, HeN. Effect of glucose on poly-γ-glutamic acid metabolism in Bacillus licheniformis. Microbial Cell Factories, 2017, 16( 1): 22

[12] ChenZ, LiuP, LiZ, YuW, WangZ, YaoH, WangY, LiQ, DengX, HeN. Identification of key genes involved in polysaccharide bioflocculant synthesis in Bacillus licheniformis. Biotechnology and Bioengineering, 2017, 114( 3): 645– 655

[13] LiuP, ChenZ, YangL, LiQ, HeN. Increasing the bioflocculant production and identifying the effect of overexpressing epsB on the synthesis of polysaccharide and γ-PGA in Bacillus licheniformis. Microbial Cell Factories, 2017, 16( 1): 163

[14] XiongY, WangY, YuY, LiQ, WangH, ChenR, HeN. Production and characterization of a novel bioflocculant from Bacillus licheniformis. Applied and Environmental Microbiology, 2010, 76( 9): 2778– 2782

[15] ChenZ, MengT, LiZ, LiuP, WangY, HeN, LiangD. Characterization of a beta-glucosidase from Bacillus licheniformis and its effect on bioflocculant degradation. AMB Express, 2017, 7( 1): 197

[16] LiH, DurbinR. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics (Oxford, England), 2009, 25( 14): 1754– 1760

[17] LiH, HandsakerB, WysokerA, FennellT, RuanJ, HomerN, MarthG, AbecasisG, DurbinR. Genome Project Data P. The sequence alignment/map format and SAMtools. Bioinformatics (Oxford, England), 2009, 25( 16): 2078– 2079

[18] RahimF, UllahH, JavidM T, WadoodA, TahaM, AshrafM, ShaukatA, JunaidM, HussainS, RehmanW, MehmoodR, SajidM, KhanM N, KhanK M. Synthesis, in vitro evaluation and molecular docking studies of thiazole derivatives as new inhibitors of α-glucosidase. Bioorganic Chemistry, 2015, 62 : 15– 21

[19] SadiqF A, YanB W, ZhaoJ X, ZhangH, ChenW. Untargeted metabolomics reveals metabolic state of Bifidobacterium bifidum in the biofilm and planktonic states. LWT, 2020, 118 : 108772– 108779

[20] CaoS, ZhouX, JinW B, WangF, TuR J, HanS F, ChenH Y, ChenC, XieG J, MaF. Improving of lipid productivity of the oleaginous microalgae Chlorella pyrenoidosa via atmospheric and room temperature plasma (ARTP). Bioresource Technology, 2017, 244 : 1400– 1406

[21] FangM Y, JinL H, ZhangC, TanY Y, JiangP X, GeN, LiH P, XingX H. Rapid mutation of Spirulina platensis by a new mutagenesis system of atmospheric and room temperature plasmas (ARTP) and generation of a mutant library with diverse phenotypes. PLoS One, 2013, 8( 10): e77046

[22] WangL Y, HuangZ L, LiG, ZhaoH X, XingX H, SunW T, LiH P, GouZ X, BaoC Y. Novel mutation breeding method for Streptomyces avermitilis using an atmospheric pressure glow discharge plasma. Journal of Applied Microbiology, 2010, 108( 3): 851– 858

[23] LilgeL, VahidinasabM, AdiekI, BeckerP, NesamaniC K, TreinenC, HoffmannM, HeraviK M, HenkelM, HausmannR. Expression of degQ gene and its effect on lipopeptide production as well as formation of secretory proteases in Bacillus subtilis strains. MicrobiologyOpen, 2021, 10( 5): 1– 10

[24] TsugeK, AnoT, HiraiM, NakamuraY, ShodaM. The genes degQ, pps, and lpa-8 (sfp) are responsible for conversion of Bacillus subtilis 168 to plipastatin production. Antimicrobial Agents and Chemotherapy, 1999, 43( 9): 2183– 2192

[25] SteinT, KlugeB, VaterJ, FrankeP, OttoA, WittmannlieboldB. Gramicidin-S synthetase-1 (phenylalanine racemase), a prototype of amino-acid racemases containing the cofactor 4′-phosphopantetheine. Biochemistry, 1995, 34( 14): 4633– 4642

[26] BuX Z, WuX M, NgN L J, MakC K, QinC G, GuoZ H. Synthesis of gramicidin S and its analogues via an on-resin macrolactamization assisted by a predisposed conformation of the linear precursors. Journal of Organic Chemistry, 2004, 69( 8): 2681– 2685

[27] LiuH X, GaoL, HanJ Z, MaZ, LuZ X, DaiC, ZhangC, BieX M. Biocombinatorial synthesis of novel lipopeptides by COM domain-mediated reprogramming of the plipastatin NRPS complex. Frontiers in Microbiology, 2016, 7 : 1801

[28] HeinzelmannE, BergerS, PukO, ReichensteinB, WohllebenW, SchwartzD. A glutamate mutase is involved in the biosynthesis of the lipopeptide antibiotic friulimicin in Actinoplanes friuliensis. Antimicrobial Agents and Chemotherapy, 2003, 47( 2): 447– 457

[29] WangJ Q, GuoR J, WangW C, MaG Z, LiS D. Insight into the surfactin production of Bacillus velezensis B006 through metabolomics analysis. Journal of Industrial Microbiology & Biotechnology, 2018, 45( 12): 1033– 1044

[30] QiuY M, WangQ, ZhuC J, YangQ Q, ZhouS Y, XiangZ W, ChenS W. Deciphering metabolic responses of biosurfactant lichenysin on biosynthesis of poly-glutamic acid. Applied Microbiology and Biotechnology, 2019, 103( 10): 4003– 4015

[31] FarresM, PlatikanovS, TsakovskiS, TaulerR. Comparison of the variable importance in projection (VIP) and of the selectivity ratio (SR) methods for variable selection and interpretation. Journal of Chemometrics, 2015, 29( 10): 528– 536

[32] HalmschlagB, PutriS P, FukusakiE, BlankL M. Identification of key metabolites in poly-γ-glutamic acid production by tuning γ-PGA synthetase expression. Frontiers in Bioengineering and Biotechnology, 2020, 8 : 1– 14

[33] WuJ Y, LiaoJ H, ShiehC J, HsiehF C, LiuY C. Kinetic analysis on precursors for iturin A production from Bacillus amyloliquefaciens BPD1. Journal of Bioscience and Bioengineering, 2018, 126( 5): 630– 635

[34] ChenX Y, SunH Z, QiaoB, MiaoC H, HouZ J, XuS J, XuQ M, ChengJ S. Improved the lipopeptide production of Bacillus amyloliquefaciens HM618 under co-culture with the recombinant Corynebacterium glutamicum producing high-level proline. Bioresource Technology, 2022, 349 : 126863

[35] KlenchinV A, SchmidtD M, GerltJ A, RaymentI. Evolution of enzymatic activities in the enolase superfamily: structure of a substrate-liganded complex of the L-Ala-D/L-Glu epimerase from Bacillus subtilis. Biochemistry, 2004, 43( 32): 10370– 10378

[36] XuG Q, ZhaJ, ChengH, IbrahimM H A, YangF, DaltonH, CaoR, ZhuY X, FangJ H, ChiK J, ZhengP, ZhangX, ShiJ, XuZ, GrossR A, KoffasM A G. Engineering Corynebacterium glutamicum for the de novo biosynthesis of tailored poly-γ-glutamic acid. Metabolic Engineering, 2019, 56 : 39– 49

[37] ZhangC, WuD J, QiuX L. Stimulatory effects of amino acids on γ-polyglutamic acid production by Bacillus subtilis. Scientific Reports, 2018, 8( 1): 1– 9

[38] NiuD D, LiC Y, WangP, HuangL, McHunuN P, SinghS, PriorB A, YeX Y. Twin-arginine signal peptide of Bacillus licheniformis GlmU efficiently mediated secretory expression of protein glutaminase. Electronic Journal of Biotechnology, 2019, 42 : 49– 55

[39] ZhangQ, ChenY Z, GaoL, ChenJ G, MaX, CaiD B, WangD, ChenS W. Enhanced production of poly-γ-glutamic acid via optimizing the expression cassette of Vitreoscilla hemoglobin in Bacillus licheniformis. Synthetic and Systems Biotechnology, 2022, 7( 1): 567– 573

[40] ChanetonB, HillmannP, ZhengL, MartinA C L, MaddocksO D K, ChokkathukalamA, CoyleJ E, JankevicsA, HoldingF P, VousdenK H, FrezzaC, O’ReillyM, GottliebE. Serine is a natural ligand and allosteric activator of pyruvate kinase M2. Nature, 2012, 491( 7424): 458– 462

[41] YehC M, WangJ P, LoS C, ChanW C, LinM Y. Chromosomal integration of a synthetic expression control sequence achieves poly-γ-glutamate production in a Bacillus subtilis strain. Biotechnology Progress, 2010, 26( 4): 1001– 1007

[42] ShaY Y, SunT, QiuY B, ZhuY F, ZhanY J, ZhangY T, XuZ Q, LiS, FengX H, XuH. Investigation of glutamate dependence mechanism for poly-γ-glutamic acid production in Bacillus subtilis on the basis of transcriptome analysis. Journal of Agricultural and Food Chemistry, 2019, 67( 22): 6263– 6274

[43] FukushimaT, UchidaN, IdeM, KodamaT, SekiguchiJ. DL-endopeptidases function as both cell wall hydrolases and poly-γ-glutamic acid hydrolases. Microbiology (Reading, England), 2018, 164( 3): 277– 286

[44] HoffmannS L, JungmannL, SchiefelbeinS, PeyrigaL, CahoreauE, PortaisJ C, BeckerJ, WittmannC. Lysine production from the sugar alcohol mannitol: design of the cell factory Corynebacterium glutamicum SEA-3 through integrated analysis and engineering of metabolic pathway fluxes. Metabolic Engineering, 2018, 47 : 475– 487

[45] IsraelsenW J, Vander HeidenM G. Pyruvate kinase: function, regulation and role in cancer. Seminars in Cell & Developmental Biology, 2015, 43 : 43– 51

[46] SonensheinA L. Control of key metabolic intersections in Bacillus subtilis. Nature Reviews. Microbiology, 2007, 5( 12): 917– 927

[47] YuW, ChenZ, ShenL, WangY, LiQ, YanS, ZhongC J, HeN. Proteomic profiling of Bacillus licheniformis reveals a stress response mechanism in the synthesis of extracellular polymeric flocculants. Biotechnology and Bioengineering, 2016, 113( 4): 797– 806

Acknowledgements

This work was financially supported by the National Natural Science Foundation of China (Grant Nos. 32170061 and 31871779).

Primers used in qRT-PCR in this experiment

Gene	Primer sequence (5’ to 3’)
q-crr-F	TCAAGCCGCATCCACC
q-crr-R	AAGTTCTCCAATAAAATCTCCC
q-pyk-F	CAGCCGCTTTTTCAAGGGAC
q-pyk-R	CAGCCGCTTTTTCAAGGGAC
q-pdh-F	CTCTTGTCATTGGTGCGGGA
q-pdh-R	CATTCTCATAGCGGTGGCCT
q-pgi-F	CTTTCGGCAGCACATTG
q-pgi-R	GTCGCCCACCATACCAT
q-glpk-F	GCGTGCCTAAACCTACAAA
q-glpk-R	CGTGATGGGCTGAGAATG
q-gapB-F	ACGCTGGAGACGATTGC
q-gapB-R	CCACGGAAGAAGTTTAGGG
q-capA-F	CCATTTGCGAAGGAGTTT
q-capA-R	GCTGACGAAGCAGGAGAA
q-capB-F	GAATTGTCTGCGACGATGACT
q-capB-R	GATGGGACCGACTTTGGAT
q-capC-F	AGCGTAATCGTTAATCCCTGTC
q-capC-R	CGGTGATGCCGTTTGAGA
q-glnA-F	AGTCATGGTCAAAGCCCTCG
q-glnA-R	CTCCCAAGGGTGGACTTGTG
q-gltA-F	GGCAACAAAGTGTATCC
q-gltA-R	TCGGTGAGGCTCCAGTG
q-gltB-F	AGCGTCGTCCAGTTCGG
q-gltB-R	CGCCTCTTCATAAGCATAGT
q-pdgS-R	AGACATCTTGAGGGTGCG
q-pdgS-R	TCCGTTTGATTTTGTGCTG
q-ccpN-F	CCTGTTTGCCGATGCTG
q-ccpN-R	CGCGGGTCGGTTATTTC
q-ccpA-F	CGAGCCGTAAAGGAACA
q-ccpA-R	GCTTGCCATTTGAGGAA
q-16S-F	CAGATTTGTGGGATTGGCTTAG
q-16S-R	CGTGTCGTGAGATGTTGGGT

RIGHTS & PERMISSIONS

2022 Higher Education Press