iTRAQ-based quantitative analysis of cancer-derived secretory proteome reveals TPM2 as a potential diagnostic biomarker of colorectal cancer

Abstract

Colorectal cancer (CRC) is a leading cause of cancer-related deaths worldwide. We aimed to find novel molecules as potential biomarkers for the early diagnosis of CRC. A serum-free conditioned medium was successfully collected from three pairs of CRC tissue and adjacent normal tissue. iTRAQ-based quantitative proteomic analysis was applied to compare the differences in secretome between primary CRC mucosa and adjacent normal mucosa. A total of 145 kinds of proteins were identified. Of these proteins, 29 were significantly different between CRC and normal tissue. Tropomyosin 2 β (TPM2) exhibited the most significant differences; as such, this protein was selected for further validation. Quantitative real-time PCR indicated that the mRNA expression of TPM2 significantly decreased in the CRC tissue compared with the paired adjacent normal tissue. Immunohistochemical analysis also confirmed that TPM2 was barely detected at protein levels in the CRC tissue. In summary, this study revealed potential molecules for future biomarker applications and provided an efficient approach for the differential analysis of cancer-associated secretome. TPM2 may be valuable for the early diagnosis of CRC.

Keywords

iTRAQ / secretome / colorectal cancer / TPM2

Introduction

Colorectal cancer (CRC) is a common malignant tumor. It causes significant morbidity and mortality among males and females, especially individuals in developed countries [ 1]. In China, the incidence of CRC has increased rapidly; as a consequence, this disease has been ranked as the fifth most common cancer type. For instance, 310 244 new cases in this country were diagnosed as CRC in 2011, and this disease caused 149 722 deaths [ 2]. The survival rate of patients decreases as the stages of CRC advance [ 3, 4]. Most patients in China are diagnosed in advanced stages, and 10% are diagnosed in early stages (stages I and II) [ 5]. As a result, the 5-year survival rate of patients is low. Therefore, early diagnosis is a key problem.

Colonoscopy and sigmoidoscopy are the most sensitive procedures used to detect CRC. However, researchers experience difficulty in applying these techniques on a large scale because of high costs and invasiveness [ 6, 7]. Fecal occult blood testing (FOBT) is another widely used approach characterized by cost effectiveness and non-invasiveness. Nevertheless, its sensitivity and specificity are lower than those of endoscopy; FOBT is also usually effective in late stages of CRC [ 8]. Serum carcinoembryonic antigen has also been recommended for CRC diagnosis [ 9, 10], but this substance exhibits inadequate sensitivity and specificity for the early diagnosis of CRC (stages I and II) [ 11]. Therefore, diagnostic biomarkers should be developed to detect CRC in early stages.

Optimum and acceptable biomarkers for cancer screening and monitoring should be obtained from a body fluid sample [ 12, 13]. CRC biomarkers can be detected through a differential proteomic analysis of blood. Serum biomarkers have been described and used for non-invasive testing to detect CRC [ 14, 15]. Potential biomarkers have also been identified by evaluating CRC cell line-derived secretome [ 16]. Through secretome studies, a useful database of cancer-secreted proteins has been established; these proteins can be used as potential biomarkers measurable in blood or urine samples via non-invasive assays. However, biomarker testing is limited by various factors, including highly complex blood proteome and pathologically relevant cell line secretome. Serum or plasma samples also contain numerous proteins in various concentrations [ 17]. The level of serological markers for cancer is usually very low. Therefore, adequate protein enrichment techniques should be employed before mass spectrometric analysis is conducted [ 18, 19]. Current methods are also characterized by drawbacks. To address this issue, Xiao and his colleagues [ 20] developed a novel approach based on a primary tumor tissue culture and collected proteins specifically secreted by tumors. The proteins from a serum-free conditional medium (CM) are then identified through LC-MS/MS. Thus, a rich set of potential biomarkers for lung cancer has been detected [ 20– 22].

With the development of mass spectrometric techniques, isobaric tag for relative and absolute quantitation (iTRAQ)-based quantitative proteomic analysis has become a promising technology to identify differentially expressed proteins. In our study, a serum-free primary culture system was used, and iTRAQ-based LC-MS/MS was performed. The CRC secretome, which may contain potential biomarkers for the serologic diagnosis of CRC, was then subjected to protein profiling.

Materials and methods

Ethics statement and human samples

Three cases of CRC and paired normal mucosa located 5 cm from the tumor were collected for primary organ culture. A total of 62 cases (5 cases of T1, 15 cases of T2, 28 cases of T3, and 12 cases of T4) were collected for quantitative PCR and 37 cases (4 cases of T1, 5 cases of T2, 24 cases of T3, and 4 cases of T4) were obtained for immunohistochemical analysis. The tissue samples were histologically confirmed by a pathologist. The corresponding clinicopathological data of three tissue samples for the sample culture are listed in Table 1.

CRC samples and matched normal mucosa were obtained through surgical resection at Cancer Hospital, Chinese Academy of Medical Sciences (CAMS) from 2010 to 2014. All patients received no anti-cancer treatment before surgery and signed informed consent forms for sample collection. The procedures related to human samples were approved by the Review Board of CAMS Cancer Institute.

Primary organ culture and CM preparation

A primary organ culture was prepared in accordance with previously published procedures with minor revisions [ 20]. Fresh tissue samples were immersed in serum-free DMEM/F12 medium with 1% penicillin and streptomycin for 30 min. The samples were then cut into 2–3 mm³ pieces and transferred to 60 mm culture dishes. The tissue samples were cultivated in serum-free LHC-9 medium. The culture dishes were placed on a rocking platform supported by a gas mixture of 50% O₂, 45% N₂, and 5% CO₂ at 37 °C. After 24 h, the culture medium was replaced with serum-free LHC-9 without bovine pituitary extract. The culture medium was collected after another 24 h. The collected CM was dialyzed by using an Amicon Ultra-15 centrifugal filter (Millipore, MA, USA) and stored at -80 °C for further analysis. Afterward, a piece of explant was chosen randomly and histopathologically examined to test the integrity of the tissue sample.

iTRAQ

For iTRAQ labeling, 200 mg of proteins were used. CM proteins from three cancer tissue samples and normal mucosa were mixed in equal quantity. Proteins were denaturated by 2% SDS, reduced by a reducing agent (TCEP), and alkylated by a cysteine blocking agent (MMTS). Protein samples were then digested by trypsin. Tryptic peptides from each CM sample were divided into equal halves and subjected to iTRAQ labeling (iTRAQ Multiplex kit; Applied Biosystems/MDS Sciex, Foster City, CA). The labeled peptides from each condition were reconstituted in 10 mmol/L KH₂PO₄ with 20% ACN (pH= 2.8).

Strong cation exchange (SCX) chromatography-based fractionation

SCX chromatography was performed as previously described [ 23]. The peptides were fractionated on a polysulfoethyl A column (200 mm× 2.1 mm, 5 mm, 300 Å, Poly LC, Columbia, MD, USA) by using an Agilent 1200 LC system (Agilent Technologies). Peptide fractions were collected every minute via a linear gradient of solvent B (350 mmol/L KCl in solvent A, pH= 2.8). The pooled fractions were desalted by using C18 stage tips (3M Empore, SDB-XC, product number 2240/2340).

LC-MS/MS

MS analyses were conducted by Beijing Protein Innovation facilities. Nano LC-MS/MS analysis was performed on a Proxeon Easy nano-LC connected to a MicroTOF-Q (Bruker). Peptide mixtures were loaded onto a 75 mm i.d. 10 cm length C18 BEH column (Waters, Milford, MA) packed with 1.7 mm particles with a pore of 130 Å and then separated by a segmented gradient of solvent B (CAN with 0.1% formic acid) from 5% to 80% in 120 min at a flow rate of 300 nl/ min. Solvent A was 0.1% formic acid in water. MicroTOF-Q II mass spectrometer was operated in positive ionization mode. The MS survey scan for all experiments was performed in a FT cell that records a window between 50 and 3000 m/z.

Protein identification

The obtained MS data were also analyzed by Beijing Protein Innovation facilities. Data were analyzed using SEQUEST algorithm against the NCBI Human RefSeq database. Parameters involved in the analysis used trypsin as the enzyme, allowing 1 missed cleavage. The selection criteria for the confidential list of differential proteins were set as≥2 peptides, single peptide with multiple PSMs, and P≤0.05.

Bioinformatics analysis

The basic properties of the CM protein database were analyzed with GOFFA and DAVAID.

RNA isolation, RT and PCR

Total RNA was isolated from a patient sample by using TRIzol reagent (Invitrogen), treated with DNase I, and reverse-transcribed by using a transcription kit (Invitrogen) to obtain total cDNA as a template. The primers used for quantitative PCR were purchased from Sangon Biotech. Quantitative real-time PCR was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Primers for regular PCR of TPM2 and GAPDH were as follows: TPM2 forward: GCTGAGACCCGAGCAGAGTT, TPM2 reverse: GTGATGTCATTGAGTGCGTTGT; GAPDH forward: GACGCTGGGGCTGGCATTG, GAPDH reverse: GCTGGTGGTCCAGGGGTC.

Immunohistochemistry

The CRC tissue fragments from the dense tumor area and the paired normal tissue were sampled by pathologist. Immunohistochemistry was performed using a 5 mm section of a paraffin-embedded specimen via a standard immunohistochemical technique. The slides were deparaffinized, rehydrated, and dripped in 3% hydrogen peroxide solution for 15 min. For antigen retrieval, the slides were heated in a citrate buffer (pH= 6.0) at 95 °C for 15 min and slowly cooled to room temperature. The sections were incubated with anti-TPM2 (1:100) overnight at 4 °C and incubated with a second antibody (goat anti-Rabbit IgG/goat anti-rabbit/IgG 1:100 dilution) for 30 min at 37 °C. Diaminobenzidine solution was used to develop the slides. After hematoxylin counterstaining, immunostaining was scored by two independent, experienced pathologists. Immunoreactivity of detected proteins was recorded by intensity of staining and percentage of immunoreactive cell as follows: tissue with no staining was rated 0, faint or moderate to strong staining in<25% of cell rated 1, strong staining in 25%–50% of cell rated 2, and strong staining in>50% of cell rated 3.

Statistical analysis

Statistical analyses were conducted with SPSS software. Data were analyzed via Student’s t-test to evaluate the difference in the immunohistochemical staining results of TPM2 between CRC tissue and paired normal tissue. The mRNA levels of TPM2 between groups were also compared via Student’s t-test. χ² testing was conducted to analyze the data and evaluate the correlation between the expression of TPM2 and the clinical pathological characteristic of CRC samples. Differences were considered significant at P<0.05.

Results

Sample preparation and quality control

Using the serum-free primary culture system, we successfully obtained CM from three pairs of CRC tissue and adjacent normal tissue. The protein concentration of CM samples derived from tumor tissue was 4.2±0.69 mg/ml, while that of normal tissue was much lower, 0.91±0.22 mg/ml. For quality monitoring, CM samples of equal amounts were separated by 10% SDS-PAGE, and the gel was stained with Coomassie to visualize the difference between the two groups (Fig. 1).

Identification of differential protein in CM by iTRAQ

A total of 145 proteins were identified through iTRAQ based LC-MS/MS. Of these proteins, 29 (Table 2) were differentially expressed in the CM of CRC tissue compared with the CM of adjacent normal tissue (change fold>1.5). Of the 29 differentially expressed proteins, 9 were downregulated and 20 were upregulated in CRC tissue compared with normal tissue.

To obtain a systematic overview, we subjected the secretome data set to Gene Ontology analysis and categorized our findings on the basis of their cellular components by using GOFFA. Of the 29 differential proteins, 18% were extracellular proteins (Fig. 2A). The data set was also analyzed to cluster the differentially expressed proteins in CM into functional annotation terms of the DAVID annotation system. The most significant molecular functions were “actin-binding” and “acetylation” (Fig. 2B).

Analysis of TPM2 in CRC tissue and paired normal colon tissue

To confirm the results obtained from iTRAQ-based LC-MS/MS analysis, we further analyzed tropomyosin 2 β (TPM2), which exhibited the most significant decrease in the CM of CRC. First, the mRNA expression of TPM2 was detected in 62 CRC tissue samples and adjacent normal tissue through real-time PCR. The TPM2 level was significantly lower in the CRC tissue than in the normal tissue (Fig. 3A; P<0.001). The TPM2 expression was also significantly decreased in the early stage of CRC (T1 and T2 stage; Fig. 3B).

To evaluate the TPM2 expression at a protein level, we evaluated 37 CRC tissue samples and paired adjacent normal tissue through immunohistochemical staining. TPM2 was predominantly localized in stromal cells but not epithelial or tumor cells (Fig. 3C). Moreover, positive staining of TPM2 was observed in only 13.5% (5/37) of CRC tissue and 89.2% (33/37) in normal tissue (P<0.001; Fig. 3D). The correlation between TPM2 expression and clinical pathological factors was also analyzed (Table 3). None (0/9) of the early-stage CRC tissue samples showed positive staining. Thus, TPM2 could be valuable for early diagnosis of CRC.

Discussion

Over the last few decades, novel and effective biomarkers have been developed to diagnose CRC in early stages. Body fluids, including blood plasma and serum, are an important resource for biomarker mining. CRC biomarkers have been evaluated by analyzing serum peptide profiles through mass spectrometry combined with bioinformatics [ 24– 26]. Unfortunately, these techniques are limited by the complexity of proteome in body fluids. Proteins with high concentrations in circulating plasma also hamper the identification of proteins with low concentrations, which are more often of clinical significance. Given the limitations of blood-based biomarker discovery, an alternative approach to biomarker discovery is to analyze the secretome of cancer tissue and cancer cell lines [ 27– 30].

Secretome is a set of proteins released by cells, tissue, or primary organisms. Our study successfully established a serum-free primary culture system suitable for CRC primary organ culture [ 20]. The tissue sample maintained integrity throughout the process, and the quantity of secretome was sufficient for further analysis. Ultimately, 145 non-redundant proteins were identified; of these proteins, 29 changed significantly (change fold>1.5) in CM of the CRC mucosa compared with the normal mucosa. A potential serological marker should be a protein secreted by tumor cells into the blood. In our results, about 18% of CM proteins obtained (as shown in Fig. 2A) are abundant in the extracellular region.

Periostin, an extracelluar protein, increased 9-fold in CM of CRC tissue, making it a putative biomarker for CRC. Other articles have also revealed that the expression of periostin increases in 80% of CRC tissue [ 31]. Periostin is also significantly increased in serum from CRC patients compared with that from healthy volunteers, polyps, or adenomas. Moreover, high levels of periostin in serum are significantly correlated with distant metastasis, advanced stage, and poor prognosis [ 32]. Overexpression of periostin in CRC cells greatly promotes cancer cell metastasis by preventing stress-induced apoptosis and enhancing endothelial cell survival. Periostin increases cellular survival by activating Akt/PKB signaling pathways [ 33]. Thus, the identification of periostin authenticates the reliability of the CRC secretome obtained in our study.

Considering that protein can be secreted to extracellular regions through non-classic secretion or exosomes [ 29], we chose TPM2, the most downregulated protein, for further verification. Quantitative real-time PCR and immunostaining results revealed that the TPM2 expression is remarkably decreased in the CRC tissue compared with the normal mucosa. Thus, TPM2 may be a biomarker candidate for CRC. Several early studies also showed that TPM2 was downregulated in human esophageal squamous cell carcinoma [ 34] and upregulated in ovarian cancer [ 35] and breast cancer [ 36]. TPM2 can be detected in the serum of ovarian cancer patients, and the TPM2 expression level is higher in the serum sample of ovarian cancer patients than in the serum sample of healthy volunteers [ 35]. Thus, TPM2 could be a putative serological biomarker for CRC. However, the TPM2 expression in the serum of CRC patients should be further investigated.

In conclusion, a CRC-associated secretome was constructed on the basis of a serum-free primary culture model. TPM2 was selected for validation in CRC samples. A larger scale test should be conducted to confirm that TPM2 could be a potential diagnostic biomarker of CRC. Our study provided a set of potential biomarkers for CRC. Further studies should be performed to verify additional biomarker candidates in the data set.

References

[1] Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin 2015; 65(2): 87–108

[2] Chen W, Zheng R, Zeng H, Zhang S, He J. Annual report on status of cancer in China, 2011. Chin J Cancer Res 2015; 27(1): 2–12

[3] Smith RA, Cokkinides V, Brawley OW. Cancer screening in the United States, 2008: a review of current American Cancer Society guidelines and cancer screening issues. CA Cancer J Clin 2008; 58(3): 161–179

[4] Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin 2011; 61(2): 69–90

[5] Jiang X, Wang Y, Wang H, Geng M, Liu YL. Typical symptoms of colorectal cancer and its influence in timely diagnosis. Natl J Med China (Zhonghua Yi Xue Za Zhi) 2013; 93(4): 275–279 (in Chinese)

[6] He J, Efron JE. Screening for colorectal cancer. Adv Surg 2011; 45(1): 31–44

[7] Moawad FJ, Maydonovitch CL, Cullen PA, Barlow DS, Jenson DW, Cash BD. CT colonography may improve colorectal cancer screening compliance. AJR Am J Roentgenol 2010; 195(5): 1118–1123

[8] Parra-Blanco A, Gimeno-García AZ, Quintero E, Nicolás D, Moreno SG, Jiménez A, Hernández-Guerra M, Carrillo-Palau M, Eishi Y, López-Bastida J. Diagnostic accuracy of immunochemical versus guaiac faecal occult blood tests for colorectal cancer screening. J Gastroenterol 2010; 45(7): 703–712

[9] Bhatti I, Patel M, Dennison AR, Thomas MW, Garcea G. Utility of postoperative CEA for surveillance of recurrence after resection of primary colorectal cancer. Int J Surg 2015; 16(Pt A):123–128

[10] Tan E, Gouvas N, Nicholls RJ, Ziprin P, Xynos E, Tekkis PP. Diagnostic precision of carcinoembryonic antigen in the detection of recurrence of colorectal cancer. Surg Oncol 2009; 18(1): 15–24

[11] Duffy MJ. Carcinoembryonic antigen as a marker for colorectal cancer: is it clinically useful? Clin Chem 2001; 47(4): 624–630

[12] Veenstra TD, Conrads TP, Hood BL, Avellino AM, Ellenbogen RG, Morrison RS. Biomarkers: mining the biofluid proteome. Mol Cell Proteomics 2005; 4(4): 409–418

[13] Schmidt A, Aebersold R. High-accuracy proteome maps of human body fluids. Genome Biol 2006; 7(11): 242

[14] Liu Z, Zhang Y, Niu Y, Li K, Liu X, Chen H, Gao C. A systematic review and meta-analysis of diagnostic and prognostic serum biomarkers of colorectal cancer. PLoS ONE 2014; 9(8): e103910

[15] Yao L, Lao W, Zhang Y, Tang X, Hu X, He C, Hu X, Xu LX. Identification of EFEMP2 as a serum biomarker for the early detection of colorectal cancer with lectin affinity capture assisted secretome analysis of cultured fresh tissues. J Proteome Res 2012; 11(6): 3281–3294

[16] de Wit M, Kant H, Piersma SR, Pham TV, Mongera S, van Berkel MP, Boven E, Pontén F, Meijer GA, Jimenez CR, Fijneman RJ. Colorectal cancer candidate biomarkers identified by tissue secretome proteome profiling. J Proteomics 2014; 99: 26–39PMID:24418523

[17] Tang HY, Ali-Khan N, Echan LA, Levenkova N, Rux JJ, Speicher DW. A novel four-dimensional strategy combining protein and peptide separation methods enables detection of low-abundance proteins in human plasma and serum proteomes. Proteomics 2005; 5(13): 3329–3342

[18] Rai AJ, Gelfand CA, Haywood BC, Warunek DJ, Yi J, Schuchard MD, Mehigh RJ, Cockrill SL, Scott GB, Tammen H, Schulz-Knappe P, Speicher DW, Vitzthum F, Haab BB, Siest G, Chan DW. HUPO Plasma Proteome Project specimen collection and handling: towards the standardization of parameters for plasma proteome samples. Proteomics 2005; 5(13): 3262–3277

[19] Fang X, Zhang WW. Affinity separation and enrichment methods in proteomic analysis. J Proteomics 2008; 71(3): 284–303

[20] Xiao T, Ying W, Li L, Hu Z, Ma Y, Jiao L, Ma J, Cai Y, Lin D, Guo S, Han N, Di X, Li M, Zhang D, Su K, Yuan J, Zheng H, Gao M, He J, Shi S, Li W, Xu N, Zhang H, Liu Y, Zhang K, Gao Y, Qian X, Cheng S. An approach to studying lung cancer-related proteins in human blood. Mol Cell Proteomics 2005; 4(10): 1480–1486

[21] Lou X, Xiao T, Zhao K, Wang H, Zheng H, Lin D, Lu Y, Gao Y, Cheng S, Liu S, Xu N. Cathepsin D is secreted from M-BE cells: its potential role as a biomarker of lung cancer. J Proteome Res 2007; 6(3): 1083–1092

[22] Li M, Xiao T, Zhang Y, Feng L, Lin D, Liu Y, Mao Y, Guo S, Han N, Di X, Zhang K, Cheng S, Gao Y. Prognostic significance of matrix metalloproteinase-1 levels in peripheral plasma and tumour tissues of lung cancer patients. Lung Cancer 2010; 69(3): 341–347

[23] Polisetty RV, Gautam P, Sharma R, Harsha HC, Nair SC, Gupta MK, Uppin MS, Challa S, Puligopu AK, Ankathi P, Purohit AK, Chandak GR, Pandey A, Sirdeshmukh R. LC-MS/MS analysis of differentially expressed glioblastoma membrane proteome reveals altered calcium signaling and other protein groups of regulatory functions. Mol Cell Proteomics 2012; 11(6): 013565

[24] Albrethsen J, Bøgebo R, Gammeltoft S, Olsen J, Winther B, Raskov H. Upregulated expression of human neutrophil peptides 1, 2 and 3 (HNP 1-3) in colon cancer serum and tumours: a biomarker study. BMC Cancer 2005; 5(1): 8

[25] Ward DG, Suggett N, Cheng Y, Wei W, Johnson H, Billingham LJ, Ismail T, Wakelam MJ, Johnson PJ, Martin A. Identification of serum biomarkers for colon cancer by proteomic analysis. Br J Cancer 2006; 94(12): 1898–1905

[26] de Noo ME, Mertens BJ, Ozalp A, Bladergroen MR, van der Werff MP, van de Velde CJ, Deelder AM, Tollenaar RA. Detection of colorectal cancer using MALDI-TOF serum protein profiling. Eur J Cancer 2006; 42(8): 1068–1076

[27] Pavlou MP, Diamandis EP. The cancer cell secretome: a good source for discovering biomarkers? J Proteomics 2010; 73(10): 1896–1906

[28] Xue H, Lü B, Zhang J, Wu M, Huang Q, Wu Q, Sheng H, Wu D, Hu J, Lai M. Identification of serum biomarkers for colorectal cancer metastasis using a differential secretome approach. J Proteome Res 2010; 9(1): 545–555

[29] Volmer MW, Stühler K, Zapatka M, Schöneck A, Klein-Scory S, Schmiegel W, Meyer HE, Schwarte-Waldhoff I. Differential proteome analysis of conditioned media to detect Smad4 regulated secreted biomarkers in colon cancer. Proteomics 2005; 5(10): 2587–2601

[30] Shi HJ, Stubbs R, Hood K. Characterization of de novo synthesized proteins released from human colorectal tumour explants. Electrophoresis 2009; 30(14): 2442–2453

[31] Kikuchi Y, Kashima TG, Nishiyama T, Shimazu K, Morishita Y, Shimazaki M, Kii I, Horie H, Nagai H, Kudo A, Fukayama M. Periostin is expressed in pericryptal fibroblasts and cancer-associated fibroblasts in the colon. J Histochem Cytochem 2008; 56(8): 753–764

[32] Ben QW, Zhao Z, Ge SF, Zhou J, Yuan F, Yuan YZ. Circulating levels of periostin may help identify patients with more aggressive colorectal cancer. Int J Oncol 2009; 34(3): 821–828

[33] Bao S, Ouyang G, Bai X, Huang Z, Ma C, Liu M, Shao R, Anderson RM, Rich JN, Wang XF. Periostin potently promotes metastatic growth of colon cancer by augmenting cell survival via the Akt/PKB pathway. Cancer Cell 2004; 5(4): 329–339

[34] Zhang J, Wang K, Zhang J, Liu SS, Dai L, Zhang JY. Using proteomic approach to identify tumor-associated proteins as biomarkers in human esophageal squamous cell carcinoma. J Proteome Res 2011; 10(6): 2863–2872

[35] Tang HY, Beer LA, Tanyi JL, Zhang R, Liu Q, Speicher DW. Protein isoform-specific validation defines multiple chloride intracellular channel and tropomyosin isoforms as serological biomarkers of ovarian cancer. J Proteomics 2013; 89: 165–178

[36] Li DQ, Wang L, Fei F, Hou YF, Luo JM, Zeng R, Wu J, Lu JS, Di GH, Ou ZL, Xia QC, Shen ZZ, Shao ZM. Identification of breast cancer metastasis-associated proteins in an isogenic tumor metastasis model using two-dimensional gel electrophoresis and liquid chromatography-ion trap-mass spectrometry. Proteomics 2006; 6(11): 3352–3368PMID:16637015

RIGHTS & PERMISSIONS

Higher Education Press and Springer-Verlag Berlin Heidelberg