2007-09-05 2007, Volume 1 Issue 3

  • Select all
  • Fluorescence in situ hybridization (FISH) and comparative genomic hybridization (CGH) were applied to somatic chromosome preparations of Oryza sativa, O. officinalis/ and O. meyeriana with labeled probes of C0t-1 DNA and genomic DNA from cultivated rice. The coverage percentage (%) and size (Mb) of C0t-1 DNA in O. sativa, O. officinalis and O. meyeriana were 47.1±0.16, 38.61±0.13, 44.38±0.13 and 212.33±1.21, 269.42±0.89, 532.56±1.68, respectively. The coverage percentage and size of probe signals with gen omic DNA from O. sativa in O. officinalis and O. meyeriana were 91.0%, 93.6% and 634 Mb, 1 123 Mb respectively, in which there were 365 and 591 Mb in O. officinalis and O. meyeriana which came from O. sativa genomic DNA not from repetitive sequences of O. sativa, and the uncovered genome size in O. officinalis and O. meyeriana was 64 and 78 Mb, respectively. In addition, karyotype analysis was conducted based on the signal bands of C0t-1 DNA in O. sativa, O. officinalis and O. meyeriana. The results showed that highly and moderately repetitive sequences in Oryza genus were conserved as the functional genes during the evolution process. The repetitive sequence reduplication might be one of the important causes of genome enlargement in O. officinalis and O. meyeriana; the O. officinalis genome enlarged more slowly compared with O. meyeriana. Based on the above results, it is concluded that O. officinalis and O. meyeriana formed by reduplication, rearrangement and gene selective loss during the evolution process.
  • ZHANG Jianfu, Swapan K. Datta, WANG Guoying, XIE Huaan
    Pyruvate orthophosphate dikinase (PPDK) is a key enzyme in photosynthesis in some plants that exploit the C4 photosynthetic pathway for the fixation of CO2. The C4-specific PPDK encoding pyruvate orthophosphate dikinase was introduced into C3 plant, a rice (Oryza sativa L. cv. indica IR64) mediated by biolistic and Agrobacterium transformation. The C4-PPDK gene of maize was integrated to indica IR64 with polymerase chain reaction (PCR)-Southern blotting. The total nitrogen of flag leaves of transgenic IR64 was analyzed with Kjeldahl method for quantitative determination of nitrogen, indicating that the total nitrogen of flag leaves of most transgenic IR64 was higher than that of non-transgenic control IR64 formants in the greenhouse. The maximum value of total nitrogen of flag leaves was 3.61% among transgenic IR64 plants, 1.07% higher than that of non-transgenic control IR64 formants. The total nitrogen of flag leaves of transgenic IR64 was increased by 42.1%. The factors for yield of transgenic IR64 plants were analyzed, indicating there was a greater difference in yield-forming factors among transgenic IR64 plants in the greenhouse, i.e. dried plant weight, harvested index and so on. Thus, it could help rice breeders select different materials for breeding.
  • Three plant binary expression vectors—pNAR501, pNAR502 and pNAR503—were constructed, carrying fragments of exon2-exon3, 5 2partial deletion exon1 and 5 2partial deletion exon1-exon2-exon3 of Pib gene driven by 35S. These three vectors were transformed into the japonica rice variety Nipponbare through agrobacterium-mediated transformation. More than 30 transgenic rice plants were obtained and confirmed by polymerase chain reaction (PCR), Southern hybridization and the hygromycin resistance test in seed germination of their progeny. A rice blast resistance test for in vitro leaves of To transgenic plants in the tillering stage showed higher resistance to the races of E1, F1 and G1 of rice blast than that of the control Nipponbare. However, results of rice blast resistance test for seedlings of Tl transgenic plants in the 3- to 4-leaf stage were different. All Tl transgenic seedlings had a lower level of resistance to E1, F1and G1 races than that of the control Nipponbare.
  • Water stress by polyethylene glycol (PEG) 6000 solution (Ψs = 0.2 MPa, stress time: 48 h, rehydration time: 48 h) was performed in leaves of two alfalfa cultivar (Long-Dong and Algonquin) seedlings. Gas exchange parameters, chlorophyll fluorescence parameters, activity of antioxidant enzyme and photosynthetic pigment concentrations were measured to investigate the available photosynthetic and antioxidant enzyme response to variable water conditions as well as stomatal and non-stomatal limitations to photosynthesis. The results showed that non-stomatal limitations were responsible for the reduction of photosynthesis during water stress. At the beginning of water stress (12 h), water was lost and then the stomata closed rapidly, which resulted in a decrease of transpiration, net photosynthesis and CO2 diffusion. Therefore, when intercellular CO2 concentration and carboxylation efficiency decrease, water use efficiency and value of stomatal limitation would increase. However, the decline of net photo synthetic rate was faster than transpiration rate. At the same time, the maximal photochemical efficiency, potential activity of PSII reaction center and photochemical quenching of chlorophyll fluorescence declined significantly, the activity of antioxidant enzyme increased rapidly and the photosynthetic pigment concentrations changed slightly. The results also indicated that, at the initial period of stress, neither oxidative stress nor membrane lipid peroxidation was induced, nor were photosynthetic structures damaged, but photosynthetic functions were partly inhibited. Therefore, the stomatal limitation and non-stomatal limitations had the same responsibility for the reduction of photosynthesis. At the mid-late stage of water stress, net photosynthetic rate, stomatal conductance, maximal photochemical efficiency, potential activity of PSII reaction center and photochemical quenching of chlorophyll fluorescence decreased linearly with the decline of the relative water content. And the relative electron transport rate, the effective quantum yield of PSII photochemistry and photosynthetic pigment concentrations declined continually. The activity of antioxidant enzymes maintained at a higher level but malondialdehyde accumulated gradually with prolonging of water stress. Simultaneously, the non-photochemical quenching of chlorophyll fluorescence increased obviously after water stress for 24 h. The remarkable decline of light saturated point of photosynthetic electron transport, that is, the initial point of photo-inhibition, was observed in advance. Therefore, non-stomatal limitations dominated the changes of a series of physiological and biochemical reactions during mid-late period of water stress. After 48 h rehydration, all the parameters except intercellular CO2 concentration in Long-Dong recovered obviously but incompletely, which resulted from severe oxidative injury and photo-inhibition induced by water stress even though photo-protection was triggered during water stress in alfalfa leaves. Alfalfa seedlings were sensitive to water stress and there were certain differences between cultivars.
  • Using the cotyledon of white clover as explants, the transgenic white clover lines ectopic expression of the PhyA gene were established based on Agrobacterium tumefaciens-mediated transformation method. It was found that the tested transgenic lines were all Polymerase Chain Reaction (PCR) positive. The transgenic lines 1 to 4 were used for further Southern blot and Northern blot analysis. The lines 1 and 3 with higher level of PhyA expression were used to assay the phytase activities in root and its intercellular space. When the phytate was the sole phosphorus source, the phytase activities in root in lines 1 and 3 were 31.43% and 44.76% higher than those in control (CK), respectively. Meanwhile, the phytase activities in the root intercellular space in lines 1 and 3 were 3.3-fold and 5.12-fold higher than those in CK, respectively. The phosphorus concentration of plants, the accumulative P amount per plant, plant fresh weight, and plant dry weight were all much higher in lines 1 and 3 than in CK. Thus, it is clearly shown that ectopic expression of Aspergillus niger PhyA gene could significantly increase the ability for white clover to utilize organic phosphate under inorganic phosphate (Pi)-deficient condition.
  • Kernel sets in corn were affected by silk receptivity, pollen grain vigor, and the synchronization of silking and pollen shedding. Grain yield decrement was often caused by poor kernel set ability under field conditions. This study was conducted with two corn hybrids—Yedan 12 and Yedan 19— in both field and laboratory to observe silk receptivity, pollen vigor, synchronization of silking and pollen, and their effects on the kernel sets. The results showed that silk receptivity could be maintained over a relatively longer period of time after silks emerged, but both kernel set percentage and kernel weight decreased as silks aged when pollination occurred. Pollen grains that shed earlier had higher TTC-dehydrogenase activity, higher germination percentage, more rapid pollen tube growth rate, and higher percentage of kernel sets and kernel weight than those that shed later. The effect of delayed silking on kernel set ability was more significant compared with delayed pollen. Synchronization of silking and pollen shedding showed different characters in different hybrids: partial overlapped  for Yedan 12 and overlapped  for Yedan 19.
  • The quality of oil determined by the constituents and proportion of fatty acid components, and the understanding of heredity of fatty acid components are of importance to breeding good quality soybean varieties. Embryo, cytoplasmic and maternal effects and genotype × environment interaction effects for quality traits of soybean [Glycine max (L.) Merrill.] seeds were analyzed using a general genetic model for quantitative traits of seeds with parents, F1 and F2, of 20 crosses from a diallel mating design of five parents planted in the field in 2003 and 2004 in Harbin, China. The interaction effects of palmitic, stearic, and linoleic acid contents were larger than the genetic main effects, while the genetic main effects were equal to interaction effects for linolenic and oleic acid content. Among all kinds of genetic main effects, the embryo effects were the largest for palmitic, stearic, and linoleic acids, while the cytoplasm effects were the largest for oleic and linolenic acids. Among all kinds of interaction effects, the embryo interaction effects were the largest for fatty acids. The sum of additive and additive × environment effects were larger than that of dominance and dominance × environment effects for the linolenic acid content, but not for other quality traits. The general heritabilities were the main parts of heritabilities for palmitic and oleic acid contents, but the interaction was more important for stearic, linoleic, and linolenic acid contents. For the general heritability, maternal and cytoplasm heritabilities were the main components for palmitic, oleic, and linolenic acid contents. It was shown for the interaction heritabilities that the embryo interaction heritabilities were more important for oleic and linolenic acid contents, while the maternal interaction heritabilities were more important for linoleic acid content. Among selection response components, the maternal and cytoplasm general responses and /or interaction responses were more important for palmitic, stearic, oleic, and linoleic acid contents. The main selection response components were from the embryo general response and / or interaction response for linolenic acid content. It suggested that the selection of palmitic, stearic, oleic, and linoleic acid contents in offspring should be in maternal plants, while linolenic acid content should be improved by screening or selecting the single seed in higher generations.
  • The recombinant inbred lines (RILs) population derived from the cross between Zhongyouzao8  (hsien or indica) and Fengjin  (keng or japonica) was grown in Liaoning and Sichuan Provinces to compare the subspecies characteristics under different environments. The results showed that the distribution of Cheng s index was japonicalinous. The population was more japonicalinous in Sichuan than that in Liaoning as a whole. Further analysis indicated that indica and indica-cline in Sichuan were more indicalinous than those in Liaoning, japonica and japonica-cline in Sichuan were more japonicalinous than those in Liaoning. The effects of environment on six characteristics of Cheng s index were different because of different characters, as well as on the correlations between the six characters, the Cheng s index and the vascular bundle traits. For example, the length of the first and second rachis and leaf pubescence were more japonicalinous in Sichuan than in Liaoning, while the length/width ratio of spikelets and glume color at heading time were more indicalinous in Sichuan than in Liaoning. The vascular bundle characteristics of RILs in different environments changed remarkably. The number of large vascular bundles in panicle neck was less in Sichuan than in Liaoning, while the number of small vascular bundles in panicle neck and second top stem was greater in Sichuan than in Liaoning. The ratio of large to small vascular bundles in panicle neck decreased and the ratio of large vascular bundles between the second top stem and panicle neck increased in Sichuan. Though total trend was the vascular bundle ratio of large to small in indica was greater than that in japonica and the ratio of large vascular bundles in indica was less than that in japonica, it is not appropriate that the vascular bundle ratio of large to small and the ratio of large vascular bundles are regarded as the parameters for subspecies classification in rice. The vascular bundles characteristics from typical indica or japonica were recombined in the population derived from indica and japonica crossing.
  • Through pot experiment, effects of phytoremediation on microbial communities in soils at different nickel treatment levels were studied. Two Ni hyperaccumulating and one Ni tolerant species were planted in paddy soils different in Ni concentration, ranging from 100 to 1 600 mg/kg. After 110 days of incubation, soil microbial activities were analyzed. Results showed that populations of bacteria, fungus, and actinomycetes and biomass of the microorganisms were stimulated when nickel was added at a rate of 100 mg/kg in non-rhizospheric soil. When the rate was over 100 mg/kg in the soil, adverse effects on the soil microbial communities were observed. The plantation of Ni hyperaccumulating species could increase both the population and biomass of soil microorganisms, because, by absorbing nickel from the soil and excreting root exudates, the plants reduced nickel toxicity and improved the living environment of the microbes. However, different plant species had different effects on microorganisms in soil.Randomly Amplified Polymorphic DNA (RAPD) with five primers was used in this study in 25 soil samples of four types of soils. A total of 947 amplified bands were obtained, including 888 polymorphic bands and 59 non-polymorphic bands. The results indicated that the composition of microbial DNA sequences had changed because of the addition of nickel to the treated soils. Shannon-Weaver index of soil microbial DNA sequences reduced in the nickel contaminated soils with increasing nickel concentration. The changes in Shannon-Weaver index in the four types of soils ranged from 1.65 to 2.32 for Alyssum corsicum, 1.37 to 2.27 for Alyssum murale, 1.37 to 1.96 for Brassica juncea, and 1.19 to 1.85 for non-rhizospheric soil. With the same amount of nickel added to soils, the Shannon-Weaver index in rhizospheric soil with plants was higher than that in non-rhizospheric soil.
  • A growth model-based decision support system for crop management (GMDSSCM) was developed, which integrates process-based models of four different crops—wheat, rice, rape and cotton—and realized decision support function, thus facilitating the simulation and application of the crop models for different purposes. The individual models include six sub models for simulating phase development, organ formation, biomass production, yield and quality formation, soil-crop water relations and nutrient (N, P, K) balance. The implemented system can be used for evaluating individual and comprehensive management strategies based on the results of crop growth simulation under various environments and different genotypes. A stand-alone edition (GMDSSCMA) was established on VC++ and VB platforms by adopting the characteristics of object-oriented and component-based software and with the effective integration and coupling of the growth prediction and decision-making functions. A web-based system (GMDSSCMW) was then further developed on the .net platform using C# language. These GMDSSCM systems have realized dynamic prediction of crop growth and decision making on cultural management, and thus should be helpful for the construction and application of informational and digital farming system.
  • Based on the relationship between crops and circumstances, a dynamic knowledge model for maize management with wide applicability was developed using the system method and mathematical modeling technique. With soft component characteristics incorporated, a component and digital knowledge model-based decision support system for maize management was established on the Visual C++ platform. This system realized six major functions: target yield calculation, design of pre-sowing plan, prediction of regular indices, real-time management control, expert knowledge reference and system administration. Cases were studied on the target yield knowledge model with data sets that include different eco-sites, yield levels of the last three years, and fertilizer and water management levels. The results indicated that this system overcomes the shortcomings of traditional expert systems and planting patterns, such as site-specific conditions and narrow applicability, and can be used more under different conditions and environments. This system provides a scientific knowledge system and a broad decision-making tool for maize management.
  • The study was conducted by means of nutrient solution culture to investigate the effects of exogenous nitric oxide (NO) on growth of cucumber seedlings, active oxygen species metabolism and photosynthetic characteristics in cucumber leaves under 50 mmol/L NaCl stress. The results showed that 10–400 μmol/L exogenous sodium nitroprusside (SNP), especially 100 μmol/L SNP, significantly alleviated the injury to seedlings and increased seedling growth. The activity of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX), and the contents of photosynthetic pigments and proline also increased under 50 mmol/L NaCl stress. Similarly, net photosynthetic rate (Pn), stomatal conductance (Gs), and transpiration rate (Tr) also increased significantly. However, exogenous nitric oxide application markedly decreased membrane permeability, rate of O2· - production, the contents of malondialdehyde (MDA) and H2O2, and intercellular CO2 concentration (Ci) under 50 mmol/L NaCl stress.
  • A feeding trial was conducted to investigate the effects of dietary soybean oligosaccharides (SBOS) on the levels of cholesterol in plasma and liver, and the fatty acid composition in muscle and liver of juvenile Japanese flounder (Paralichthys olivaceus Temminck et Schlegel). Four isonitrogenous and isocaloric practical diets (crude protein 49%, gross energy 19 kJ/g) including only fish meal (FM) or soy protein isolate (SPI) as sole dietary protein source with (Diets FMO and SPIO) or without (Diets FM and SPI) supplemented SBOS (stachyose, 2.61%; raffinose, 0.61%) were formulated. Each diet was randomly assigned to triplicate aquaria stocked with 30 fish (initial body weight 1.93±0.02 g) each. Fish were maintained in the flow-through aquaria at water temperature ranging from 22.0 to 25.0 and fed twice (08:00, 16:00) daily to apparent satiation for 8 weeks. Dietary SBOS supplementation significantly increased the levels of total cholesterol (TC) and high-density lipoprotein cholesterol (HDL-C) in plasma of the fish fed FM-based diets (P<0.05), but no significant differences were observed at the levels of plasma triacylglycerol (TG) and low-density lipoprotein cholesterol (LDL-C) and LDL-C/HDL-C ratio (P>0.05). The levels of TC, TG, HDL-C and LDL-C, and LDL-C/HDLC ratio in plasma of the fish fed SPI-based diets were not significantly influenced by the supplemented SBOS (P>0.05). Supplementation of SBOS did not influence the hepatic TC, TG and lipid contents and lipid droplet accumulation in fish fed FM-based diets, but significantly decreased the hepatic TC, TG and lipid contents and lipid droplet accumulation in fish fed SPI-based diets (P<0.05). In contrast, supplemented SBOS significantly increased fecal cholesterol extraction in the fish fed FM-based diets (P<0.05), but no significant difference was observed in the fish fed SPI-based diets (P>0.05). The fatty acid composition in muscle and liver was not significantly affected by supplemental SBOS regardless of dietary protein source (P>0.05). These results indicate that dietary SBOS supplementation (stachyose, 2.61%; raffinose, 0.61%) does not negatively affect the lipid metabolism of the fish fed FM-based diets, but decrease the incidences of fatty liver of the fish fed SPI-based diets.
  • The genomes of seven native goat populations were screened by using microsatellites as molecular markers; the populations were Yichang white, Matou, Xiangdong black, Fuqing, Daiyun, Huanghuai and Yangtse River Delta white goats. A total of 23 microsatellite markers were used and genetic diversities and genetic distances were also determined. The results showed that only 21 loci showed polymorphism in all populations. BM0203 was a homozygotic locus in every population, but more than one allele was found among all populations. Alleles of BM6444 were homozygotic in Xiangdong Black and Yichang White goats, but more than one allele was detected in other populations. Average heterozygosity of all populations was 0.819 0, and the mean polymorphism information content (PIC) of all seven populations was 0.630 5–0.691 9. An unweighted pair group method with arithmetic mean (UPGMA) dendrogram was constructed on Nei s standard genetic distance. Matou and Xiangdong black were grouped at first, then Fuqing, Daiyun, Yangtse River Delta white and Huanghuai goats joined them respectively. Finally, Yichang white goats clustered with all of the above.
  • There still exists a remarkable difference on the yak s taxonomic status in Bovinae. Primers designed according to the mitochondrial gene sequences of Bos taurus reported were used to amplify and sequence the yak s cytochrome b gene, and the whole sequence of cytochrome b gene was finally obtained. Using Ovis aries as outgroup taxa, the phylogeny about the representative species of Bovinae was analyzed. Results showed that among the different species, the ratio of transition/transversion (Ts/Tv) of Cytochrome b gene was 4.9, suggesting that the mutation was not saturation. The percentage nucleotide sequence divergence between yak and Bovinae was 8.0%–8.6%, which was higher than that of yak and Bison bison. Phylogeny analysis found that Poephagus grunniens and Poephagus mutus clustered first before gathering with Bison bison, indicating higher genetic comparability than that of Bos. The results sustained the idea that Poephagus grunniens and Poephagus mutus shared one ancestor—the primitive yak. The approximate divergence time between these two species was 0.55 million years. The data also supported the viewpoint that the yak is classified into Poephagus of Bovinae, including two species of Poephagus grunniens and Poephagus mutus.
  • It has previously been shown that Human Chorionic Gonadotropin (hCG) can stimulate steroidogenesis in Leydig cells. In the present study, the mechanisms of hCG stimulated steroidogenesis in Leydig cells of immaturated pigs were investigated. It was found that both hCG and 8-Br-cAMP could enhance the expression level of both the Steroidogenic acute regulatory protein (StAR) and mRNA, and increase the activity of extracellular signal-regulated kinase1/2 (ERK1/2) significantly depending on stimulating time. However, the effect of 8-Br-cAMP was more significant than that of hCG. While appending the inhibitor of Protein Kinase A (PKA) to Leydig cells in culture, the expression level of StAR protein, mRNA and the activity of ERK1/2 began to drop significantly, but the level of StAR mRNA could still be detectable. While appending the inhibitor of MAPK (PD98059), the expression level of StAR protein and mRNA declined significantly. These results infer that at the beginning of hCG stimulation, hCG increases the level of StAR protein by cAMP-PKA. With prolonged stimulating time, hCG increases the level of StAR protein through cAMP-PKA-ERK1/2.
  • The effects of additional leptin on the long type receptor (Ob-Rb mRNA) for adipocytes of new born calf were tested by means of competitive reverse transcription polymerase chain reaction (RT-PCR). A sample of fine monolayer adipose cells were first obtained and recombination leptins of calf (5 ng/mL ? 12 h) were added. No additive was adopted as tester in the adipose cell. Total RNA was determined at 4, 12, 24, 36, 48 and 72 h, and duplicated three times in every treatment in the single factor duplicating test. The result, compared with the group of testers, was that the quantity of Ob-Rb mRNA in adipose cell cultures was also significantly higher (P<0.01) at the beginning stage. Following this tendency, the quantity was gradually lower with cultured time going on in 12–24 h, and the quantity was in stable level (P>0.05) from 48 to 72 h. It was shown that leptin could improve the level of expression of Ob-Rb in cultured adipose cells of new born calf within a definite time.
  • The objective of this research is to analyze the genetic characterization of a bovine viral diarrhea virus (BVDV) strain (HB-DCZ strain) isolated from China and describe its relationship with other BVDV strains. Special primers (forward: 5 2- gagatctcgggaggtac -3 2, reverse: 5 2- cctctcggcatgatcccgaaa -3 2) are used to amplify partial NS2-3 sequence of HB-DCZ strain by reverse transcription polymerase chain reaction (RT-PCR). The product of PCR is cloned into pMD18-T vector, and then transfected into JM109. The recombinant plasmids are extracted and identified by EcoR I and Hind III enzyme digestion. The NS2 3 nucleotide fragment of the isolated virus is sequenced, and then amino acid sequence is deduced. Nucleotide sequence and deduced amino acid sequence of the strain are analyzed and compared with other BVDV strains from Genebank with the aid of DNAstar software. The results show that the obtained fragment of HB-DCZ strain contains 665 bp nucleotides, which indicate that there is no insertion in the isolated virus genome. The homologies of nucleotide sequences show that HB-DCZ strain has 99.1%, 97.4%, 92.3%, 77%, 76.9%, 76.4% and 76.2%, sequence similarity with 184, ZM195, Osloss, Oregon C24V, Singer, NADL, and S D-I, respectively. According to the nucleotide sequences of the obtained fragments, the 208 corresponding amino acids are deduced. The homologies of amino acid sequences show that HB-DCZ strain had 100%, 93.3%, 91.3% and 83.2% sequence similarity with VEDEVAC, Osloss, ILLC and Oregon C24V, respectively. In conclusion, HB-DCZ strain has no exogenous sequence insertion, no gene recombination, no gene rearrangement and no gene deficiency. HB-DCZ strain is closely related to BVDV Osloss strain, and belongs to subtype Ib.
  • The polymorphism of mitochondrial DNA (mtDNA) D-loop of 83 individuals from nine Chinese indigenous sheep breeds and two imported sheep breeds was studied with five endonucleases, Hinf I, Msp I, Sau3A I, Xsp I and Taq I, using PCR-RFLP. The results indicated that there existed two basic haplotypes in the region of mtDNA D-loop. It could be inferred that Chinese indigenous sheep breeds originated from two maternal ancestors. The average polymorphic degree (π value = 0.0421%) of mtDNA D-loop showed that the genetic diversity of mtDNA of Chinese indigenous sheep breeds was very low.
  • The nucleocapsid protein gene of transmissible gastroenteritis virus, 1 149 bp in length, was amplified by RT-PCR from isolated strain HB06 and cloned into pMD18-T. Sequence comparison with other transmissible gastroenteritis virus (TGEV) strains selected from the Gene Bank revealed that the homology of N gene complete sequence shares more than 97% in nucleotide. N gene was cloned into BamHI and EcoRI multiple cloning sites of the prokaryotic expression vector pET 20 b, and named pETN. After being induced by isopropyl-β-D-thiogalactopyranoside (IPTG), the recombinant nucleocapsid protein was expressed. The result of SDS-PAGE and Western-blot showed that the recombinant nucleocapsid protein was 47 kDa and had strong positive reactions with TGEV-specific antibody.