Novel reference gene microseminoprotein‐beta based prostate cancer antigen 3 urine test: Enhanced diagnostic performance for prostate cancer and feasibility of non‐digital rectal examination urine sampling

Abstract

Background: The diagnosis of prostate cancer (PCa) is limited by low specificity and invasiveness. This study aims to establish a highly accurate, noninvasive reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR)‐based urinary prostate cancer antigen 3 (PCA3) assay system and explore the feasibility of using first‐morning urine instead of post‐digital rectal examination (DRE) samples.

Methods: Three prospective multicenter cohort studies were conducted on 643 Chinese men. Urine PCA3 expression was quantified by RT‐qPCR, using either the novel reference gene microseminoprotein‐beta (MSMB) or conventional kallikrein‐related peptidase 3 (KLK3, encoding prostate‐specific antigen, PSA). Diagnostic performance was evaluated through receiver operating characteristic (ROC) analysis in Cohort I (n = 176), with validation in Cohort II (n = 350). In Cohort III (n = 117), the diagnostic accuracy of PCA3/MSMB test was compared between DRE and non‐DRE urine samples.

Results: The PCA3/MSMB RT‐qPCR system showed high precision and stability. In Cohort I, the PCA3/MSMB test demonstrated superior diagnostic performance compared with the PCA3/KLK3 test, with a significantly higher area under the receiver operating characteristic curve (AUC) (0.869 vs. 0.830, p = 0.0468), higher sensitivity (82.1% vs. 79.0%), and higher specificity (77.8% vs. 74.1%). Cohort II confirmed these results, yielding a sensitivity of 82.63% and a specificity of 77.50%. In Cohort III, no significant difference in diagnostic performance was observed between non‐DRE and DRE urine samples (AUC 0.859 vs. 0.850, p = 0.6262), suggesting the potential for simplified sample collection.

Conclusion: The PCA3/MSMB urine test is a promising noninvasive diagnostic tool for PCa; it can reduce unnecessary biopsies and improve detection accuracy using non‐DRE urine samples.

Graphical abstract

Keywords

MSMB / non‐DRE / noninvasive diagnosis / PCA3 / prostate cancer / RT‐qPCR / urine

1 INTRODUCTION

Prostate cancer (PCa) is the second most prevalent cancer in men worldwide, with 1 467 854 new cases and 397 430 deaths reported in 2022[1]. The annual percentage change in age‐standard incidence rates for PCa worldwide from 2014 to 2019 was 0.32%[2]. Early‐stage localized PCa can be treated radically with radiation or surgery[3,4]. However, once the disease has metastasized, radical treatment is no longer available, resulting in a poorer prognosis[5,6]. Therefore, early diagnosis is crucial for improving patient survival.

The gold standard for PCa diagnosis is puncture biopsy, however, it is an invasive procedure associated postoperative complications, including bleeding and infection[7–11]. Prostate‐specific antigen (PSA) is currently the most commonly used biomarker for PCa screening and diagnosis, but it has low specificity, especially in the so‐called gray zone (4.0–10.0 ng/mL), where the specificity is only 25%–40%, resulting in a large number of unnecessary biopsies and reduced utility in clinical practice[12–14].

Several biomarkers, such as the prostate health index (PHI), the TMPRSS2‐ERG fusion gene, 4K score, and prostate cancer antigen 3 (PCA3), have been shown to improve the specificity and sensitivity of PCa diagnosis, reducing unnecessary biopsies in patients[15–19]. Among these biomarkers, PCA3 is the most PCa‐specific gene identified to date. PCA3 expression is restricted to prostate tissue and is absent in other normal human tissues[18]. Located on chromosome 9q21‐22, PCA3 encodes a long non‐coding RNA that is highly over‐expressed in PCa tissue compared to benign tissue[18]. However, the area under the receiver operating characteristic curve (AUC) of PCA3 for the clinical PCa detection is approximately 0.75, which remains suboptimal, and its diagnostic utility is further limited by the requirement for urine collection after digital rectal examination (DRE).

In this study, we developed a PCA3‐based reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR) assay for the noninvasive diagnosis of PCa. We chose the microseminoprotein‐beta (MSMB) gene as a reference gene instead of the traditional kallikrein‐related peptidase 3 (KLK3). MSMB, also known as prostate secretory protein, is a nearly prostate‐specific protein secreted by the luminal epithelial cells in the prostate. MSMB is one of the three most abundant proteins secreted by the prostate[20,21]. The MSMB gene, located on chromosome 10q11.2, is abundantly and specifically expressed in prostate tissue. These characteristics make it an attractive reference gene, expected to provide more accurate and reliable normalization of PCA3 expression levels[22].

The study population included men with suspected PCa. To investigate the feasibility of utilizing non‐DRE urine as an alternative to DRE urine for PCa diagnosis, morning urine and post‐DRE urine samples were collected, and PCA3 expression in urinary sediment was measured using RT‐qPCR. Combining the PCA3 levels with clinicopathologic findings, we evaluated the diagnostic performance of the assay for PCa detection.

2 MATERIALS AND METHODS

2.1 Study population

Three prospective multicenter studies were conducted at three medical centers (West China Hospital of Sichuan University, the Second Affiliated Hospital Zhejiang University School of Medicine, and the First Affiliated Hospital of Wenzhou Medical University) during February to May 2024 (Cohort I), May to December 2024 (Cohort II), and January to March 2025 (Cohort III). A total of 674 subjects were initially enrolled; 31 were excluded due to their urine RNA concentrations was below 5 ng/μL or A260/A280 ratios fell outside the 1.8–2.1 range. Thus, 643 subjects were included in the final analysis. Urine samples from Cohort I (n = 176) and Cohort II (n = 350) were collected after DRE, while paired DRE and non‐DRE samples from the same patients were collected for Cohort III (n = 117). Participants included men scheduled for prostate biopsy who meet at least one of the following criteria: (1) suspicious prostate nodule on DRE; (2) suspicious lesion identified by transrectal prostate ultrasound (TRUS) or magnetic resonance imaging (MRI); (3) serum PSA > 10 ng/mL; (4) serum PSA 4–10 ng/mL, with abnormal f/t PSA (free PSA/total PSA) or prostate‐specific antigen density (PSAD). Patients who had been treated with anti‐androgen drugs within 1 year or had a previous history of PCa or surgery for PCa were excluded. Pathological examination of biopsies was performed by urologic pathologists at each medical center. The study was performed in accordance with the Declaration of Helsinki. The study protocols were approved by the Ethics Committee of West China Hospital of Sichuan University (approval number: HX‐IRB‐AF‐I2‐V4.0), the Second Affiliated Hospital Zhejiang University School of Medicine (approval number: 2024‐MD‐365), and the First Affiliated Hospital of Wenzhou Medical University (approval number:FAHWMU‐2024‐PMD‐140), and written informed consent was obtained from each participant.

2.2 Sample collection and processing

A 20 mL of DRE urine was collected following a standardized DRE[23]. A 40 mL of non‐DRE urine was collected from the first morning urine. Urine samples were collected using a disposable sampler (Hangzhou York Biotech, Zhejiang Hangzhou Instrument Record No. 20190694), a collection tube containing 10 mL of urine preservation solution. Samples were shipped to the central laboratory at room temperature and immediately stored at a 4°C.

Nucleic acid extraction was performed within 5 days of collection using a nucleic acid extraction kit (Hangzhou York Biotech, Zhejiang Hangzhou Instrument Record No. 20190691) following the manufacturer's instructions. RNA concentration and purity were measured using NanoDrop (Thermo Fisher, NanoDrop One, USA). Subjects with sample RNA concentrations below 5 ng/μL or A260/A280 ratios outside 1.8–2.1 were excluded.

2.3 RT‐qPCR assay

PCA3 transcript levels were quantified in the urine sediment using the time‐resolved fluorescence‐based quantitative RT‐qPCR protocol. KLK3 or MSMB served as the reference gene for relative quantification.

For reverse transcription, each reaction mix contained 4 μL reverse transcription premix (ABclonal, Cat. No. RK20403, China), and 16 μL of RNA samples to make a final volume of 20 μL. Reverse transcription was carried out at 37°C for 25 min followed by heat inactivation at 85°C for 10 s.

For PCR amplifications, each reaction mix contained 15 μL PCR premix, (HuanKai Microbial, Cat. No. HKE091), 1.25 μL of 10 μmol/L forward primer, 1.25 μL of 10 μmol/L reverse primer, 2.5 μL of probe, 10 μL of cDNA template to make a final volume of 30 μL. The PCA3‐specific primers were as follows: forward, 5′‐CACAAAAGGAAGCACAGAGAT‐3′, and reverse, 5′‐GTCTGTTTTCCTCTCATTGGT‐3′. The MSMB‐specific primers were as follows: forward, 5′‐ CCAGGAGATTCAACCAGGAA‐3′, and reverse, 5′‐ CAGTCTGCCACTCCGAGTTT‐3′. The KLK3‐specific primers were as follows: forward, 5′‐ GCATTGAACCAGAGGAGTTCT‐3′, and reverse, 5′‐ CACAGCATGAACTTGGTCA‐3′. Reactions were performed with the qPCR system in the following conditions: 95°C for 10 min, followed by 45 cycles of denaturation at 95°C for 10 s and annealing/extension at 60°C for 30 s.

2.4 Evaluation of precision, linearity, and anti‐interference capability of the RT‐qPCR system for PCA3/MSMB test

To assess the precision of RT‐qPCR system for PCA3/MSMB test, twenty RT‐qPCR analyses were performed on strongly positive (mixture of 15 000 copies/μL for both PCA3 RNA and MSMB RNA) and weakly positive samples (mixture of 200 copies/μL for both PCA3 RNA and MSMB RNA). Cycle threshold (Ct) values and the coefficients of variation were calculated. The PCA3 RNA and MSMB RNA reference standards were synthesized by Huzhou Hippo Biotechnology Co., Ltd. The copy number concentrations of PCA3 and MSMB RNA were converted by the following formula: Concentration of copy number (copies/μL)=\frac{N\left(\mathrm{ng}/\mathrm{\mu L}\right)}{M\left(\mathrm{g}/\mathrm{mol}\right)}\times 6.02\times10¹⁴ where N is the RNA concentration detected by NanoDrop (Thermo Fisher, NanoDrop One, USA) and M is the molecular mass of the RNA fragments.

To assess the linearity, 10‐fold serial dilutions (1 × 10² to 1 × 10⁶ copies/μL) of PCA3 and MSMB RNA mixtures were tested in triplicate. The correlation coefficients between the Ct values and the logarithmic values of the corresponding RNA concentrations of PCA3 and MSMB were calculated.

To assess the anti‐interference capability, 20 potential interfering substances were added to urine samples from both healthy men and PCa patients. The twenty interfering substances were: 2 g/L hemoglobin, 60 g/L albumin, 0.35 mmol/L bilirubin, 1.5 mmol/L uric acid, 60 mmol/L glucose, 40 mmol/L cholesterol, 0.4 g/L vitamin C, 1.5 mmol/L acetaminophen, 5% whole blood, 50 µmol/L levofloxacin, 12 µmol/L penicillin, 1.2 µmol/L doxazosin, 25 mg/L atorvastatin, 0.3 mmol/L metformin, 30 mg/L alfuzosin, 0.3 mmol/L allopurinol, 0.25 µmol/L amlodipine, 5 × 10⁶ CFU/mL Escherichia coli, 5 × 10⁶ CFU/mL Staphylococcus aureus, and 5 × 10⁶ CFU/mL Candida albicans. Urine samples from healthy men and PCa patients without added interfering substances were used as controls. The PCA3/MSMB test was performed on the interference and control samples. Anti‐interference was evaluated by comparing Ct values and diagnostic accuracy between interference and control samples. Compared with the control samples, the Ct values and ΔCt values of the samples containing interfering substances showed no significant differences. Moreover, in urine containing interfering substances, the diagnostic accuracy of the PCA3/MSMB test remained 100% (with the cut‐off value set at 5.32), indicating that these substances did not interfere with the RT‐qPCR assay.

2.5 Statistical analysis

Statistical analyses were performed using GraphPad Prism (version 8.0.2) and MedCalc (version 23.0.1). For comparison between two groups of continuous variables, the Welch t test or the Mann–Whitney U test was used as a nonparametric alternative when the data failed the Kolmogorov–Smirnov test for normality. For comparisons among three groups of continuous variables, one‐way analysis of variance (ANOVA) or the Kruskal–Wallis test was applied accordingly. Qualitative variables were compared using the chi‐square test. Pearson's correlation coefficient was calculated for correlations analyses. The sensitivity and specificity of diagnostic performance were evaluated using receiver operating characteristic (ROC) curves, with the AUC serving as a measure of the marker's discriminative efficacy. The 95% confidence intervals (CIs) and comparisons of AUCs were performed using MedCalc software. Paired samples were compared using DeLong's test, while independent samples were compared using the Hanley and McNeil method. Youden index was used to determine the optimal cut‐off value for model scores. Statistically significant differences were set at p < 0.05. ****: p < 0.0001.

3 RESULTS

3.1 Patient characteristics

A total of 643 urine samples were collected in three independent prospective clinical trials (Cohort I: n = 176; Cohort II: n = 350; Cohort III: n = 117). Table 1 summarizes the patient characteristics. In Cohort I, 95 of 176 men (53.98%) had positive biopsy results, compared with 190 of 350 men (54.29%) in the Cohort II and 55 of 117 men (47.01%) in Cohort III. No statistically significant differences in baseline characteristics were observed among the cohorts, except for fPSA levels.

3.2 Precision, linearity, and anti‐interference capability of the RT‐qPCR system for PCA3/MSMB test

As shown in Figure 1A,B, the coefficients of variation (CVs) of Ct values in strongly positive samples were 0.18% for PCA3 and 0.23% for MSMB. For weakly positive samples, the CVs were 0.46% and 0.27%, respectively. These results demonstrate the high precision of the RT‐qPCR assay. In terms of linearity, the correlation coefficients between Ct values and the logarithmic values of PCA3 and MSMB RNA concentrations were −0.9999 and −1.0000, respectively, indicating the near‐perfect linearity of the RT‐qPCR assay (Figure 1C,D). In samples containing interfering substances, the diagnostic accuracy of the PCA3/MSMB test remained 100% (cut‐off value: 5.32), and the differences in Ct and ΔCt values relative to control samples were less than 1 and not statistically significant (Figure 1E,F and Table S1). These results demonstrate that the PCA3/MSMB RT‐qPCR assay exhibits potent anti‐interference capability and performs reliably in complex urine matrices.

3.3 Diagnostic performance

A total of 176 urine samples with corresponding clinical diagnostic data were collected from 95 PCa patients and 81 benign patients in Cohort I, serving as the training cohort. PCA3 expression levels were detected by RT‐qPCR using MSMB as the reference gene (PCA3/MSMB test). For comparison, PCA3 expression was also normalized to the commonly used reference gene KLK3 (PCA3/KLK3 test).

The diagnostic performance of these biomarkers is summarized in Table 2. The AUC of the PCA3/MSMB test was 0.869 (95% CI: 0.810–0.915; p < 0.0001), with an optimal cut‐off value of 5.32, a sensitivity of 82.1%, and a specificity of 77.8%. The AUC of the PCA3/KLK3 test was 0.830 (95% CI: 0.767–0.883; p < 0.0001), with an optimal cut‐off value of 3.72, a sensitivity of 79.0%, and a specificity of 74.1% (Figure 2A). AUC of the PCA3/MSMB test was significantly higher than that of the PCA3/KLK3 test (p = 0.0468), confirming that MSMB is a more effective reference gene than KLK3. Using PCA3 alone yielded an AUC of 0.764, and adding MSMB significantly improved performance (AUC 0.869 vs. 0.764; p = 0.0055). In contrast, adding KLK3 did not produce a statistically significant improvement (AUC 0.830 vs. 0.763; p = 0.0856).

In the “gray zone” subgroup (4.0–10.0 ng/mL), MSMB also outperformed KLK3. As shown in Table 3, within this subgroup (Cohort I), the PCA3/MSMB test achieved an 80.6% diagnostic accuracy (95% CI: 69.2%–88.6%), with an 87.9% sensitivity (95% CI: 70.9%–96.0%) and 74.4% specificity (95% CI: 57.6%–86.4%). In comparison, the PCA3/KLK3 test showed 76.4% accuracy (95% CI: 64.7%–85.3%), 81.8% sensitivity, and 71.8% specificity. Clinically, this translates to fewer unnecessary biopsies (25.6% false‐positive rate for PCA3/MSMB vs. 28.9% for PCA3/KLK3) and reduced missed diagnoses (12.1% false‐negative rate vs. 17.6%) within this clinically challenging subgroup. As shown in Figure 2B, the Ct value for MSMB were significantly lower than those for KLK3 in identical samples, indicating a higher detectability of the MSMB and enabling reliable measurement from smaller sample volumes. In samples with low KLK3 expression, the AUC value obtained using MSMB (AUC = 0.863) was higher than that using KLK3 (AUC = 0.815); although this difference was not statistically significant (DeLong test p = 0.2194) (Figure S1).

3.4 Diagnostic performance validation

In Cohort II (n = 350), using a cut‐off value of 5.32, the PCA3/MSMB test showed a sensitivity of 82.63%, specificity of 77.50%, positive predictive value of 81.35%, and negative predictive value of 78.98% (Figure 2C and Table 4). These results closely matched those of Cohort I, confirming the robustness and reproducibility of the PCA3/MSMB assay.

To provide a simple value for informing patients, we convert the Ct value to the relative PCA3 expression level using the following formula, referred to as PCA3 index:

\begin{array}{}& PCA\mathit{3}\text{Index}=2^{–\mathrm{\Delta }\text{Ct}}\times 1000,\end{array}

where ΔCt is the Ct value of PCA3 minus the Ct value of MSMB, that is, ΔCt = Ct [PCA3] ‐ Ct [MSMB]. For cut‐off value of 5.32, the PCA3 index equals 25. A PCA3 index higher than 25 suggests a high risk of PCa.

3.5 Diagnostic performance of DRE versus non‐DRE urine samples

To investigate whether non‐DRE urine samples provide the same diagnostic performance as DRE urine samples, 117 paired DRE and non‐DRE urine samples were collected from the same patients in Cohort III. PCA3/MSMB test was performed on all samples (Figure 2D). The AUC values of DRE and non‐DRE urine samples were 0.859 (95% CI: 0.783–0.917; p < 0.0001) and 0.850 (95% CI: 0.772–0.909; p < 0.0001), respectively, demonstrating comparable diagnostic accuracy (p = 0.6262 difference of AUCs). These findings indicate that non‐DRE urine samples have the potential to replace DRE urine samples, thereby simplifying specimen collection.

4 DISCUSSION

This study employed the novel reference gene MSMB to establish the PCA3/MSMB test, which demonstrates superior diagnostic performance. It demonstrated that the test holds potential to replace DRE urine samples with non‐DRE urine samples, thereby simplifying sample collection. Multiple studies and meta‐analyses have evaluated the diagnostic accuracy of PCA3, almost all of which have used post‐DRE urine and KLK3 as the reference gene[18,24–27]. A comprehensive meta‐analysis of 46 clinical trials involving 12 295 subjects reported that the pooled sensitivity of 0.65, specificity of 0.73, and AUC of 0.75, indicating acceptable diagnostic performance[28]. The present study developed a highly sensitive and specific diagnostic using a novel reference gene MSMB and demonstrated improved diagnostic accuracy in both DRE and non‐DRE urine samples. This improvement has the potential to reduce reliance on invasive biopsies.

In this study, the RT‐qPCR system for the PCA3/MSMB test exhibited strong anti‐interference capability, high precision, and excellent linearity, confirming its reliability in complex clinical settings. These analytical validation results support its suitability as a stable and robust diagnostic assay.

The diagnostic performance of the PCA3/MSMB test was validated in Cohort I, with a sensitivity of 82.1% and a specificity of 77.8%, which are comparable to or exceed those reported in previous PCA3‐based studies[18,29,30]. Furthermore, the PCA3/MSMB test demonstrated higher diagnostic accuracy than the PCA3/KLK3 test, especially in the PSA gray zone to reduce over‐biopsies and underdiagnosis. These results suggest that MSMB is a more reliable reference gene for PCA3 testing than the traditional KLK3 in PCa diagnosis.

The Cohort II further confirmed the diagnostic performance of the PCA3/MSMB test, with similar sensitivity and specificity to the Cohort I. The similar sensitivity and specificity observed across independent cohorts enhance confidence in the robustness and reproducibility of this assay. This is particularly important given the heterogeneity of PCa and the need for accurate and consistent biomarkers to guide clinical decision‐making[31,32].

Current PCA3 and other molecular assays generally require post‐DRE urine collection, adding complexity to clinical workflows. This study investigated whether non‐DRE urine samples could achieve similar diagnostic performance to DRE urine samples. The results showed that non‐DRE urine had comparable diagnostic performance. This finding offers substantial clinical advantages: non‐DRE sampling supports home‐based collection, simplifies primary care workflows, facilitates repeat sampling, and improves overall patient experience by eliminating DRE‐related discomfort. This is particularly useful for patients on active surveillance, in whom periodic noninvasive monitoring is essential. The specific mechanism by which the PCA3/MSMB test maintains stability without DRE remains incompletely elucidated. This may be attributed to the superior detectability of MSMB, thereby sustaining detection performance with a limited number of exfoliated cells present in morning urine. Further studies are warranted to elucidate these potential mechanisms.

We acknowledge several limitations of this study. First, all participants were Chinese men; therefore, generalizability to other ethnic groups requires further validation. Second, pathological evaluation was performed by local pathologists at each center without centralized review, so the impact of inter‐observer variability in Gleason (ISUP) grading was not assessed. Third, the study focused on diagnostic accuracy at the time of biopsy and did not include long‐term outcomes; thus, the prognostic value of the PCA3/MSMB test remains unknown. Fourth, although PSAD was an inclusion criterion, prostate volume data were not collected, limiting further analysis of the relationship between PSAD and PCA3/MSMB performance. Finally, head‐to‐head comparisons with other commercially available biomarker panels (e.g., PHI, 4K score) were not performed, and future studies should evaluate the comparative clinical and economic value of PCA3/MSMB testing.

Clinically, the PCA3/MSMB test should be used as an adjunctive tool in patients with equivocal or borderline diagnostic findings. In the PSA gray zone (4.0–10.0 ng/mL), a positive PCA3/MSMB result favors proceeding with biopsy, whereas a negative result may support deferring biopsy in favor of multiparametric MRI (mpMRI) and close follow‐up. However, a negative PCA3/MSMB test does not eliminate the need for biopsy in patients with high‐risk features such as suspicious DRE findings or PI‐RADS ≥ 4 lesions on mpMRI. Conversely, in patients with low PSA (< 4.0 ng/mL) but concerning clinical findings, a positive PCA3/MSMB result may justify closer surveillance or biopsy.

We acknowledge that several authors are employees of Hangzhou York Biotech Co., Ltd., the manufacturer of the assay kits used in this study. To minimize potential bias, the study design oversight, clinical recruitment, sample collection, and pathological diagnosis were independently conducted by three academic medical centers. All biopsy results were assessed by urologic pathologists blinded to assay results. Data analyses were performed jointly by company and academic investigators, and independent verification was carried out before manuscript submission. All authors had unrestricted access to the raw data and participated in data interpretation and manuscript approval. The entire research process was supervised by the ethics committees of all participating institutions, and academic independence was maintained throughout study design, result interpretation, and manuscript preparation. These procedures were implemented to ensure the objectivity and scientific integrity of the study.

5 CONCLUSION

The PCA3/MSMB urine test is a noninvasive and accurate tool for PCa diagnosis, outperforming PCA3/KLK3 assay. Its compatibility with non‐DRE samples simplifies clinical implementation, and this promising noninvasive diagnostic method has the potential to reduce unnecessary biopsies and improve the overall accuracy of PCa detection.

References

[1] Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024;74(3):229–263.

[2] He H, Liang L, Han D, Xu F, Lyu J. Different trends in the incidence and mortality rates of prostate cancer between China and the USA: a joinpoint and age‐period‐cohort analysis. Front Med. 2022;9:824464.

[3] Cornford P, van den Bergh RCN, Briers E, Van den Broeck T, Brunckhorst O, Darraugh J, et al. EAU‐EANM‐ESTRO‐ESUR‐ISUP‐SIOG guidelines on prostate cancer‐2024 update. Part I: screening, diagnosis, and local treatment with curative intent. Eur Urol. 2024;86(2):148–163.

[4] Wallis CJD, Saskin R, Choo R, Herschorn S, Kodama RT, Satkunasivam R, et al. Surgery versus radiotherapy for clinically‐localized prostate cancer: a systematic review and meta‐analysis. Eur Urol. 2016;70(1):21–30.

[5] Achard V, Putora PM, Omlin A, Zilli T, Fischer S. Metastatic prostate cancer: treatment options. Oncology. 2022;100(1):48–59.

[6] Tilki D, van den Bergh RCN, Briers E, Van den Broeck T, Brunckhorst O, Darraugh J, et al. EAU‐EANM‐ESTRO‐ESUR‐ISUP‐SIOG guidelines on prostate cancer. Part II‐2024 update: treatment of relapsing and metastatic prostate cancer. Eur Urol. 2024;86(2):164–182.

[7] Ortner G, Tzanaki E, Rai BP, Nagele U, Tokas T. Transperineal prostate biopsy: The modern gold standard to prostate cancer diagnosis. Türk Üroloji Dergisi/Turkish J Urol. 2021;47:S19–S26.

[8] Romics I. Ultrasound guided biopsy, a gold standard diagnostical test of the prostate cancer. Acta Chir Iugosl. 2005;52(4):23–26.

[9] Bennett HY, Roberts MJ, Doi SAR, Gardiner RA. The global burden of major infectious complications following prostate biopsy. Epidemiol Infect. 2016;144(8):1784–1791.

[10] Halpern JA, Sedrakyan A, Dinerman B, Hsu WC, Mao J, Hu JC. Indications, utilization and complications following prostate biopsy: New York state analysis. J Urol. 2017;197(4):1020–1025.

[11] Loeb S, Vellekoop A, Ahmed HU, Catto J, Emberton M, Nam R, et al. Systematic review of complications of prostate biopsy. Eur Urol. 2013;64(6):876–892.

[12] Gomella LG, Liu XS, Trabulsi EJ, Kelly WK, Myers R, Showalter T, et al. Screening for prostate cancer: the current evidence and guidelines controversy. Can J Urol. 2011;18(5):5875–5883.

[13] Van Poppel H, Albreht T, Basu P, Hogenhout R, Collen S, Roobol M. Serum PSA‐based early detection of prostate cancer in Europe and globally: past, present and future. Nat Rev Urol. 2022;19(9):562–572.

[14] Roddam AW, Duffy MJ, Hamdy FC, Ward AM, Patnick J, Price CP, et al. Use of prostate‐specific antigen (PSA) isoforms for the detection of prostate cancer in men with a PSA level of 2–10 ng/mL: systematic review and meta‐analysis. Eur Urol. 2005;48(3):386–399.

[15] Ye C, Ho JN, Kim DH, Song SH, Kim H, Lee H, et al. The Prostate Health Index and multi‐parametric MRI improve diagnostic accuracy of detecting prostate cancer in Asian populations. Investig Clin Urol. 2022;63(6):631–638.

[16] Yao Y, Wang H, Li B, Tang Y. Evaluation of the TMPRSS2: ERG fusion for the detection of prostate cancer: a systematic review and meta‐analysis. Tumor Biol. 2014;35(3):2157–2166.

[17] Uhr A, Glick L, Gomella LG. An overview of biomarkers in the diagnosis and management of prostate cancer. Can J Urol. 2020;27:24–27.

[18] Hessels D, Klein Gunnewiek JMT, van Oort I, Karthaus HFM, van Leenders GJL, van Balken B, et al. DD3(PCA3)‐based molecular urine analysis for the diagnosis of prostate cancer. Eur Urol. 2003;44(1):8–16.

[19] Alford AV, Brito JM, Yadav KK, Yadav SS, Tewari AK, Renzulli J. The use of biomarkers in prostate cancer screening and treatment. Rev Urol. 2017;19(4):221–234.

[20] Kote‐Jarai Z, Leongamornlert D, Tymrakiewicz M, Field H, Guy M, Al Olama AA, et al. Mutation analysis of the MSMB gene in familial prostate cancer. Br J Cancer. 2010;102(2):414–418.

[21] Chan PSF, Chan LW, Xuan JW, Chin JL, Choi HL, Chan FL. In situ hybridization study of PSP94 (prostatic secretory protein of 94 amino acids) expression in human prostates. Prostate. 1999;41(2):99–109.

[22] Sjoblom L, Saramaki O, Annala M, Leinonen K, Nattinen J, Tolonen T, et al. Microseminoprotein‐beta expression in different stages of prostate cancer. PLoS One. 2016;11(3):e0150241.

[23] Groskopf J, Aubin SM, Deras IL, Blase A, Bodrug S, Clark C, et al. APTIMA PCA3 molecular urine test: development of a method to aid in the diagnosis of prostate cancer. Clin Chem. 2006;52(6):1089–1095.

[24] Tinzl M, Marberger M, Horvath S, Chypre C. DD3 RNA analysis in urine? a new perspective for detecting prostate cancer. Eur Urol. 2004;46(2):182–187.

[25] Marks LS, Fradet Y, Lim Deras I, Blase A, Mathis J, Aubin SMJ, et al. PCA3 molecular urine assay for prostate cancer in men undergoing repeat biopsy. Urology. 2007;69(3):532–535.

[26] Deras IL, Aubin SMJ, Blase A, Day JR, Koo S, Partin AW, et al. PCA3: a molecular urine assay for predicting prostate biopsy outcome. J Urol. 2008;179(4):1587–1592.

[27] Shu X, Wang J, Cai W, Lin S, Li J, Ma X, et al. Clinical assessment of urinary prostate cancer antigen 3 in Chinese population: a large‐scale, prospective and multicenter study. World J Surg Oncol. 2024;22(1):355.

[28] Cui Y, Cao W, Li Q, Shen H, Liu C, Deng J, et al. Evaluation of prostate cancer antigen 3 for detecting prostate cancer: a systematic review and meta‐analysis. Sci Rep. 2016;6:25776.

[29] Laxman B, Morris DS, Yu J, Siddiqui J, Cao J, Mehra R, et al. A first‐generation multiplex biomarker analysis of urine for the early detection of prostate cancer. Cancer Res. 2008;68(3):645–649.

[30] Jiang Z, Zhao Y, Tian Y. Comparison of diagnostic efficacy by two urine PCA3 scores in prostate cancer patients undergoing repeat biopsies. Minerva Urol Nefrol. 2019;71(4):373–380.

[31] Haffner MC, Zwart W, Roudier MP, True LD, Nelson WG, Epstein JI, et al. Genomic and phenotypic heterogeneity in prostate cancer. Nat Rev Urol. 2021;18(2):79–92.

[32] Bian X, Wang W, Abudurexiti M, Zhang X, Ma W, Shi G, et al. Integration analysis of single‐cell multi‐omics reveals prostate cancer heterogeneity. Adv Sci. 2024;11(18):e2305724.

Rights & permissions

2026 The Author(s). UroPrecision published by John Wiley & Sons Australia, Ltd on behalf of Higher Education Press.