Zfyve16 regulates the proliferation of B-lymphoid cells

Abstract

Zfyve16 (a.k.a. endofin or endosome-associated FYVE-domain protein), a member of the FYVE-domain protein family, is involved in endosomal trafficking and in TGF-β, BMP, and EGFR signaling. The FYVE protein SARA regulates the TGF-β signaling pathway by recruiting Smad2/3 and accelerating their phosphorylation, thereby altering their susceptibility to TGF-β-mediated T cell suppression. Zfyve16 binds to Smad4 and their binding affects the formation of Smad2/3-Smad4 complex in TGF-β signaling. However, the in vivo function of Zfyve16 remains unknown. In this study, we generated a Zfyve16 knockout mouse strain (Zfyve16^KO) and examined its hematopoietic phenotypes and hematopoietic reconstruction ability. The proportion of T cells in the peripheral blood of Zfyve16^KO mice increases compared with that in wild-type mice. This finding is consistent with the role of Zfyve16 in facilitating TGF-β signaling. Unpredictably, B cell proliferation is inhibited in Zfyve16^KO mice. The proliferation potential of Zfyve16^KO B-lymphoid cells also significantly decreases in vitro. These results suggest that Zfyve16 inhibits the proliferation of T cells, possibly through the TGF-β signaling, but upregulates the proliferation of B-lymphoid cells.

Keywords

Zfyve16 / endofin / hematopoiesis / TGF-β / lymphocytes

Introduction

The Zfyve16 gene encodes endofin (endosome-associated FYVE-domain protein), an evolutionarily conserved large protein of 250 kDa [¹]. Endofin is a member of the FYVE domain family and contains a highly conserved FYVE motif and a Smad binding domain (SBD). The FYVE domain is a highly conserved zinc-finger domain and contains eight conserved cysteine residues, which coordinate two Zn²⁺ ions in a “cross-braced” topology [²–⁴]. This domain also contains other conserved residues, such as the R(R/K)HHCRxCG motif surrounding a third and a fourth cysteine residue and arginine at position 74 [⁵]. With its Zn²⁺ coordination and a basic motif, the FYVE domain family proteins can bind to phosphatidylinositol-3-phosphate on the cytoplasmic surface of cell membranes [⁶–⁹]. The membrane association ability allows FYVE-containing proteins to recruit additional molecules to localize to the cell membrane.

The TGF-b signaling pathway regulates many cellular processes, including cell proliferation, differentiation, and tumor metastasis. In the hematological system, TGF-b negatively regulates cell proliferation and differentiation [¹⁰,¹¹]. TGF-b is initially secreted as a latent protein complex and requires activation to exert its biological function [¹²,¹³]. The activated TGF-b signaling pathway is primarily mediated by two receptors, namely, type II TGF-b receptor (TbRII) and type I TGF-b receptor (TbRI), which are serine/threonine kinase receptors. The TGF-b family ligands first bind to the TbRII receptor. After its autophosphorylation, TbRII phosphorylates and activates TbRI, which then phosphorylates a series of downstream signaling molecules, including receptor-regulated Smads (R-Smads) [¹⁴]. The recruitment and phosphorylation of R-Smads are key steps in the TGF-b signaling pathway and play an important role in TGF-b signaling.

The disruption of TGF-b signaling in T cells impairs the maintenance of regulatory T cells, leading to the expansion of the activated effector T cells [¹⁵–¹⁸]. A previous mouse knockout experiment reported that Smad3 plays a critical role in mediating the inhibitory effects of TGF-b signaling in T cells [¹⁸]. TGF-b signaling also inhibits the proliferation and differentiation of B lymphocytes. In particular, TGF-b-induced Smad1/5 phosphorylation inhibits the proliferation of B lymphocytes [¹⁹].

TGF-b signaling pathways can be enhanced by scaffold proteins, such as SARA, which can recruit Smad2/3 to the membrane and accelerate their phosphorylation [²⁰]. Similar to Zfyve16, SARA contains an FYVE domain and an SBD domain. The FYVE domain in SARA can recruit Smad2/3 to the vicinity of the activated TbRI and phosphorylate them [²¹]. Phospho-Smad2/3 binds to the common Smad (Smad4) to form a complex, which transfers into nuclear regulatory downstream target genes [⁶].

Similar to SARA, Zfyve16 is enriched in EEA1-positive endosomes and functions as a scaffold protein to facilitate TGF-b signaling [²²,²³]. In TGF-b signaling, Zfyve16 promotes Smad3 and Smad4 to form a heteromeric complex, which translocates to the nucleus and controls the transcription of target genes [⁶]. The target genes include apoptosis regulators, namely, Bcl-xl, Bim, Bax, and cell cycle regulators such as DAPK1. In addition, Zfyve16 binds to Smad1, and the bonding enhances Smad1 phosphorylation and nuclear localization [²⁴]. Despite these biochemical studies, the in vivo function of Zfyve16 remains unknown.

In this study, we generated a murine model with deletion of the Zfyve16 gene. The proportion of T cells in Zfyve16^KO mice increases compared with that in the wild-type mice. However, Zfyve16 deficiency exhibits an opposite effect on B-lymphoid cells. Hence, Zfyve16 plays a novel role in B lymphocyte development.

Materials and methods

Zfyve16 knockout mice

Zfyve16-deficient mice containing a “knockout-first” allele targeted to the Zfyve16 genomic locus named Zfyve16^{tm2a(KOMP)Wtsi} were obtained from the Knockout Mouse Project resource (KOMP-CSD ID:41673). Mice were genotyped using DNA extracted from mouse tails through multiplex PCR with the following primers (wild-type= 491 bp; knockout= 399 bp):

Zfyve16-F: GAGATGGCGCAACGCAATTAATG,

Zfyve16-R: TTAAGCTCAACTCAAGGCTTTCGCC,

Lox-F: GAGATGGCGCAACGCAATTAATG,

Lox-R: GTCACAGTAGCCCAAACTCACATGC.

Semi-quantitative PCR primer:

RT-F: GCCGAATGGTGAAGTTGCAG,

RT-R: TGACAAGTTG GACTCTGGCT.

Mice were bred and kept in barrier facilities. All procedures were carried out in accordance with the ethical approval of the Animal Care and Welfare Committee of Shanghai Jiao Tong University School of Medicine.

Western blot analysis

Mouse kidney cells were treated with red blood cell lysis buffer and lysed with 1× lysis buffer (#9803, Cell Signaling Technology, MA, USA) containing protease inhibitors and 1 mmol/L PMSF. Protein concentration in the supernatant was determined using a BCA Protein Assay Kit (Thermo Scientific, USA). Equal amounts of total protein from each group were separated on 10% SDS-PAGE gels and transferred to a nitrocellulose membrane. The membrane was incubated with mouse polyclonal anti-endofin antibody (1:500, A7766, Abcam, Cambridge, UK) and anti-Gapdh antibody (1:1000; Cell Signaling Technology, MA, USA). Goat-anti-rabbit IgG was used as secondary antibody.

Flow cytometry analysis

For surface staining, cells isolated from mice were treated with red blood cell lysis buffer at room temperature for 5 min and washed in cold PBS. Cells (1 × 10⁶ per assay) were incubated with conjugated antibodies (5 µg/mL) in the dark at room temperature for 20 min. Gr-1-PE, Mac-1-PE-cy7, B220-APC-cy7, and CD19-APC (BD, San Diego, CA, USA) were used to analyze hematopoietic cells of different lineages. Lineage-APC-cy7, Sca-1-PE-cy7, c-kit-APC, CD127-PE, CD16/32-Percp-cy5.5, and CD34-PE (BD, San Diego, CA, USA) were used to analyze hematopoietic stem cells (HSC) and progenitor cells (HSPCs). Nuclear staining of Ki67 was performed using FITC-conjugated Ki67 antibody (BD Pharmingen, CA, USA) and 1 × fixation/permeabilization solutions (BD Biosciences). After washing with cold PBS, the cells were resuspended in 200 µL of PBS and subjected to fluorescence-activated cell sorting (FACS) machine (LSR II system, BD Biosciences, San Jose, CA, USA). FACS data were analyzed using FlowJo, 7.6.1 software (Tree Star, San Carlos, CA, USA).

Blood cell counts

Briefly, 10 µL of blood collected from each mouse by tail vein bleeding was transferred into 1.5 mL Eppendorf tube containing 1 µL of 0.5 mol/L EDTA (BD, Pharmingen, CA, USA). Complete blood count (CBC) was determined using a pocH-100iV Diff hematology analyzer (Sysmex Corporation, Kobe, Japan).

Colony formation assay

Colony forming unit (CFU)-Pre-B assays were performed using MethoCult M3630 methylcellulose medium (StemCell Technologies, Vancouver, Canada) in accordance with the manufacturer’s instructions. Mouse bone marrow cells were isolated, plated into 3 mL of MethoCult M3630 methylcellulose medium at a density of 2 × 10⁵ cells/dish in triplicate, and cultured at 37 °C and 5% CO₂. Colonies were counted after 10 days of culture.

Statistical analysis

GraphPad Prism 5 software was used for statistical analysis of data. Statistical significance threshold was set at 0.05.

Results

Characterization of Zfyve16 knockout mice

Zfyve16-deficient mice were generated by homologous recombination in embryonic stem cells with the Zfyve16 gene locus targeted by a gene trapping cassette (Zfyve16^{tm2a(KOMP)Wtsi}), which contains a splice acceptor site En2SA, an internal ribosome entry site IRES, and a lacZ reporter between Zfyve16 exons VI and VII (Fig. 1A). The Zfyve16 knockout mouse strain was confirmed by tail-DNA PCR analysis (Fig. 1B). The disruption of the expression of Zfyve16 transcripts by the trapping cassette was confirmed by RT-qPCR analysis, although exon 7 was slightly expressed in the knockout mice (Fig. 1C). Western blot analysis showed that Zfyve16 was not expressed at the protein level because the trapping cassette also caused a frameshift mutation in Zfyve16 mRNA (Fig. 1D).

Zfyve16 knockout mice (Zfyve16^KO) were viable and fertile and exhibited no apparent abnormalities compared with the wild-type littermates. In addition, the body weight of Zfyve16 knockout mice was not significantly different from that of the wild-type mice during the 9-month observation period (Fig. 1E).

Zfyve16 modulates the proportions of lymphoid cells in peripheral blood

To examine the effect of Zfyve16 deficiency on hematopoiesis, we compared the peripheral blood of Zfyve16^KO and wild-type mice. The numbers of white blood cells (WBCs), red blood cells (RBCs), and platelets in the peripheral blood of Zfyve16^KO mice are similar to those in the wild-type controls (Fig. 2A). The frequency of myeloid cells (Gr-1⁺Mac-1⁺) in peripheral blood was not significantly different between Zfyve16^KO and wild-type mice (Fig. 2B). However, the percentage of T-lymphoid cells (CD3e⁺) in the peripheral blood of Zfyve16^KO mice is relatively higher than that in wild-type mice (Fig. 2B), while the proportion of B-lymphoid cells (CD19⁺ B220⁺) decreased compared with that of control mice. Hence, Zfyve16 regulates the development of lymphoid cells.

We also examined the proliferation of B cells in spleen, considering that most B cells in peripheral blood are quiescent. The number of splenic B cells in the G0 phase is significantly higher in Zfyve16^KO mice compared with that in wild-type mice (Fig. 2C). We also analyzed the apoptosis of B-lymphoid cells from bone marrow, spleen, and peripheral blood by using annexin V and 7AAD. The proportion of apoptotic B cells was not significantly different between Zfyve16^KO and Zfyve16^WT mice (Supplementary Fig. 1). These data indicate that Zfyve16 regulates B cell proliferation by regulating the cell cycle.

Zfyve16 modulates the frequencies of common lymphoid progenitors

We further investigated the physiological role of Zfyve16 on hematopoietic stem and progenitor cells (HSPCs). The function of Zfyve16 in the bone marrow, spleen, liver, thymus, and lymph nodes was not significantly different between Zfyve16^KO and wild-type mice (Fig. 3A and data not shown). Bone marrow analysis revealed no significant changes in LSK (Lin^-Sca-1⁺c-Kit⁺) cells and in myeloid progenitor (CMP, Lin⁻Sca-1⁻c-Kit⁺FcgR^hiCD34⁺), granulocytic and monocytic progenitor (GMP, Lin-Sca-1-c-Kit⁺FcgR^hiCD34⁺), and megakaryocytic and erytheral progenitor (MEP, Lin⁻Sca-1⁻c-Kit⁺FcgR^hiCD34⁺) cells between Zfyve16^KO and wild-type mice (Fig. 3B). However, the number of committed lymphoid progenitor (CLP, Lin⁻c-kit^loCD127⁺) cell subpopulation significantly increased in Zfyve16^KO mice compared with that in wild-type mice. This phenomenon is consistent with the increased number of T-lymphoid cells in Zfyve16^KO and wild-type mice.

Zfyve16 modulates the reconstitution abilities of T- and B-lymphoid cells in recipient mice

Considering the differential effect of Zfyve16 on T- and B-lymphoid cells in steady hematopoiesis, we investigated whether such difference exists during bone marrow reconstitution and in response to external stress. We conducted adoptive bone marrow transplantation experiment, in which Zfyve16^KO (CD45.2)/Zfyve16^WT (CD45.2) and wild-type (CD45.1) BM cells were mixed (1:1, 2 × 10⁵ each) and transplanted into lethally irradiated recipient mice (CD45.1). The result of FACS analysis showed that the percentage of donor derived B cells was not significantly different between Zfyve16^KOand Zfyve16^WT mice (Supplementary Fig. 2). This finding demonstrates that the bone marrow reconstitution capacity is not affected by the loss of Zfyve16. In another separate experiment, Zfyve16^KO and wild-type mice were subjected to semi-lethal dose of radiation. The recovery of the hematopoietic system was monitored every 3 days after irradiation (Fig. 4A and 4B). Blood cells began to recover on the 9th day after irradiation. The counts of WBC, RBC, and platelet in peripheral blood were not significantly different between the two groups of mice (Fig. 4A). Moreover, the course of recovery of myeloid cells was similar between the two groups. However, the recovery rate of B-lymphoid cells is significantly lower in Zfyve16^KO mice compared with that in wild-type mice. These results suggest that Zfyve16 may regulate the proliferation of B cells. By contrast, the proliferation rate of T-lymphoid cells is significantly higher in Zfyve16^KO mice than in wild-type mice. These data confirm that Zfyve16 affects the development of lymphoid lineage cells.

Zfyve16 modulates the colony formation capacity of B-lymphoid cells

TGF-b signaling negatively regulates T cell expansion [¹⁴,¹⁵]. Similarly, the present results showed that the depletion of Zfyve16, a positive regulator of TGF-b signaling, increased the number of T-lymphoid cells. However, the effect of Zfyve16 on B cells was not predicted. To further confirm the effect of Zfyve16 on B cell proliferation, we performed a B-lymphoid cell colony formation assay. Briefly, 2 × 10⁵ bone marrow cells were plated in triplicate into the methylcellulose medium for culturing mouse B-lymphoid cells (MethoCult^TMM3630). Colonies were counted on day 10 after plating. Both the size and number of B cell colonies in Zfyve16^KO mice significantly decreased compared with those in wild-type mice (Fig. 5A and 5B). The data demonstrate that Zfyve16 directly regulates the growth of B-lymphoid cells.

Discussion

Zfyve16 plays a critical role in TGF-b signal transduction and endosomal trafficking [¹,²⁵]. In this study, we investigated the function of Zfyve16 in vivo by using mice with inactivating insertion into the Zfyve16 alleles. Zfyve16^KO mice developed normally and showed no gross abnormalities. The proportion of T cells in the peripheral blood of Zfyve16^KO mice is significantly, though not dramatically, higher than that in wild-type mice. Consistently, the number of common lymphoid progenitor cells in Zfyve16^KO mice also increased. Zfyve16 forms complexes with Smad2/3 and Smad4 in TGF-b signaling, and Smad2/3 complexes are involved in TGF-b inhibition of interleukin-2 (IL-2), interferon-g (IFN-g) and granzyme B transcription, which are required for proliferation and differentiation of effector T helper 1 (Th1), Th2, and cytotoxic T lymphocyte cells [¹⁴,²⁶]. The inactivation of Zfyve16 possibly weakens TGF-b signaling and ameliorates the negative regulatory role of TGF-b in T-lymphoid cell proliferation. The increased number of T-lymphoid cells in Zfyve16^KO mice is consistent with previous findings.

Unexpectedly, we found that the proportion of B-lymphoid cells in Zfyve16^KO mice decreased. The B-cell colony assay confirmed the in vivo observation, indicating that this effect is cell autonomous. These results demonstrate for the first time that Zfyve16 positively regulates the development of B-lymphoid cells. The decreased proliferation of B-lymphoid cells in Zfyve16^KO mice is inconsistent with the negative regulatory role of TGF-b signaling in lymphocyte development and activation [¹⁹]. Hence, Zfyve16 possibly regulates other cellular processes which are required for the full proliferation capacity of B-lymphoid cells. According with the increasing proportion of CLP, the reduction in the number of B cells could be due to the blockade of CLP differentiation into B-lymphoid cells. Further studies must investigate such novel mechanisms in the future.

References

[1] Seet LF, Hong W. Endofin, an endosomal FYVE domain protein. J Biol Chem 2001; 276(45): 42445–42454

[2] Michel SL, Berg JM. Building a metal binding domain, one half at a time. Chem Biol 2002; 9(6): 667–668

[3] Stenmark H, Aasland R, Toh BH, D’Arrigo A. Endosomal localization of the autoantigen EEA1 is mediated by a zinc-binding FYVE finger. J Biol Chem 1996; 271(39): 24048–24054

[4] Stenmark H, Aasland R. FYVE-finger proteins—effectors of an inositol lipid. J Cell Sci 1999; 112(Pt 23): 4175–4183

[5] Gillooly DJ, Simonsen A, Stenmark H. Cellular functions of phosphatidylinositol 3-phosphate and FYVE domain proteins. Biochem J 2001; 355(2): 249–258

[6] Chen YG, Wang Z, Ma J, Zhang L, Lu Z. Endofin, a FYVE domain protein, interacts with Smad4 and facilitates transforming growth factor-b signaling. J Biol Chem 2007; 282(13): 9688–9695PMID:17272273

[7] Dong M, Blobe GC. Role of transforming growth factor-b in hematologic malignancies. Blood 2006; 107(12): 4589–4596

[8] Huang F, Chen YG. Regulation of TGF-b receptor activity. Cell Biosci 2012; 2(1): 9 doi:10.1186/2045-3701-2-9

[9] Toy W, Lim SK, Loh MC, Lim YP. EGF-induced tyrosine phosphorylation of endofin is dependent on PI3K activity and proper localization to endosomes. Cell Signal 2010; 22(3): 437–446

[10] Blobe GC, Schiemann WP, Lodish HF. Role of transforming growth factor b in human disease. N Engl J Med 2000; 342(18): 1350–1358 doi:10.1056/NEJM200005043421807

[11] Khalil N. TGF-b: from latent to active. Microbes Infect 1999; 1(15): 1255–1263

[12] Hµger M, Pedersen CC, Larsen MT, Andersen MK, Hother C, Grønbæk K, Jarmer H, Borregaard N, Cowland JB. MicroRNA-130a-mediated down-regulation of Smad4 contributes to reduced sensitivity to TGF-b1 stimulation in granulocytic precursors. Blood 2011; 118(25): 6649–6659

[13] Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways in TGF-b family signalling. Nature 2003; 425(6958): 577–584

[14] Letterio JJ. TGF-b signaling in T cells: roles in lymphoid and epithelial neoplasia. Oncogene 2005; 24(37): 5701–5712

[15] Zhang N, Bevan MJ. TGF-b signaling to T cells inhibits autoimmunity during lymphopenia-driven proliferation. Nat Immunol 2012; 13(7): 667–673

[16] Cottrez F, Groux H. Regulation of TGF-b response during T cell activation is modulated by IL-10. J Immunol 2001; 167(2): 773–778

[17] Letterio JJ, Geiser AG, Kulkarni AB, Dang H, Kong L, Nakabayashi T, Mackall CL, Gress RE, Roberts AB. Autoimmunity associated with TGF-b1-deficiency in mice is dependent on MHC class II antigen expression. J Clin Invest 1996; 98(9): 2109–2119

[18] Wolfraim LA, Fernandez TM, Mamura M, Fuller WL, Kumar R, Cole DE, Byfield S, Felici A, Flanders KC, Walz TM, Roberts AB, Aplan PD, Balis FM, Letterio JJ. Loss of Smad3 in acute T-cell lymphoblastic leukemia. N Engl J Med 2004; 351(6): 552–559

[19] Bakkebø M, Huse K, Hilden VI, Smeland EB, Oksvold MP. TGF-b-induced growth inhibition in B-cell lymphoma correlates with Smad1/5 signalling and constitutively active p38 MAPK. BMC Immunol 2010; 11(1): 57

[20] Tsukazaki T, Chiang TA, Davison AF, Attisano L, Wrana JL. SARA, a FYVE domain protein that recruits Smad2 to the TGFb receptor. Cell 1998; 95(6): 779–791

[21] Itoh F, Divecha N, Brocks L, Oomen L, Janssen H, Calafat J, Itoh S, Dijke P. The FYVE domain in Smad anchor for receptor activation (SARA) is sufficient for localization of SARA in early endosomes and regulates TGF-b/Smad signalling. Genes Cells 2002; 7(3): 321–331

[22] Seet LF, Hong W. Endofin recruits clathrin to early endosomes via TOM1. J Cell Sci 2005; 118(3): 575–587

[23] Seet LF, Liu N, Hanson BJ, Hong W. Endofin recruits TOM1 to endosomes. J Biol Chem 2004; 279(6): 4670–4679

[24] Goh JB, Wallace DF, Hong W, Subramaniam VN. Endofin, a novel BMP-SMAD regulator of the iron-regulatory hormone, hepcidin. Sci Rep 2015; 5(1): 13986

[25] Shi W, Chang C, Nie S, Xie S, Wan M, Cao X. Endofin acts as a Smad anchor for receptor activation in BMP signaling. J Cell Sci 2007; 120(7): 1216–1224

[26] Li MO, Wan YY, Flavell RA. T cell-produced transforming growth factor-b1 controls T cell tolerance and regulates Th1- and Th17-cell differentiation. Immunity 2007; 26(5): 579–591

RIGHTS & PERMISSIONS

Higher Education Press and Springer-Verlag GmbH Germany, part of Springer Nature