2026-06-30 2026, Volume 12 Issue 3

  • Select all
  • research-article
    Ikemsinachi C. Nzenwa, Raimundas Lunevicius, Jack F. Bennett
    2026, 12(3): 025290041. https://doi.org/10.36922/JCTR025290041

    Background: Little is known about patient-reported outcomes and health-related quality of life (QoL) following subtotal cholecystectomy (STC) for benign gallbladder disease. Aim: To conduct a cross-sectional, survey-based pilot study assessing patient-reported outcomes and health-related QoL among patients who underwent STC for complicated cholecystolithiasis. Methods: Forty-four eligible patients were randomly selected from a prospectively maintained list of STCs performed at a university hospital between 2011 and 2021. They were invited to participate in interviews using a five-section, composite, semi-structured questionnaire, which included the Gastrointestinal Quality of Life Index-10 (GIQLI-10), a modified version of the Short-Form Survey 36, and a subjective health self-assessment. Results: Nineteen patients (response rate: 43.2%) participated in the survey. STC was performed laparoscopically in 14 patients (73.7%). One patient (5.3%) required readmission. At the time of the interview, the mean age was 66.2 years (standard deviation [SD]: 16.95). Sixteen patients (84.2%) reported other medical conditions. The most common long-term symptoms were fatigue (n = 12; 63.2%), bloating (n = 10; 52.6%), and excessive flatulence (n = 10; 52.6%). The mean GIQLI-10 score was 32.5 out of 40 (SD: 6.0; 95% confidence interval [CI]: 29.6-35.4), with a median score of 35 (interquartile range (IQR): 9; 95% CI: 28-37), accounting for 87.5% of the maximum score. Fifteen patients (78.9%) reported their general health as good or very good. In 13 patients (68.4%), health remained unchanged or improved compared to one year earlier. The mean self-assessed health score was 74.1 (SD: 13.7; 95% CI: 67.5-80.7), with a median of 75 (IQR: 15; 95% CI: 65-80). Conclusion: These findings align with existing literature, showing generally positive patient-reported outcomes following STC. However, this study provides new quantitative details with greater granularity on overall health-related QoL and individual postoperative symptoms. Relevance for patients: The Short-Form Health Survey indicates that 8 out of 10 patients who underwent subtotal cholecystectomy reported their overall health as good or very good, despite experiencing some gastrointestinal symptoms. The information provided in this study can aid preoperative discussions and shared decision-making before cholecystectomy.

  • research-article
    Seyedeh Zahra Mousavi, Nasrin Payab, Mohammad Sina, Elham Tootoonchi, Amirhossein Ghorbanpour, Morteza Dehghan, Razieh Pourahmad Jaktaji, Morteza Hadizadeh
    2026, 12(3): 025370062. https://doi.org/10.36922/JCTR025370062

    Background: The ubiquitin-proteasome system is vital for regulating protein stability and function, influencing numerous cellular processes, including bone homeostasis. Aim: This study aims to uncover the role of the ubiquitin-specific protease (USP) family in osteoporosis. Methods: The osteoporosis expression microarray profile was analyzed to identify differentially expressed genes (DEGs). DEGs related to ubiquitins were isolated, followed by the analysis of biological pathways and gene ontology for these genes. The interactions between differentially expressed ubiquitins (DE-Ubs) and their targets were examined using the UbiBrowser database. Ultimately, a network of interactions between DE-Ubs and their targets in the context of osteoporosis was constructed. The diagnostic potential of the DE-Ubs was evaluated using receiver operating characteristic (ROC) analysis. Additionally, antisense oligonucleotide design and validation were performed using various bioinformatics tools, including Sfold, IDT OligoAnalyzer, RNAfold, RNAhybrid, and HNADOCK. Results: Among the 1,082 DEGs, USP19 and USP17L2 were recognized as statistically significant due to their involvement in the mitogen-activated protein kinase and Ras signaling pathways. The diagnostic potential of USP19 as a biomarker was confirmed through ROC analysis, demonstrating its high predictive accuracy in osteoporosis. Among the designed antisense oligonucleotides for USP19, the sequence TGTCACGCCAGATAAAACTA showed the most favorable predicted properties according to the ΔG values and structural stability. Conclusion: This study provides insights into the USP family genes associated with osteoporosis and identifies potential therapeutic targets for further investigation. Relevance for patients: This study identifies USP19 as a promising biomarker for early osteoporosis detection.

  • research-article
    Mustapha Abdulsalam, Miracle Uwa Livinus, Musa Ojeba Innocent, Fatimoh Abdulsalam Danjuma, Imam Muzeenat Oyinkansola, Ishola Jonathan Adekunle, Salam Olaitan Lateefat
    2026, 12(3): 025420073. https://doi.org/10.36922/JCTR025420073

    Background: Autoimmune diseases are highly heterogeneous, with unpredictable treatment outcomes that often result in prolonged morbidity. Conventional bulk transcriptomic approaches obscure cellular diversity and fail to capture the spatial microenvironment that drives drug responses. Aim: To identify spatial transcriptomic biomarkers that predict patient-specific therapeutic responses in autoimmune diseases. Methods: We applied single-cell spatial transcriptomics (scST) to patient-derived synovial tissue from rheumatoid arthritis (n = 12) and systemic lupus erythematosus (n = 8) to construct a high-resolution atlas of immune and stromal interactions during therapy. Results: By integrating scST with machine learning-based predictive modeling, we identified cell-state signatures that stratify patients into responders and non-responders before treatment initiation. Spatial colocalization of interferon gamma-responsive macrophages and C-X-C motif chemokine ligand 13-positive T follicular helper cells predicted resistance to Janus kinase inhibitors (AUC = 0.89). In contrast, enrichment of programmed cell death protein-1 in highly exhausted T cells adjacent to fibroblastic reticular cells improved response to tumor necrosis factor-alpha blockade (AUC = 0.92). Notably, extracellular matrix (ECM)-associated remodeling genes, including COL6A3 and FN1, emerged as critical determinants of microenvironmental drug sensitivity, highlighting the ECM as a therapeutic co-driver in autoimmunity. Validation in an independent cohort (n = 20) confirmed the predictive robustness of these spatial biomarkers. Conclusion: Our findings demonstrate that scST can resolve patient-specific immune niches and provide actionable biomarkers for precision immunotherapy. Relevance for patients: Beyond its immediate implications for rheumatology, this framework establishes spatial single-cell mapping as a predictive diagnostic platform for diverse autoimmune diseases, transforming treatment from trial-and-error to individualized therapeutic guidance.

  • research-article
    Ahmed Nageeb Mahmoud, Yagiz Ozdag, Juan David Bernate, Mahmoud AH Mahmoud, William Mack Malarkey, Mostafa Aly Elabd, Louis Christopher Grandizio, Daniel S. Horwitz
    2026, 12(3): 025490091. https://doi.org/10.36922/JCTR025490091

    Background: Fracture displacement and bony contact in proximal humeral fractures can affect healing and patient outcomes. The eccentric head index, currently used to measure displacement, is relatively complex and not ideal for all fracture types. Aim: This study proposes and evaluates the reproducibility of an exploratory measurement, the humeral shaft coverage, to quantify the degree of bony contact between fracture ends in surgical neck humeral fractures. Methods: All patients with surgical neck humeral fractures who had undergone closed reduction in our electronic medical records were identified using the diagnostic terms, and their full series of follow-up radiographs were reviewed for measurement by two observers. The estimated total humeral shaft coverage (THSC) was calculated by multiplying the proportion of metaphyseal width covered by the humeral head on both anteroposterior (AP) and scapular Y views. Total uncoverage was determined using the formula: 1 - THSC. Results: Two observers evaluated 22 shoulder AP and Y radiographs, resulting in 44 measurements, and each repeated their measurements to assess intra-observer reliability. The mean HSC values for observers 1 and 2 were 0.36 ± 0.32 and 0.44 ± 0.31, with no significant difference (p = 0.098). Inter-observer reliability was good to excellent (intraclass correlation coefficient [ICC] = 0.88, 95% confidence interval: 0.67-0.97). Intra-observer reliability was excellent for both observers (ICC = 0.99). Conclusion:Humeral shaft coverage is a consistent measurement that may help quantify fracture displacement in surgical neck humeral fractures. Relevance for patients: A simple method for quantifying fracture displacement may help predict prognosis and guide management of proximal humeral fractures.

  • research-article
    Linya Lyu, Wei Fu, Fang Dai, Jinji Huang, Guobin Cheng
    2026, 12(3): 026050009. https://doi.org/10.36922/JCTR026050009

    Background: Stomach disease is highly prevalent among middle-aged and older adults and often coexists with other chronic conditions, yet its comorbidity patterns remain unclear. This cross-sectional study aimed to construct a comorbidity network for stomach disease and identify its key associated factors using data from the China Health and Retirement Longitudinal Study (CHARLS, 2008-2020). Methods: A total of 19,541 participants were included. Data on 18 demographic variables and 14 chronic diseases were collected. Disease network analysis, extended Bayesian information criterion graphical least absolute shrinkage and selection operator (LASSO), the LASSO regression, and logistic regression were employed to examine network topology and factors associated with stomach disease. Results: A total of 19,541 unique participants were included. Among them, 26.17% (5,114/19,541) had stomach disease. Disease network analysis and regression analysis revealed significant, stable relationships among the included diseases. Nine diseases, including arthritis, dyslipidemia, and heart disease, were identified as independent factors associated with stomach disease. Among demographic characteristics, nine indicators, such as age, male sex, and current alcohol consumption, were independently associated with stomach disease (p < 0.05). Conclusion: Our study reveals that stomach disease in middle-aged and older adults primarily functions as a “terminal” phenomenon. It is statistically associated with core diseases within the network. Stomach disease is independently associated with multiple chronic conditions, such as arthritis, heart disease, and liver diseases, as well as factors like rural residence. These associations should be interpreted as statistical correlations rather than causal relationships, given the cross-sectional design. Relevance for patients: Stomach disease in older adults often reflects broader chronic disease burdens, warranting holistic rather than symptom-only management.

  • research-article
    Huseyin Karakaya, Meral Ekim, Hasan Ekim, Gokhan Dogukan Akarsu
    2026, 12(3): 026090014. https://doi.org/10.36922/JCTR026090014

    Background: The coronavirus disease 2019 (COVID-19) pandemic has significantly worsened health outcomes in pregnant women, a population already vulnerable due to physiological immune suppression and increased insulin resistance. Gestational diabetes mellitus (GDM) and vitamin B12 deficiency further compound these risks, creating a complex and potentially dangerous clinical picture. Aim: This review examines the interrelationships between COVID-19, GDM, and vitamin B12 deficiency in pregnancy, and evaluates the clinical implications for maternal and fetal health. Methods: A narrative review of the current literature was conducted, focusing on the mechanisms linking severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection, GDM, vitamin B12 metabolism, metformin use, and nutritional status during pregnancy. Results: SARS-CoV-2 directly damages pancreatic beta cells and triggers hyperinflammation, disrupting glycemic control in pregnant women. Vitamin B12 deficiency elevates homocysteine levels, impairing insulin signaling and promoting thrombosis, thereby increasing risks of GDM, preeclampsia, and adverse fetal neurodevelopmental outcomes. Metformin, widely used in GDM and polycystic ovary syndrome (PCOS) management, further reduces B12 absorption. Pandemic-related disruptions to antenatal care, food access, and psychosocial stress accelerated B12 depletion in this population. The Mediterranean diet offers partial mitigation, though targeted supplementation remains necessary in high-risk individuals. Conclusion: Routine B12 screening should be integrated into standard antenatal care, particularly for women with GDM, PCOS, or long-term metformin use. Relevance for patients: Pregnant women with GDM or PCOS using metformin are at heightened risk of vitamin B12 deficiency, which can silently harm both mother and baby. Regular B12 monitoring and timely supplementation are simple, safe, and potentially life-changing interventions.

  • research-article
    Pedro Parra-Caballero, Ángela Sánchez-Juez, Fernando Ruiz-Berraco, Ana Salvador Rodríguez, Nuria Ruiz-Giménez Arrieta, Jaime Bustos Carpio, Ana Rodríguez Revillas, María Jesús Delgado Heredia
    2026, 12(3): 026130023. https://doi.org/10.36922/JCTR026130023

    Background: The use of complementary radiological studies for suspected pulmonary embolism (PE) during the same clinical episode is uncommon and is usually due to a suboptimal or indeterminate initial study. However, the prevalence and decision-making in this clinical scenario are uncertain. Aim: The objective of this study was to determine the appropriateness of complementary studies (computed tomography angiography [CTA] and perfusion single-photon emission computed tomography/low-dose computed tomography [SPECT/ldCT]) in patients with suspected acute PE in real-world clinical practice. Methods: We analyzed all patients who underwent both tests for suspected PE during the same clinical process over a 10-year period. Results: Pulmonary CTA and perfusion SPECT/ldCT were performed as complementary studies in 4.42% of patients with suspected PE. In 69.7% of these patients, CTA was the initial diagnostic test and was subsequently followed by perfusion SPECT/ldCT, of which 64.6% were considered to have been inappropriately indicated. In 30.3% of patients, an initial lung perfusion SPECT/ldCT was followed by CTA; of these, 26.4% of CTA and 33.9% of perfusion studies were considered inappropriate. The overall agreement between the results of both tests was 49.3%. Conclusion: At least one imaging test was considered inappropriately indicated in 67.6% of patients who underwent both tests. This may result in unjustified risk associated with these procedures, unnecessary increase in costs, and additional difficulty in interpreting the high proportion of studies with discrepant results. Diagnostic and treatment protocols should be implemented in patients with suspected PE to reduce differences in clinical outcomes and optimize resource use. Relevance for patients: Inappropriate indications for radiological studies may cause unnecessary harm to certain patients, especially with regard to contrast-induced nephropathy.

  • research-article
    Pier Paolo Piccaluga, Mohsen Navari, Chen Ming
    2026, 12(3): 026170032. https://doi.org/10.36922/JCTR026170032