Antimicrobial properties of endophytic actinomycetes isolated from Combretum latifolium Blume, a medicinal shrub from Western Ghats of India

H. C. Yashavantha Rao , Devaraju Rakshith , Sreedharamurthy Satish

Front. Biol. ›› 2015, Vol. 10 ›› Issue (6) : 528 -536.

PDF (570KB)
Front. Biol. ›› 2015, Vol. 10 ›› Issue (6) :528 -536. DOI: 10.1007/s11515-015-1377-8
RESEARCH ARTICLE
RESEARCH ARTICLE
Antimicrobial properties of endophytic actinomycetes isolated from Combretum latifolium Blume, a medicinal shrub from Western Ghats of India
Author information +
History +
PDF (570KB)

Abstract

Endophytic actinomycetes were isolated from Combretum latifolium Blume (Combretaceae), Western Ghats of Southern India and identified by its characteristic culture morphology and molecular analysis of 16S rRNA gene sequences. In this survey of endophytic actinomycetes, a total of 117 isolates representing 9 different genera of endophytic actinomycetes were obtained using four different isolation media and several of them seemed to be novel taxa. Streptomyces genera (35%) was the most frequently isolated strains, followed by Nocordiopsis (17%) and Micromonospora (13%). ISP-4 medium recovered more isolates (47%) when compared to rest of the media used. Preliminary antibacterial activity of the isolates was carried out by confrontation test. Ethyl acetate fraction of selected isolates in disc diffusion assay exhibited broad spectrum antimicrobial activity against test human pathogens. All Streptomyces spp. strains displayed significant antimicrobial activity against test pathogens. Strain CLA-66 and CLA-68 which are Nocordipsis spp. inhibited both bacterial and fungal pathogens where as other isolates inhibited atleast three test human pathogens in disc diffusion assay. Antimicrobial screening of endophytic actinomycetes from this host may represent a unique potential niche for antimicrobial compounds of industrial and pharmaceutical applications. This work is the first comprehensive report on incidence of potential endophytic actinomycetes inhabiting C. latifolium Blume.

Keywords

endophytic actinomycetes / Combretum latifolium Blume / Streptomyces / antimicrobial activity

Cite this article

Download citation ▾
H. C. Yashavantha Rao, Devaraju Rakshith, Sreedharamurthy Satish. Antimicrobial properties of endophytic actinomycetes isolated from Combretum latifolium Blume, a medicinal shrub from Western Ghats of India. Front. Biol., 2015, 10(6): 528-536 DOI:10.1007/s11515-015-1377-8

登录浏览全文

4963

注册一个新账户 忘记密码

Introduction

The hunt for new biologically active secondary metabolites synthesized by microorganisms continues to be an important area in order to cope with the increasing demand for the treatment of human diseases ( Liu et al., 2013). Over the last several decades, natural products have contributed a highly significant role in the area of drug discovery ( Ji et al., 2009; Rao and Satish, 2015). Secondary metabolites produced by actinomycetes are considered to be an excellent starting scaffold for the development of antibiotics, anticancer agents, enzymes, anti-infection agents, immunomodulators, anthelminthic agents, insect control agents and plant growth hormones ( Demain, 1995; Fiedler et al., 2008; Schulz et al., 2009; Strobel et al., 2004; Baltz, 2010; Qin et al., 2011). Interestingly, about 70%–80% of all isolated compounds are from actinomycetes ( El-Tarabily et al., 2000; Bérdy , 2005; Nagpure et al., 2014). Meantime, promising approaches of mining unexplored microbial ecological niches for use as antibiotics have also been emerging (Fischbach and Walsh, 2009). These microbial endophytes may represent an underexplored reservoir for novel species of potential interest in the discovery of novel lead compounds and for exploitation in pharmaceutical, agriculture and industry ( Qin et al., 2011; Rao et al., 2015).

Microbial endophytes of medicinal plants participate in the metabolic pathways of medicinal plants and produce analogous or novel bioactive secondary metabolites ( Yu et al., 2010). Endophytic actinomycetes as one of the substantial residents in plant tissues, which are rarely studied have attracted more attention in recent years since there is an ever increasing need for novel organisms and their bioactive products ( Li et al., 2012). Antimicrobial agents produced by endophytic actinomycetes may provide new alternatives to combat multidrug-resistant human pathogens, the prevalence of which is increasing in the recent days ( Verma et al., 2013). They are considered as a potential source towards the discovery of novel bioactive metabolites ( Lam, 2006).

Species distribution, species richness and biologic diversity are significantly influenced by ecological environs ( Sheil, 1999; Hou et al., 2009). The diversity and antimicrobial activity of endophytic actinomycetes isolated from medicinal plants of tropical regions have been reported in previous studies ( Li et al., 2008; Bascom-Slack et al., 2009; Qin et al., 2009), while the medicinal plants from Western Ghats of India have not gained much research attention. Therefore, screening for endophytic actinomycetes able to produce bioactive compounds, the exploration of new habitats has been recommended ( Nolan and Cross, 1988; Takahashi and Omura, 2003).

Combretum latifolium Blume (Combretaceae) is a large climbing shrub which has great ethnomedicinal values (Shrisha et al., 2011). Stem and bark of this shrub is used as insecticides ( Suthari et al., 2014), Leaves juice is used in the treatment for dysentery ( Debnath et al., 2014). No reports are available in search of endophytic actinomycetes in C. latifolium Blume, in spite of the fact that it has great medicinal value and has huge importance to the mankind. Thus, the present study was designed to explore the hidden endophytic actinomycetes of C. latifolium Blume using different isolation media for greater diversity.

Materials and methods

Study site characteristics and selection of plant

Western Ghats are a mountain range that runs almost parallel to the Western coast of the Indian peninsula, located entirely in India. It is one of the eight ‘hottest hotspots’ of biological diversity in the world (Myres et al., 2000). Pushpagiri Sanctuary (12°35′N 75°40′E, elevation 1748 m) is located in the Western Ghats of Kodagu (Coorg), Karnataka which is the part of Southern India covered with thick evergreen and semi-evergreen forests and shoal grassland habitat. The imposing Kumaraparvata Peak forms the core of the Sanctuary, with dense sholas on the upper reaches and evergreen forests lower down. C. latifolium Blume was selected for the study from this region. The selection of plant for the isolation endophytes was based on its local ethnobotanical properties, including its antibacterial, insecticidal, antitumor, and wound-healing properties ( Debnath et al., 2014; Suthari et al., 2014).

Collection of samples

Healthy and asymptomatic bark, root and leaf samples of C. latifolium Blume were collected. To secure the endophytic nature of the isolates, the cut ends of root and bark were sealed with wax. All the samples were immediately brought to the laboratory in an icebox and stored at 4°C. Each sample tissues were used for the isolation of endophytic actinomycetes within 24 h from collection.

Isolation media

Four isolation media (HiMedia, Mumbai, India): Yeast extract-malt extract agar (ISP-2), Inorganic Salt Starch Agar (ISP-4), Chitin agar (CA) and Humic-vitamin agar (HV) which is supplemented with 1.8% agar were used in the study to isolate endophytic actinomycetes. To inhibit the growth of nonactinomycetes, the isolation media were supplemented with nalidixic acid and K2Cr2O7 ( You et al., 2005) both to a final concentration of 50 μg/ml and 75 μg/ml of filter-sterilized cycloheximide as an antifungal agent to reduce fungal contamination ( Jensen et al., 1991).

Isolation of endophytic actinomycetes

Isolation of endophytic actinomycetes was carried out according to method described by Johannes et al. (2006) with some modifications. Each sample tissues were washed under running water for 15 min and dried at room temperature prior to surface-sterilization. All the slight visibly damaged material was excluded. Samples were washed by sonification for 10 min at 150 w to dislodge soil and organic matter. Surface sterilization: the tissue segments were rinsed in 0.1% Tween 20 for 30 s, sequentially immersed in 75% ethanol for 5 min, 2% sodium hypochlorite for 5 min and rinsed with 10% NaHCO3 for 10 min to inhibit the growth of fungi. All samples were rinsed three times in sterile distilled water after each treatment. Finally, the tissue samples were dried thoroughly in the sterile conditions. To confirm the success of surface disinfection process, aliquots of the sterile distilled water from the final rinse were inoculated on the isolation media plates. The surface-sterilized tissue samples were aseptically cut into small pieces, placed on different isolation media (100 each from leaf, root and bark) and incubated at 28ºC for 1 month. The plates were regularly checked for the growth of endophytic actinomycetes isolates. Pure cultures were obtained by repeated streaking on ISP-4 agar medium cultivated at 28ºC.

Growth characteristics of endophytic actinomycetes

All the isolates were sub cultured on ISP-4 medium at 28±2ºC and the growth rate was monitored every two days up to 25 days. The isolates, which showed good growth in 4 days were considered as fast growers and those that showed good growth between 4 to 8 days were classified as moderate growers and the slow growers took more than 8 days for their growth. In addition to growth, color of mycelia was monitored in all the isolates of endophytic actinomycetes and documented.

Preliminary identification of endophytic actinomycetes

Actinomycetes were recognized on basis of morphological features following directions of International Streptomyces Project (ISP) ( Shirling and Gottlieb, 1966). The appearance and growth of endophytic actinomycetes were observed regularly. They were dereplicated by cultural and morphological characteristics, including chalky to leathery appearance and color of diffusible pigment and growth. Further, the isolates were observed using light microscope for their filamentous nature, spores, spiral sporospores, hyphe and Gram-straining were performed for further identification ( Yan, 1992). Individual colonies were picked up, maintained on ISP-4 slope medium and stored at 4ºC after profuse growth of isolates.

Confrontation test

Diversity of active endophytic actinomycetes isolates was determined by the confrontation test. Isolates were suspended in sterile distilled water and inoculated on the surface of modified nutrient agar (50% NA+ 50% ISP-4). After 72 h of incubation at 28ºC, test human pathogens were inoculated in perpendicular directions of the endophytic isolates and incubated at 28ºC for 48 h ( Highley and Ricard, 1988; Bensultana et al., 2010). The diversity in producing antibiotics is expressed by the inhibition zones between the test isolates. The inhibition zone against human pathogens was measured after 48 h of incubation. Plates with the same medium without inoculation of endophytic actinomycetes but with simultaneous streaking of test human pathogens were maintained as control.

Fermentation and extraction

Selected active isolates were cultured in 1 L Erlenmeyer flask containing 300 mL of ISP-4 broth. The cultures were incubated for 30 days at 28ºC under static conditions. The culture broth was then filtered to separate the filtrate and mycelium. Filtrate was blended thoroughly and centrifuged at 4000 r/min for 10 min. Liquid supernatant was extracted with ethyl acetate (v/v) thrice separately and this was evaporated to dryness under reduced pressure at 45ºC using rotary flash evaporator ( Anibou et al., 2008).

Antimicrobial susceptibility testing

Antimicrobial susceptibility test was carried out by disc diffusion assay. The sterile discs (6 mm) were impregnated with 20 mL (100 mg/disc) of ethyl acetate extract. Discs impregnated with ethyl acetate extract were dried in laminar air flow and placed on the surface of the media seeded with test human pathogen in Petri plates. A disc impregnated with only 20 mL of ethyl acetate was also placed for each test human pathogen with a positive control. The plates were incubated at 37±2°C and room temperature (for test bacteria and fungi respectively) and the diameter of the zone of inhibition was recorded (Ramesh and Mathivanan, 2009).

Genomic DNA extraction and 16S rRNA gene sequence analysis

The selected potential endophytic actinomycetes isolates were grown for 7 days at 28ºC with agitation in 250 mL flasks containing 100 mL of ISP-4 broth medium. Biomass was harvested by centrifugation (8000 r/min for 5 min). 200 mg of mycelium was used for genomic DNA extraction as described by Kieser et al. (2000). The PCR amplification of 16S rDNA was carried out with universal primers: PA 5′ AGAGTTTGATCCTGGCTCAG 3′ and PH 5′ AAGGAGGTGATCCAGCCGCA 3′ (Loqman et al., 2009) in a thermal cycler (Bio-Rad, USA). PCR reaction was performed using the extracted genomic DNA as template under following conditions: DNA was denatured at 94ºC for 5 min, followed by 30 cycles of 94ºC for 1 min, 55ºC for 30 s, and 72ºC for 1 min 30 s, with a final 10 min extension at 72ºC. The sequence was compared with similar 16S rDNA gene sequences retrieved from the DNA databases using the BLAST search program in the National Center for Biotechnology Information (NCBI).

Results and discussion

Taxonomic diversity of endophytic actinomycetes

Actinomycetes constantly hold a special significance in the research arena for the past few decades as the members of this group, especially Streptomyces spp. are known to produce a vast array of biological compounds. The searching of new natural products derived from microorganisms, especially from actinomycetes, has been focused on the isolation of species from unexplored niches. In this backdrop, the present work has been initiated to exploit hidden endophytic actinomycetes from Western Ghats of India because of its rich microbial diversity which has been studied only to a limited extent. Endophytic actinomycetes were isolated from internal part leaf, bark and root tissues of C. latifolium Blume. Cultures that exhibited growth morphology indicative of actinomycetes were selected for further study. A total of 117 isolates belonging to nine well identified distinct taxa (Fig. 3) were recovered from 200 segments of three different tissue samples of Combretum latifolium Blume after 1–1.5-month incubation using four different isolation media. No colonies emerged from the final rinses of the sterilization procedure showing that the surface sterilization was effective and the subsequent isolates were endophytes.

All three tissues showed variation in the recovery of endophytic actinomycetes (Fig. 1). Maximum recovery of isolates was found in root (54.7%), secondly from stem (26.5%) and least in leaf (18.8%). The higher recovery of endophytic actinomycetes from root samples compared to stem and leaf is supported by previous literature of endophytes diversity in leaves, stem and roots of Citrus reticulate L. ( Shutsrirung et al., 2013), Azadirachta indica A. Juss. ( Verma et al., 2009) and three other medicinal plants ( Gangwar et al., 2014). The prominent recovery of endophytic actinomycetes from roots compared to stem and leaf suggests that, property of root tissue which has soil adhesion around its surface enriches nutrient supplements for the growth of endophytes. Interestingly, among 117 isolates, 68 isolates (72.59%) exhibited fast growth, 29 isolates (4.8%) showed moderate growth and the remaining of 10 isolates (4.8%) showed slow growth (Fig. 2). The result clearly implies that the endophytic actinomycetes are not slow growing microorganisms and most of their growth is comparable with filamentous fungi (Ramesh and Mathivanan, 2009).

Effect of isolation media on recovery of endophytic bioactive isolates

Four media were utilized to retrieve the isolates from the host plant. These isolation media were helpful in acquiring to the diverse isolates obtained in this study. These isolation media seem to be specific and sensitive for endophytic actinomycetes ( Barakate et al., 2002). According to the results (Table 1), ISP-4 medium retrieved more isolates followed by ISP-2 medium, whereas least recovery of isolates was observed in CA medium. This suggests that, ISP-4 medium seems to be the most favorable medium for the recovery of endophytic actinomycetes from the host and best suitable for the isolation of antibiotic producing strains. It can be considered that, different isolation media employed in this study were productive and resulted in the successful isolation of numerous endophytic actinomycetes.

Preliminary antibacterial activity: Confrontation test

The antimicrobial activities of endophytic strains could involve in the protection of host plant against invading pathogens which are a combination of physical, chemical and biological factors. In this study, a total of 117 isolates were subjected to primary screening (Fig. 4) and the distribution of active isolates is shown in Table 2. Despite the observed abundance of other strains, the highest percentage of bioactive strains found was genus Streptomyces (Fig. 5) which is consistent with other reports ( Qin et al., 2009; Li et al., 2012). Some strains of Streptomyces spp. and Nocordiopsis spp. were active against all the tested Gram positive and Gram negative bacteria which confirm their broad spectrum of activity. Micromonaspora isolates effectively inhibited S. aureus and B. subtilis. It is especially interesting that isolates belonging to genera not often or not all reported to exhibit antimicrobial activity were found to inhibit the growth of at least one test pathogen. Even though our isolation media were not designed to focus on the rare actinomycetes, we recovered few unique sporing structure isolates. Since similar isolation media have been used in the isolation of endophytic actinomycetes from Ocimum sanctum ( Singh and Padmavathy, 2015), findings of Li et al., (2012) and the results of our study indicates that medicinal plants in general and the medicinal plants of Western Ghats in particular host has a great diversity of endophytic actinomycetes resources. However, to catch more rare endophytic actinomycetes in Western Ghats habitat, a wider range of isolation media should be employed in further studies.

Morphological and 16S rRNA gene sequence analysis for identification

Several rare genera were obtained by using different isolation media (Table 2). The colonies of the endophytic actinomycetes were elevated, convex and powdery in nature. Many of such morphological characteristics are common in most of the Streptomycetes spp. ( Miyadoh et al., 1997; Sujatha et al., 2005; Fguira et al., 2005). Analysis of the actinomycete isolates using their colony appearance, spore chain morphology helped for the preliminary identification. To confirm the reliability of morphological identification, selected bioactive endophytic actinomycetes strains were subjected to 16S rRNA gene sequence analysis. The consensus DNA sequences in BLASTN search suggested that the isolates belonged to nine genera: Kocuria, Glycomyces, Nocordiopsis, Streptomyces, Microbispora, Micromonospora, Pseudonocardia, Spirillospora, Actinomadura. The results showed that the endophytic community is diverse and that the most abundant isolates recovered were Streptomyces genus (35%) which was consistent with various reports about other hosts ( Miyadoh et al., 1997; Qin et al., 2009; Li et al., 2012; Shutsrirung et al., 2013). This finding implies that Streptomyces spp. can dominate over the rest of the taxa in endophytic colonization. However, Kocuria, Glycomyces and Microbispora were the least frequent in the host. Notably, some uncommon genera from the endophytic environment, such as Glycomyces, Micromonospora, Pseudonocardia and Spirillospora were recovered. It is worth mentioning that such a large number of rare actinomycetes genera isolated from a single type of host. Many of them could be considered unique species or novel strains with potential to produce new secondary metabolites. This work is the first comprehensive report concerning the endophytic actinomycetes of C. latifolium Blume.

Antimicrobial susceptibility test: Disc diffusion assay

Based on primary screening for antibacterial activity by confrontation test, genus specificity and sporing structure we selected 12 isolates for antimicrobial susceptibility testing of their ethyl acetate extract cultured in ISP-4 broth. All strains demonstrated robust antimicrobial activity against the test pathogens tested human pathogens (Table 3). A prominent difference in inhibitory activities and target test organism specificity was associated with each endophytic actinomycete. Streptomyces spp. harbored a significant higher proportion of isolates with antimicrobial activities similar to that of rare actinomycetes. Strains CLA-1, CLA-12 and CLA-72 which are Streptomyces spp. exhibited strong broad spectrum antimicrobial activity compared to rest of the isolates. However, Nocordiopsis sp. (strain CLA-68), Micromonospora (strain CLA-56), strain CLA-98 and CLA-104 also exhibited significant activity against all the test human pathogens. Moreover, our findings indicates that the bioactivity against test Gram negative bacteria was significantly higher than the Gram positive bacteria. In addition, the rare actinomycetes obtained from the host are metabolically active and produce interesting bioactive molecules. Endophytic Streptomyces longisporoflavus was isolated from L. ciliata Benth. (Lamiaceae) of Western Ghats, India which exhibited anti-diabetic activity ( Akshatha et al., 2014). Search for novel secondary metabolites with diverse biological activity in assorted environment has gained greater attention in recent years due to the increased incidence of multiple resistances to the available drugs (Dharmaraj, 2011). In view of this, these potential endophytic strains were promising source of producing new antibiotics.

Conclusion

C. latifolium Blume provides a beneficial source for potential endophytic actinomycetes and these strains might represent a promising source of new biologically active compounds. ISP-4 medium serves as the most favorable medium for the recovery of endophytic actinomycetes from the host. The study implies that targeting medicinal plants from unique niche to explore endophytic actinomycetes will facilitates for the discovery of new antimicrobial agents with substantial biologic activity. This work is the first comprehensive report concerning the endophytic actinomycetes of C. latifolium Blume. from Western Ghats of Southern India.

Compliance with ethics guidelines

H. C. Yashavantha Rao, Devarju Rakshith and Sreedharamurthy Satish declare that they have no conflict of interest

References

[1]

Akshatha V JNalini M SD’Souza CPrakash H S (2014). Streptomycete endophytes from anti-diabetic medicinal plants of the Western Ghats inhibit alpha-amylase and promote glucose uptake. Lett Appl Microbiol58(5): 433–439

[2]

Anibou MZyadi AChait ABenharref AOuhdouch Y (2008). Actinomycetes from Moroccan habitats: isolation and screening for cytotoxic activities. World J Microbiol Biotechnol24(10): 2019–2025

[3]

Baltz R H (2010). Streptomyces and Saccharopolyspora hosts for heterologous expression of secondary metabolite gene clusters. J Ind Microbiol Biotechnol37(8): 759–772

[4]

Barakate MOuhdouch YOufdou KBeaulieu C (2002). Characterization of rhizospheric soil Streptomycetes from Moroccan habitats and their antimicrobial activities. World J Microbiol Biotechnol18(1): 49–54

[5]

Bascom-Slack C AMa CMoore EBabbs BFenn KGreene J SHann B DKeehner JKelley-Swift E GKembaiyan VLee S JLi PLight D YLin E HSchorn M AVekhter DBoulanger L AHess W MVargas P NStrobel G AStrobel S A (2009). Multiple, novel biologically active endophytic actinomycetes isolated from upper Amazonian rainforests. Microb Ecol58(2): 374–383

[6]

Bensultana AOuhdouch YHassani LMezrioui NRafouk L (2010). Isolation and characterization of wastewater sand filter actinomycetes. World J Microbiol Biotechnol26(3): 481–487

[7]

Bérdy J (2005). Bioactive microbial metabolites. J Antibiot (Tokyo)58(1): 1–26

[8]

Debnath BDebnath AShilsharma APaul C (2014). Ethnomedicinal knowledge of Mog and Reang communities of south district of Tripura, India. Indian J Adv Plant Res1(5): 49–54

[9]

Demain A L (1995). Why do microorganisms produce antimicrobials? In: Hunter PA, Darby GK, Russell NJ (ed.): Fifty years of antimicrobials: past, prospective and future trends- Symposium 53. Society of General Microbiology, Cambridge University Press: 205–228.

[10]

Dharmaraj S (2011). Antagonistic potential of marine actinobacteria against fish and shellfish pathogens. Turk J Biol35: 303–311

[11]

El-Tarabily K ASoliman M HNassar A HAl-Hassani H ASivasithamparam KMcKenna FHardy G E (2000). Biological control of Sclerotinia minorusing a chitinolytic bacterium and actinomycetes. Plant Pathol49(5): 573–583

[12]

Fiedler H PBruntner CRiedlinger JBull A TKnutsen GGoodfellow MJones AMaldonado LPathom-aree WBeil WSchneider KKeller SSussmuth R D (2008). Proximicin A, B and C, novel aminofuran antibiotic and anticancer compounds isolated from marine strains of the actinomycete Verrucosispora. J Antibiot (Tokyo)61(3): 158–163

[13]

Fischbach M AWalsh C T (2009). Antibiotics for emerging pathogens. Science325(5944): 1089–1093

[14]

Fourati-Ben Fguira LFotso SBen Ameur-Mehdi RMellouli LLaatsch H (2005). Purification and structure elucidation of antifungal and antibacterial activities of newly isolated Streptomyces sp. strain US80. Res Microbiol156(3): 341–347

[15]

Gangwar MDogra SGupta U PKharwar R N (2014). Diversity and biopotential of endophytic actinomycetes from three medicinal plants in India. Afr J Microbiol Res8(2): 184–191

[16]

Highley T LRicard J (1988). Antagonism of Trichoderma spp. and Gliocladium virens against wood decay fungi. Mater Organismen23: 157–169

[17]

Hou B CWang E TLi YJia R ZChen W FMan C XSui X HChen W X (2009). Rhizobial resource associated with epidemic legumes in Tibet. Microb Ecol57(1): 69–81

[18]

Jensen P RDwight RFenical W (1991). Distribution of actinomycetes in near-shore tropical marine sediments. Appl Environ Microbiol57(4): 1102–1108

[19]

Ji H FLi X JZhang H Y (2009). Natural products and drug discovery. Can thousands of years of ancient medical knowledge lead us to new and powerful drug combinations in the fight against cancer and dementia? EMBO Rep10(3): 194–200

[20]

Johannes HGabriele BBarbara S (2006). Isolation procedures for endophytic microorganisms. Berlin, Springer. 299–305

[21]

Kieser T, Bibb M J, Buttner M J, Chater K F, Hopwood D A (2000). Practical Streptomyces Genetics. Norwich, UK: The John Innes Foundation

[22]

Lam K S (2006). Discovery of novel metabolites from marine actinomycetes. Curr Opin Microbiol9(3): 245–251

[23]

Li JZhao G ZChen H HWang H BQin SZhu W YXu L HJiang C LLi W J (2008). Antitumour and antimicrobial activities of endophytic streptomycetes from pharmaceutical plants in rainforest. Lett Appl Microbiol47(6): 574–580

[24]

Li JZhao G ZHuang H YQin SZhu W YZhao L XXu L HZhang SLi W JStrobel GStrobel G (2012). Isolation and characterization of culturable endophytic actinobacteria associated with Artemisia annua L. Antonie van Leeuwenhoek101(3): 515–527

[25]

Liu HXiao LWei JSchmitz J CLiu MWang CCheng LWu NChen LZhang YLin X (2013). Identification of Streptomyces sp. nov. WH26 producing cytotoxic compounds isolated from marine solar saltern in China. World J Microbiol Biotechnol29(7): 1271–1278

[26]

Loqman SBarka E AClement COuhdouch Y (2009). Antagonistic actinomycetes from Moroccan soil to control the grapevine gray mold. World J Microbiol Biotechnol25(1): 81–91

[27]

Miyadoh SHamada MHotta KKudo TSeino AVobis G (1997). Atlas of Actinomycetes, The Society for Actinomycetes, Japan. Asakura Publishing Co. Ltd. Tokyo, Japan

[28]

Nagpure AChoudhary BKumar SGupta R K (2014). Isolation and characterization of chitinolytic Streptomyces sp. MT7 and its antagonism towards wood-rotting fungi. Ann Microbiol64(2): 531–541

[29]

Nolan R DCross T (1988). Isolation and screening of actinomycetes. In: Goodfellow M, Williams ST, Mordarski MM (ed): Actinomycetes in biotechnology. Academic Press, ISBN 0–12–289673–4, London.

[30]

Qin SLi JChen H HZhao G ZZhu W YJiang C LXu L HLi W J (2009). Isolation, diversity, and antimicrobial activity of rare actinobacteria from medicinal plants of tropical rain forests in Xishuangbanna, China. Appl Environ Microbiol75(19): 6176–6186

[31]

Qin SXing KJiang J HXu L HLi W J (2011). Biodiversity, bioactive natural products and biotechnological potential of plant-associated endophytic actinobacteria. Appl Microbiol Biotechnol89(3): 457–473

[32]

Ramesh SMathivanan N (2009). Screening of marine actinomycetes isolated from the Bay of Bengal, India for antimicrobial activity and industrial enzymes. World J Microbiol Biotechnol25(12): 2103–2111

[33]

Rao H C YSatish S (2015). Genomic and chromatographic approach for the discovery of polyketide antimicrobial metabolites from an endophytic Phomopsis liquidambaris CBR-18. Front Life Sci8: 200–207

[34]

Rao H C YSantosh PRakshith DSatish S (2015). Molecular characterization of an endophytic Phomopsis liquidambaris CBR-15 from Cryptolepis buchanani Roem. and impact of culture media on biosynthesis of antimicrobial metabolites. 3Biotech5: 165–173

[35]

Schulz DNachtigall JRiedlinger JSchneider KPoralla KImhoff J FBeil WNicholson GFiedler H PSüssmuth R D (2009). Piceamycin and its N-acetylcysteine adduct is produced by Streptomyces sp. GB 4-2. J Antibiot (Tokyo)62(9): 513–518

[36]

Sheil D (1999). Tropical forest diversity, environmental change and species augmentation: after the intermediate disturbance hypothesis. J Veg Sci10(6): 851–860

[37]

Shirling E BGottlieb D (1966). Methods for characterization of Streptomyces species. Int J Syst Bacteriol16(3): 313–340

[38]

Shrisha D LRaveesha K A, Nagabhushan (2011). Bioprospecting of selected medicinal plants for antibacterial activity against some pathogenic bacteria. J Medicinal Plants Res5(17): 4087–4093

[39]

Shutsrirung AChromkaew YAree W PChoonluchanon S (2013). Diversity of endophytic actinomycetes in mandarin grown in northern Thailand, their phytohormone production potential and plant growth promoting activity. Soil Sci Plant Nutr59(3): 322–330

[40]

Singh J MPadmavathy S (2015). Nocardiopsis sp. 5 Endophytic to Tulsi Leaves- Isolation and Antimicrobial Activity. Br Microbiol Res J5(3): 194–202

[41]

Strobel GDaisy BCastillo UHarper J (2004). Natural products from endophytic microorganisms. J Nat Prod67(2): 257–268

[42]

Sujatha PBapi Raju K V V S NRamana T (2005). Studies on a new marine streptomycete BT-408 producing polyketide antibiotic SBR-22 effective against methicillin resistant Staphylococcus aureus. Microbiol Res160(2): 119–126

[43]

Suthari SSreeramalu NOmkar KRaju V S (2014). The climbing plants of northern telangana in india and their ethnomedicinal and economic uses. Indian J Plant Sci, 2319–3824

[44]

Takahashi YOmura S (2003). Isolation of new actinomycete strains for the screening of new bioactive compounds. J Gen Appl Microbiol49(3): 141–154

[45]

Verma S KGond S KMishra ASharma V KKumar JSingh D KKumar AGoutam JKharwar R N (2013). Impact of environmental variables on the isolation, diversity and antibacterial activity of endophytic fungal communities from Madhuca indica Gmel. at different locations in India. Ann Microbiol

[46]

Verma V CGond S KKumar AMishra AKharwar R NGange A C (2009). Endophytic actinomycetes from Azadirachta indica A. Juss.: isolation, diversity, and anti-microbial activity. Microb Ecol57(4): 749–756

[47]

Yan X C (1992). Isolation and identification of actinomycete. Science Beijing, pp 45–68

[48]

You J LCao L XLiu G FZhou S NTan H MLin Y C (2005). Isolation and characterization of actinomycetes antagonistic to pathogenic Vibrio spp. from near shore marine sediments. World J Microbiol Biotechnol21(5): 679–682

[49]

Yu HZhang LLi LZheng CGuo LLi WSun PQin L (2010). Recent developments and future prospects of antimicrobial metabolites produced by endophytes. Microbiol Res165(6): 437–449

RIGHTS & PERMISSIONS

Higher Education Press and Springer-Verlag Berlin Heidelberg

PDF (570KB)

Supplementary files

Supplementary Material

2166

Accesses

0

Citation

Detail

Sections
Recommended

/