Please wait a minute...

Frontiers of Medicine

Front. Med.    2019, Vol. 13 Issue (4) : 451-460     https://doi.org/10.1007/s11684-018-0675-3
RESEARCH ARTICLE
Structural shifts in the intestinal microbiota of rats treated with cyclosporine A after orthotropic liver transplantation
Junjun Jia1,2,3, Xinyao Tian1,2,3, Jianwen Jiang1,2,3, Zhigang Ren1,2,3, Haifeng Lu2,4, Ning He1,2,3, Haiyang Xie1,2,3, Lin Zhou1,2,3, Shusen Zheng1,2,3()
1. Department of Hepatobiliary and Pancreatic Surgery, the First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou 310003, China
2. Key Laboratory of Combined Multi-Organ Transplantation, Ministry of Public Health
3. Collaborative Innovation Center for Diagnosis and Treatment of Infectious Diseases, the First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou 310003, China
4. State Key Laboratory for Diagnosis and Treatment of Infectious Diseases, the First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou 310003, China
Download: PDF(2940 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

Understanding the effect of immunosuppressive agents on intestinal microbiota is important to reduce the mortality and morbidity from orthotopic liver transplantation (OLT). We investigated the relationship between the commonly used immunosuppressive agent cyclosporine A (CSA) and the intestinal microbial variation in an OLT model. The rat samples were divided as follows: (1) N group (normal control); (2) I group (isograft LT, Brown Norway [BN] rat to BN); (3) R group (allograft LT, Lewis to BN rat); and (4) CSA group (R group treated with CSA). The intestinal microbiota was assayed by denaturing gradient gel electrophoresis profiles and by using real-time polymerase chain reaction. The liver histopathology and the alanine/aspartate aminotransferase ratio after LT were both ameliorated by CSA. In the CSA group, the numbers of rDNA gene copies of Clostridium cluster I, Clostridium cluster XIV, and Enterobacteriaceae decreased, whereas those of Faecalibacterium prausnitzii increased compared with the R group. Cluster analysis indicated that the samples from the N, I, and CSA groups were clustered, whereas the other clusters contained the samples from the R group. Hence, CSA ameliorates hepatic graft injury and partially restores gut microbiota following LT, and these may benefit hepatic graft rejection.

Keywords microbial community      liver transplantation      immunosuppressive agents      cyclosporine A     
Corresponding Authors: Shusen Zheng   
Just Accepted Date: 04 March 2019   Online First Date: 24 April 2019    Issue Date: 02 August 2019
 Cite this article:   
Junjun Jia,Xinyao Tian,Jianwen Jiang, et al. Structural shifts in the intestinal microbiota of rats treated with cyclosporine A after orthotropic liver transplantation[J]. Front. Med., 2019, 13(4): 451-460.
 URL:  
http://journal.hep.com.cn/fmd/EN/10.1007/s11684-018-0675-3
http://journal.hep.com.cn/fmd/EN/Y2019/V13/I4/451
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Junjun Jia
Xinyao Tian
Jianwen Jiang
Zhigang Ren
Haifeng Lu
Ning He
Haiyang Xie
Lin Zhou
Shusen Zheng
Target Sequence (5'–3') Sequence (3'–5') Annealing temperature (°C)
Faecalibacterium prausnitzii GATGGCCTCGCGTCCGATTAG CCGAAGACCTTCTTCCTCC 58
Enterococcus AACCTACCCATCAGAGGG GACGTTCAGTTACTAACG 57
Bifidobacterium spp. GGGTGGTAATGCCGGATG TAAGCCATGGACTTTCACACC 59
Lactobacillus AGCAGTAGGGAATCTTCCA ATTYCACCGCTACACATG 58
Enterobacteriaceae CATTGACGTTACCCGCAGAAGAAGC CTCTACGAGACTCAAGCTTGC 63
Bacteroides GAAGGTCCCCCACATTG CAATCGGAGTTCTTCGTG 56
Clostridium cluster XIVab (CG3) GAWGAAGTATYTCGGTATGT CTACGCWCCCTTTACAC 54
Clostridium clusters XI (CG2) ACGCTACTTGAGGAGGA GAGCCGTAGCCTTTCACT 58
Clostridium clusters I (CG1) TACCHRAGGAGGAAGCCAC GTTCTTCCTAATCTCTACGCAT 63
Tab.1  The primers of the dominating bacteria
Fig.1  Liver histopathology (hematoxylin and eosin stain, original magnification 200×).
Fig.2  ALT and AST levels in the N, I, R, and CSA groups (n = 6 per group). Values are expressed as mean±SEM. *P<0.05 versus N, ×P<0.05 versus I group, #P<0.05 versus R group.
Fig.3  Numbers of fecal-dominating bacteria in the N, I, R, and CSA groups (n = 8 per group). Values are expressed as mean±SEM. *P<0.05 versus N group, ×P<0.05 versus I group, #P<0.05 versus R group. FPRA, Faecalibacterium prausnitzii; ENCO, Enterococcus spp.; CG1, Clostridium cluster I; CG2, Clostridium cluster XI; CG3, Clostridium cluster XIV; ECO, Enterobacteriaceae; LAC, Lactobacillus spp.; BAC, BacteroidesPrevotella group; BIF, Bifidobacterium spp.
Fig.4  CSA improved the intestinal microbiota in rats after LT as shown in the DGGE profiles. (A) DGGE profiles of intestinal bacteria from rats. Numbers of sample above the lanes represent rats from various groups. 50, 45, 39, 26, 35, and 16 samples were from N group; 22, 21, 15, 19, 27, and 28 samples were from I group; 11, 23, 33, 24, 30, and 29 samples were from CSA group; and 46, 44, 48, 54, 13, and 9 samples were from the R group. Gel-to-gel comparison is marked by different marker lanes. Each bacterial clone indicates a band. Numbers of each band (corresponding to Fig. 6 band classes) expressed the position of bands abscised for analyses (e.g., 8 means band class 8). (B) Diversity of fecal microbial comparison (Shannon’s diversity index). Values are expressed as mean±SEM. ×P<0.05 versus I group.
Fig.5  DGGE profile cluster analysis assessed with universal primers V3, the utilizing Dice’s coefficient and UPGMA. (A) DGGE profiles cluster analysis from the different groups. Metric scale expresses the degree of similarity. (B) Cluster MDS analysis shown in (A). The plot shows an optimized three-dimensional expression of the similarity matrix obtained from the BioNumerics software; the x, y and z axes express three different dimensions separately: Dim 1, 2, and 3. Euclidean distance between 2 points reflects similarity. (C) Fecal microbial PCA of DGGE fingerprinting shown in (A). Reoriented plots maximize the variation among different lanes along the first 3 principal components with contributions of 34.7%, 16.1%, and 12.2% as obtained from the BioNumerics software.
Fig.6  Neighbor-joining method was used for phylogenetic tree sequencing. Black squares indicate band classes with increased intensity versus the N group; black triangles indicate band classes with decreased intensity versus the N group; black diamonds indicate band classes with increased intensity versus the R group; and black spots indicate band classes with decreased intensity versus the R group. The plot was generated from MEGA5 software.
Fig.7  The key band changed among the groups. (A) The R group increased the band intensity, but CSA restored it to the N group level. (B) The key bands changed in the CSA group compared with the N group, while the R group maintained a normal level (n = 6 in each group). Values are expressed as mean±SEM. *P<0.05 versus N group, #P<0.05 versus R group.
1 EY Cheng, MJ Everly. Trends of Immunosuppression and Outcomes Following Liver Transplantation: An Analysis of the United Network for Organ Sharing Registry. In: Everly MJ, Terasaki PI. Clinical Transplants 2014. LA: UCLA Immunogenetics Center, 2015: 13–26 (Chapter 2)
pmid: 26281123
2 L Barkholt, BG Ericzon, J Tollemar, AS Malmborg, A Ehrnst, H Wilczek, J Andersson. Infections in human liver recipients: different patterns early and late after transplantation. Transpl Int 1993; 6(2): 77–84
https://doi.org/10.1111/j.1432-2277.1993.tb00755.x pmid: 8447929
3 K Tanaka, S Uemoto, H Egawa, Y Takada, K Ozawa, S Teramukai, M Kasahara, K Ogawa, M Ono, H Sato, K Takai, M Fukushima, K Inaba. Cytotoxic T-cell-mediated defense against infections in human liver transplant recipients. Liver Transpl 2007; 13(2): 287–293
https://doi.org/10.1002/lt.21065 pmid: 17256783
4 LV Hooper, T Midtvedt, JI Gordon. How host-microbial interactions shape the nutrient environment of the mammalian intestine. Annu Rev Nutr 2002; 22(1): 283–307
https://doi.org/10.1146/annurev.nutr.22.011602.092259 pmid: 12055347
5 F Bäckhed, RE Ley, JL Sonnenburg, DA Peterson, JI Gordon. Host-bacterial mutualism in the human intestine. Science 2005; 307(5717): 1915–1920
https://doi.org/10.1126/science.1104816 pmid: 15790844
6 F Guarner, JR Malagelada. Gut flora in health and disease. Lancet 2003; 361(9356): 512–519
https://doi.org/10.1016/S0140-6736(03)12489-0 pmid: 12583961
7 Y Chen, F Yang, H Lu, B Wang, Y Chen, D Lei, Y Wang, B Zhu, L Li. Characterization of fecal microbial communities in patients with liver cirrhosis. Hepatology 2011; 54(2): 562–572
https://doi.org/10.1002/hep.24423 pmid: 21574172
8 JS Bajaj, PB Hylemon, JM Ridlon, DM Heuman, K Daita, MB White, P Monteith, NA Noble, M Sikaroodi, PM Gillevet. Colonic mucosal microbiome differs from stool microbiome in cirrhosis and hepatic encephalopathy and is linked to cognition and inflammation. Am J Physiol Gastrointest Liver Physiol 2012; 303(6): G675–G685
https://doi.org/10.1152/ajpgi.00152.2012 pmid: 22821944
9 K Atarashi, K Honda. Microbiota in autoimmunity and tolerance. Curr Opin Immunol 2011; 23(6): 761–768
https://doi.org/10.1016/j.coi.2011.11.002 pmid: 22115876
10 Y Xie, Z Luo, Z Li, M Deng, H Liu, B Zhu, B Ruan, L Li. Structural shifts of fecal microbial communities in rats with acute rejection after liver transplantation. Microb Ecol 2012; 64(2): 546–554
https://doi.org/10.1007/s00248-012-0030-1 pmid: 22430504
11 VM Dong, KL Womer, MH Sayegh. Transplantation tolerance: the concept and its applicability. Pediatr Transplant 1999; 3(3): 181–192
https://doi.org/10.1034/j.1399-3046.1999.00042.x pmid: 10487277
12 AL Taylor, CJ Watson, JA Bradley. Immunosuppressive agents in solid organ transplantation: mechanisms of action and therapeutic efficacy. Crit Rev Oncol Hematol 2005; 56(1): 23–46
https://doi.org/10.1016/j.critrevonc.2005.03.012 pmid: 16039869
13 M Malinowski, P Martus, JF Lock, P Neuhaus, M Stockmann. Systemic influence of immunosuppressive drugs on small and large bowel transport and barrier function. Transpl Int 2011; 24(2): 184–193
https://doi.org/10.1111/j.1432-2277.2010.01167.x pmid: 21208295
14 MJ Ferris, G Muyzer, DM Ward. Denaturing gradient gel electrophoresis profiles of 16S rRNA-defined populations inhabiting a hot spring microbial mat community. Appl Environ Microbiol 1996; 62(2): 340–346
pmid: 8593039
15 EG Zoetendal, CT Collier, S Koike, RI Mackie, HR Gaskins. Molecular ecological analysis of the gastrointestinal microbiota: a review. J Nutr 2004; 134(2): 465–472
https://doi.org/10.1093/jn/134.2.465 pmid: 14747690
16 V Mai, JG Morris Jr. Colonic bacterial flora: changing understandings in the molecular age. J Nutr 2004; 134(2): 459–464
https://doi.org/10.1093/jn/134.2.459 pmid: 14747689
17 X Tian, Z Yang, F Luo , S Zheng. Gut microbial balance and liver transplantation: alteration, management, and prediction. Front Med 2018; 12 (2): 123–129
https://doi.org/10.1007/s11684-017-0563-2
18 G Zaza, A Dalla Gassa, G Felis, S Granata, S Torriani, A Lupo. Impact of maintenance immunosuppressive therapy on the fecal microbiome of renal transplant recipients: comparison between an everolimus- and a standard tacrolimus-based regimen. PLoS One 2017; 12(5): e0178228
https://doi.org/10.1371/journal.pone.0178228 pmid: 28542523
19 Z Ren, G Cui, H Lu, X Chen, J Jiang, H Liu, Y He, S Ding, Z Hu, W Wang, S Zheng. Liver ischemic preconditioning (IPC) improves intestinal microbiota following liver transplantation in rats through 16s rDNA-based analysis of microbial structure shift. PLoS One 2013; 8(10): e75950
https://doi.org/10.1371/journal.pone.0075950 pmid: 24098410
20 H Lu, Z Wu, W Xu, J Yang, Y Chen, L Li. Intestinal microbiota was assessed in cirrhotic patients with hepatitis B virus infection. Intestinal microbiota of HBV cirrhotic patients. Microb Ecol 2011; 61(3): 693–703
https://doi.org/10.1007/s00248-010-9801-8 pmid: 21286703
21 PB Eckburg, EM Bik, CN Bernstein, E Purdom, L Dethlefsen, M Sargent, SR Gill, KE Nelson, DA Relman. Diversity of the human intestinal microbial flora. Science 2005; 308(5728): 1635–1638
https://doi.org/10.1126/science.1110591 pmid: 15831718
22 PD Cani, NM Delzenne. The role of the gut microbiota in energy metabolism and metabolic disease. Curr Pharm Des 2009; 15(13): 1546–1558
https://doi.org/10.2174/138161209788168164 pmid: 19442172
23 SR Gill, M Pop, RT Deboy, PB Eckburg, PJ Turnbaugh, BS Samuel, JI Gordon, DA Relman, CM Fraser-Liggett, KE Nelson. Metagenomic analysis of the human distal gut microbiome. Science 2006; 312(5778): 1355–1359
https://doi.org/10.1126/science.1124234 pmid: 16741115
24 RE Ley, DA Peterson, JI Gordon. Ecological and evolutionary forces shaping microbial diversity in the human intestine. Cell 2006; 124(4): 837–848
https://doi.org/10.1016/j.cell.2006.02.017 pmid: 16497592
25 HC Xing, LJ Li, KJ Xu, T Shen, YB Chen, JF Sheng, Y Chen, SZ Fu, CL Chen, JG Wang, D Yan, FW Dai, SS Zheng. Protective role of supplement with foreign Bifidobacterium and Lactobacillus in experimental hepatic ischemia-reperfusion injury. J Gastroenterol Hepatol 2006; 21(4): 647–656
https://doi.org/10.1111/j.1440-1746.2006.04306.x pmid: 16677148
26 B Chassaing, L Etienne-Mesmin, AT Gewirtz. Microbiota-liver axis in hepatic disease. Hepatology 2014; 59(1): 328–339
https://doi.org/10.1002/hep.26494 pmid: 23703735
27 Z Ren, A Li, J Jiang, L Zhou, Z Yu, H Lu, H Xie, X Chen, L Shao, R Zhang, S Xu, H Zhang, G Cui, X Chen, R Sun, H Wen, JP Lerut, Q Kan, L Li, S Zheng. Gut microbiome analysis as a tool towards targeted non-invasive biomarkers for early hepatocellular carcinoma. Gut 2018 Jul 25. [Epub ahead of print] doi: 10.1136/gutjnl-2017-315084
https://doi.org/10.1136/gutjnl-2017-315084 pmid: 30045880
28 H Lu, J He, Z Wu, W Xu, H Zhang, P Ye, J Yang, S Zhen, L Li. Assessment of microbiome variation during the perioperative period in liver transplant patients: a retrospective analysis. Microb Ecol 2013; 65(3): 781–791
https://doi.org/10.1007/s00248-013-0211-6 pmid: 23504024
29 A Müller, H Jungen, S Iwersen-Bergmann, M Sterneck, H Andresen-Streichert. Analysis of cyclosporin A in hair samples from liver transplanted patients. Ther Drug Monit 2013; 35(4): 450–458
https://doi.org/10.1097/FTD.0b013e31828abb1d pmid: 23783168
30 IB Jeffery, PW O’Toole, L Öhman, MJ Claesson, J Deane, EM Quigley, M Simrén. An irritable bowel syndrome subtype defined by species-specific alterations in faecal microbiota. Gut 2012; 61(7): 997–1006
https://doi.org/10.1136/gutjnl-2011-301501 pmid: 22180058
31 CM Surawicz, LJ Brandt, DG Binion, AN Ananthakrishnan, SR Curry, PH Gilligan, LV McFarland, M Mellow, BS Zuckerbraun. Guidelines for diagnosis, treatment, and prevention of Clostridium difficile infections. Am J Gastroenterol 2013; 108(4): 478–498, quiz 499
https://doi.org/10.1038/ajg.2013.4 pmid: 23439232
32 LP Smits, KE Bouter, WM de Vos, TJ Borody, M Nieuwdorp. Therapeutic potential of fecal microbiota transplantation. Gastroenterology 2013; 145(5): 946–953
https://doi.org/10.1053/j.gastro.2013.08.058 pmid: 24018052
33 E van Nood, A Vrieze, M Nieuwdorp, S Fuentes, EG Zoetendal, WM de Vos, CE Visser, EJ Kuijper, JF Bartelsman, JG Tijssen, P Speelman, MG Dijkgraaf, JJ Keller. Duodenal infusion of donor feces for recurrent Clostridium difficile. N Engl J Med 2013; 368(5): 407–415
https://doi.org/10.1056/NEJMoa1205037 pmid: 23323867
Related articles from Frontiers Journals
[1] Xinyao Tian, Zhe Yang, Fangzhou Luo, Shusen Zheng. Gut microbial balance and liver transplantation: alteration, management, and prediction[J]. Front. Med., 2018, 12(2): 123-129.
[2] Farhad Sahebjam,John M. Vierling. Autoimmune hepatitis[J]. Front. Med., 2015, 9(2): 187-219.
[3] Lei Li,Yimei Liu,Tiancheng Luo,Jian Zhou,Yingyong Hou,Xizhong Shen,Jiyao Wang. Comprehensive treatment of acute-on-chronic liver failure in a patient with hepatitis B: a case report[J]. Front. Med., 2014, 8(2): 250-253.
[4] Jiang LI, Yu HOU, Jing LIU, Bin LIU, Li LI. A better way to do small-for-size liver transplantation in rats[J]. Front Med, 2011, 5(1): 106-110.
[5] Nianqiao GONG, Xiaoping CHEN. Partial liver transplantation[J]. Front Med, 2011, 5(1): 1-7.
[6] Peng-Ji GAO, Xi-Sheng LENG, Dong WANG, Guang-Ming LI, Lei HUANG, Jie GAO, JI-Ye ZHU, . Graft versus host disease after liver transplantation: A case report[J]. Front. Med., 2010, 4(4): 469-472.
[7] MA Jingzhi, LI Ming, CAO Yingguang. Treatment of gingival hyperplasia induced by cyclosporine A[J]. Front. Med., 2008, 2(3): 290-294.
[8] YAN Lunan, WEN Tianfu, WANG Wentao, YANG Jiayin, XU Mingqing, CHEN Zheyu, WU Hong. Reducing biliary complications in adult-to-adult living donor liver transplantation using right lobe graft: experience of 124 cases[J]. Front. Med., 2008, 2(2): 130-133.
[9] LU Ling, ZHANG Feng, PU Liyong, YAO Aihua, YU Yue, SUN Beicheng, LI Guoqiang, WANG Xuehao. Biological features of intrahepatic CD4+CD25+ T cells in the naturally tolerance of rat liver transplantation[J]. Front. Med., 2007, 1(4): 373-376.
[10] ZHANG Feng, WANG Xuehao, LI Xiangcheng, KONG Lianbao, SUN Beicheng, LI Guoqiang, QIAN Xiaofen, CHEN Feng, WANG Ke, LU Sheng, PU Liyong, LU Ling. Emergency adult living donor right lobe liver transplantation for fulminant hepatic failure[J]. Front. Med., 2007, 1(3): 282-286.
[11] SHU Ming, PENG Chenghong, CHEN Hao, SHEN Boyong, ZHOU Guangwen, SHEN Chuan, LI Hongwei. Intra-abdominal hypertension is an independent cause of acute renal failure after orthotopic liver transplantation[J]. Front. Med., 2007, 1(2): 167-172.
[12] WANG Zhonggao. To restrict indication for stenting of the inferior vena cava and liver transplantation in patients with Budd-Chiari syndrome[J]. Front. Med., 2007, 1(2): 130-135.
[13] YAN Lunan, ZENG Yong, WEN Tianfu, ZHAO Jichun, WANG Wentao, YANG Jiayin, XU Mingqing, MA Yukui, CHEN Zheyu, LIU Jiangwen, WU Hong. Preliminary experience in adult-to-adult living donor liver transplantation in a single center in China[J]. Front. Med., 2007, 1(2): 136-141.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed