Unveiling the role of ubiquitin-specific protease family in osteoporosis: A focus on USP17L2 and USP19

Abstract

Background: The ubiquitin-proteasome system is vital for regulating protein stability and function, influencing numerous cellular processes, including bone homeostasis. Aim: This study aims to uncover the role of the ubiquitin-specific protease (USP) family in osteoporosis. Methods: The osteoporosis expression microarray profile was analyzed to identify differentially expressed genes (DEGs). DEGs related to ubiquitins were isolated, followed by the analysis of biological pathways and gene ontology for these genes. The interactions between differentially expressed ubiquitins (DE-Ubs) and their targets were examined using the UbiBrowser database. Ultimately, a network of interactions between DE-Ubs and their targets in the context of osteoporosis was constructed. The diagnostic potential of the DE-Ubs was evaluated using receiver operating characteristic (ROC) analysis. Additionally, antisense oligonucleotide design and validation were performed using various bioinformatics tools, including Sfold, IDT OligoAnalyzer, RNAfold, RNAhybrid, and HNADOCK. Results: Among the 1,082 DEGs, USP19 and USP17L2 were recognized as statistically significant due to their involvement in the mitogen-activated protein kinase and Ras signaling pathways. The diagnostic potential of USP19 as a biomarker was confirmed through ROC analysis, demonstrating its high predictive accuracy in osteoporosis. Among the designed antisense oligonucleotides for USP19, the sequence TGTCACGCCAGATAAAACTA showed the most favorable predicted properties according to the ΔG values and structural stability. Conclusion: This study provides insights into the USP family genes associated with osteoporosis and identifies potential therapeutic targets for further investigation. Relevance for patients: This study identifies USP19 as a promising biomarker for early osteoporosis detection.

Keywords

USP19 / USP17L2 / Antisense oligonucleotides / Osteoporosis / Protein- protein interaction

References

[1] Lyu FF, Ramoo V, Chui PL, Ng CG, Zhang Y. Prevalence rate of primary osteoporosis in China: a meta-analysis. BMC Public Health. 2024; 24(1):1518. doi: 10.1186/s12889-024-18932-w

[2] Shen Y, Huang X, Wu J, et al. The Global Burden of Osteoporosis, Low Bone Mass, and Its Related Fracture in 204 Countries and Territories, 1990-2019. Front Endocrinol. 2022; 13:882241. doi: 10.3389/fendo.2022.882241

[3] Dehghan M PJR, Mousavi S Z. Mutational Study in the Exon2 of Osteoprotegrin Gene in Osteoporotic Women in Chahar Mahal va Bakhtiari Province of Iran. Zahedan J Res Med Sci. 2023: 25(1):e116972. doi: 10.5812/zjrms-116972

[4] Luo W, Zhang G, Wang Z, Wu Y, Xiong Y. Ubiquitin-specific proteases: Vital regulatory molecules in bone and bone-related diseases. Int Immunopharmacol. 2023; 118:110075. doi: 10.1016/j.intimp.2023.110075

[5] Fan X, Zhang R, Xu G, et al. Role of ubiquitination in the occurrence and development of osteoporosis (Review). Int J Mol Med. 2024; 54(2). doi: 10.3892/ijmm.2024.5392

[6] Xia G, Guo Y, Zhang J, Han M, Meng X, Lv J. An Overview of the Deubiquitinase USP53: A Promising Diagnostic Marker and Therapeutic Target. Curr Protein Pept Sci. 2024; 25(9):708-718. doi: 10.2174/0113892037292440240518194922

[7] Sun T, Liu Z, Yang Q. The role of ubiquitination and deubiquitination in cancer metabolism. Mol Cancer. 2020; 19(1):146. doi: 10.1186/s12943-020-01262-x

[8] Baker HA, Bernardini JP. It’s not just a phase; ubiquitination in cytosolic protein quality control. Biochem Soc Trans. 2021; 49(1):365-377. doi: 10.1042/BST20200694

[9] Roberts JZ, Crawford N, Longley DB. The role of Ubiquitination in Apoptosis and Necroptosis. Cell Death Differ. 2022; 29(2):272-284. doi: 10.1038/s41418-021-00922-9

[10] Li Y, Li S, Wu H. Ubiquitination-Proteasome System (UPS) and Autophagy Two Main Protein Degradation Machineries in Response to Cell Stress. Cells. 2022; 11(5). doi: 10.3390/cells11050851

[11] Guo YC, Wang MY, Zhang SW, et al. Ubiquitin-specific protease USP34 controls osteogenic differentiation and bone formation by regulating BMP2 signaling. EMBO J. 2018; 37(20). doi: 10.15252/embj.201899398

[12] He H, Wang L, Xian B, Xia Y. Regulatory Roles of E 3 Ubiquitin Ligases and Deubiquitinases in Bone. Biomolecules. 2025; 15(5):679. doi: 10.3390/biom15050679

[13] Tang Y, Lv L, Li W, et al. Protein deubiquitinase USP7 is required for osteogenic differentiation of human adipose-derived stem cells. Stem Cell Res Ther. 2017; 8(1):186. doi: 10.1186/s13287-017-0637-8

[14] Li C, Qiu M, Chang L, et al. The osteoprotective role of USP26 in coordinating bone formation and resorption. Cell Death Differ. 2022; 29(6):1123-1136. doi: 10.1038/s41418-021-00904-x

[15] Shen J, Fu B, Wu Y, et al. USP25 Expression in Peripheral Blood Mononuclear Cells Is Associated With Bone Mineral Density in Women. Front Cell Dev Biol. 2021; 9:811611. doi: 10.3389/fcell.2021.811611

[16] Nicholson TA-O, Sagmeister M, Wijesinghe SA-O, Farah H, Hardy RA-O, Jones SA-O. Oligonucleotide Therapeutics for Age-Related Musculoskeletal Disorders: Successes and Challenges. Pharmaceutics. 2023; 15(1):237. doi: 10.3390/pharmaceutics15010237

[17] Shen JA-O, Lin X, Dai F, et al. Ubiquitin-specific peptidases: Players in bone metabolism. Cell Prolif. 2023; 56(8):1365-2184. doi: 10.1111/cpr.13444

[18] Xie L, Feng E, Li S, et al. Comparisons of gene expression between peripheral blood mononuclear cells and bone tissue in osteoporosis. Medicine. 2023; 102(20):e33829. doi: 10.1097/MD.0000000000033829

[19] Ritchie ME, Phipson B, Wu D, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015; 43(7):e47. doi: 10.1093/nar/gkv007

[20] Guo YC, Zhang SW, Yuan Q. Deubiquitinating Enzymes and Bone Remodeling. Stem Cells Int. 2017; 17(1):3712083. doi: 10.1186/s12935-017-0472-0

[21] Wang X, Li Y, He M, et al. UbiBrowser 2.0: a comprehensive resource for proteome-wide known and predicted ubiquitin ligase/deubiquitinase-substrate interactions in eukaryotic species. Nucleic Acids Res. 2022; 50(D1):D719-d728. doi: 10.1093/nar/gkab962

[22] Chen J, Bardes EE, Aronow BJ, Jegga AG. ToppGene Suite for gene list enrichment analysis and candidate gene prioritization. Nucleic Acids Res. 2009;37(Web Server issue):W305-311. doi: 10.1093/nar/gkp427

[23] Walter W, Sánchez-Cabo F, Ricote M. GOplot: an R package for visually combining expression data with functional analysis. Bioinformatics. 2015; 31(17):2912-2914. doi: 10.1093/bioinformatics/btv300

[24] Pruitt KD, Tatusova T, Maglott DR. NCBI Reference Sequence (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins. Nucleic Acids Res. 2005;33(Database issue):D501-504. doi: 10.1093/nar/gki025

[25] Ding Y, Chan CY, Lawrence CE. Sfold web server for statistical folding and rational design of nucleic acids. Nucleic Acids Res. 2004;32(Web Server issue):W135-141. doi: 10.1093/nar/gkh449

[26] Owczarzy R, Tataurov AV, Wu Y, et al. IDT SciTools: a suite for analysis and design of nucleic acid oligomers. Nucleic Acids Res. 2008;36(Web Server issue):W163-169. doi: 10.1093/nar/gkn198

[27] Hofacker IL.Vienna RNA secondary structure server. Nucleic Acids Research. 2003; 31(13):3429-3431. doi: 10.1093/nar/gkg599

[28] Krüger J, Rehmsmeier M. RNAhybrid: microRNA target prediction easy, fast and flexible. Nucleic Acids Res. 2006;34(Web Server issue):W451-454. doi: 10.1093/nar/gkl243

[29] He J, Wang J, Tao H, Xiao Y, Huang SY. HNADOCK: a nucleic acid docking server for modeling RNA/DNA-RNA/DNA 3D complex structures. Nucleic Acids Res. 2019; 47(W1):W35-w42. doi: 10.1093/nar/gkz412

[30] Cunningham F, Allen JE, Allen J, et al. Ensembl 2022. Nucleic Acids Res. 2022; 50(D1):D988-d995. doi: 10.1093/nar/gkab1049

[31] Lin YC, Zheng G, Liu HT, et al. USP7 promotes the osteoclast differentiation of CD14+ human peripheral blood monocytes in osteoporosis via HMGB1 deubiquitination. J Orthop Transl. 2023; 40:80-91. doi: 10.1016/j.jot.2023.05.007

[32] Pan Y, Tang Y, Gu H, Ge W. Ubiquitin modification in osteogenic differentiation and bone formation: From mechanisms to clinical significance. Front Cell Dev Biol. 2022; 10:1033223. doi: 10.3389/fcell.2022.1033223

[33] Li JJ, Wang BQ, Fei Q, Yang Y, Li D. Identification of candidate genes in osteoporosis by integrated microarray analysis. Bone Jt Res. 2016; 5(12):594-601. doi: 10.1302/2046-3758.512.BJR-2016-0073.R1

[34] Rebowski G, Wójcik M, Boczkowska M, et al. Antisense hairpin loop oligonucleotides as inhibitors of expression of multidrug resistance-associated protein 1: their stability in fetal calf serum and human plasma. Acta Biochim Pol. 2001; 48(4):1061-1076. doi: 10.18388/abp.2001_3867

[35] Papaioannou G, Mirzamohammadi F, Kobayashi T. Ras signaling regulates osteoprogenitor cell proliferation and bone formation. Cell Death Dis. 2016; 7(10):e2405. doi: 10.1038/cddis.2016.314

[36] Lee K, Seo I, Choi MH, Jeong D. Roles of Mitogen-Activated Protein Kinases in Osteoclast Biology. Int J Mol Sci. 2018; 19(10). doi: 10.3390/ijms19103004

[37] Kim JM, Yang YS, Hong J, et al. Biphasic regulation of osteoblast development via the ERK MAPK-mTOR pathway. eLife. 2022; 11. doi: 10.7554/eLife.78069

[38] Sun D, Peng Y, Ge S, Fu Q.USP1 Inhibits NF-κB/NLRP3 Induced Pyroptosis through TRAF6 in Osteoblastic MC3T3-E1 Cells. J Musculoskelet Neuronal Interact. 2022; 22(4):536-545.

[39] Olivos DJ, Perrien DS, Hooker A, et al. The proto-oncogene function of Mdm2 in bone. J Cell Biochem. 2018; 119(11):8830-8840. doi: 10.1002/jcb.27133

[40] Hammond SA-O, Aartsma-Rus AA-OX, Alves SA-O, et al. Delivery of oligonucleotide-based therapeutics: challenges and opportunities. EMBO Mol Med. 2021;13:EMMM202013243. doi: 10.15252/emmm.202013243

[41] Egli MA-OX, Manoharan MA-O. Chemistry, structure and function of approved oligonucleotide therapeutics. Nucleic Acids Res. 2023; 51(6):2529-2573. doi: 10.1093/nar/gkad067