Characteristics of microbial communities in water from CBM wells and biogas production potential in eastern Yunnan and western Guizhou, China

Wenguang TIAN , Zhaobiao YANG , Zonghao QIN , Yong QIN , Cunlei LI , Benju LU , Yongchen LI

Front. Earth Sci. ›› 2023, Vol. 17 ›› Issue (1) : 180 -196.

PDF (5941KB)
Front. Earth Sci. ›› 2023, Vol. 17 ›› Issue (1) :180 -196. DOI: 10.1007/s11707-022-1004-3
RESEARCH ARTICLE
RESEARCH ARTICLE
Characteristics of microbial communities in water from CBM wells and biogas production potential in eastern Yunnan and western Guizhou, China
Author information +
History +
PDF (5941KB)

Abstract

The study of microbial communities in the produced water of coalbed methane (CBM) wells is an important aspect of microbial-enhanced methane production. Water produced from 15 CBM wells in four synclines in eastern Yunnan and western Guizhou was collected. Through the use of 16S ribosomal RNA (16S rRNA) amplicon sequencing and realtime fluorescence quantitative polymerase chain reaction (PCR), the characteristics of bacterial and archaeal communities before and after enrichment culture were studied. The methanogenic pathways of secondary biogas were discussed, and potential microbial-enhanced methane production was preliminarily evaluated. The results showed that the bacterial DNA content in uncultured produced water was low, so it is difficult to detect. After enrichment, the dominant bacteria phyla were Proteobacteria, Bacteroidetes, and Firmicutes. A total of seven phyla were detected in the uncultured produced water, and the dominant archaeal phylum was Euyarchaeota. Methanogens were the main component of archaea. The dominant archaeal genera were Methanobacterium, Methanoculleus and Methanobrevibacter. The community structure of the archaea changed noticeably after four days of enrichment culture. The relative abundance of Euryarchaeota increased to 99% in most samples after enrichment culture. It was found that there was a transition from Methanoregula to Methanobacterium within genera. The relative abundance of Methanobacterium increased, which can produce hydrogenotrophic methane. Combined with the isotopic composition of the produced water and gas, it is considered that the CBM in the Tucheng and Enhong synlines consists of a mixture of thermogenic gas and biogas. The proportion of secondary biogas in the Tucheng and Enhong synlines are estimated to range from 10.89% to 49.62%. There are mainly hydrogentrophic methanogens in the study area, and CO2 reduction is the main way of microbial gas production. After enrichment culture of produced water in the study area, the hydrogenotrophic methanogens were enriched. These two areas have strong potential for microbial-enhanced methane production.

Graphical abstract

Keywords

eastern Yunnan and western Guizhou / produced water form CBM wells / 16S amplicon sequencing / secondary biogas / microbial-enhanced methane production

Cite this article

Download citation ▾
Wenguang TIAN, Zhaobiao YANG, Zonghao QIN, Yong QIN, Cunlei LI, Benju LU, Yongchen LI. Characteristics of microbial communities in water from CBM wells and biogas production potential in eastern Yunnan and western Guizhou, China. Front. Earth Sci., 2023, 17(1): 180-196 DOI:10.1007/s11707-022-1004-3

登录浏览全文

4963

注册一个新账户 忘记密码

1 Introduction

Coalbed methane (CBM) is a kind of clean unconventional natural gas energy. Under the international background of “carbon neutral”, “stabilizing oil and increasing gas” is China’s long-term energy strategy, and vigorously developing shale gas and CBM is an urgent need to realize this strategy. However, the permeability of the CBM reservoir in China is low, so it is generally necessary to reconstruct the reservoir to obtain industrial gas flow. The development of reservoir reconstruction technology is the core demand for improving the production of CBM. In recent years, reservoir modification and engineering experiments of microbial-enhanced methane production have been widely carried out in China and abroad (Ritter et al., 2015; Sun et al., 2018). According to the mechanism of biogas generation, the methanogenic bacteria or the nutrient solution used to cultivate the methanogenic bacteria are artificially injected into the coal seam with suitable conditions, so that the coal seam can produce gas again. In this way, the production of CBM wells can be increased, so as to enhance the recovery factor (Su et al., 2020).

The basis of these studies is to understand the characteristics of microbial community in coal reservoirs. The previous research mainly used 16S rDNA sequencing technology to study the microbial community structure by collecting underground water or coal samples. Yubai (Shimizu et al., 2007) in Japan, Surat Basin, Sydney Basin and Port Phillip Basin (Li et al., 2008; Vick et al., 2018) in Australia, Illinois Basin (Strąpoć et al., 2008; Zhang et al., 2015) and Powder River Basin (Klein et al., 2008) in America, Waikato coalfields (Fry et al., 2009) in New Zealand, Alberta Basin (Penner et al., 2010) in Canada, Ordos Basin (Guo et al., 2012) and Huaibei Mine (Liu et al., 2019) in China have all done sequencing research, and different bacteria and archaea have been found. Methanobacterium, Methanolobus and Methanoculleus were the most common archaea. Firmicutes, Proteobacteria and Bacteroidetes were the most common bacteria. Generally speaking, the diversity of bacteria was higher than that of archaea (Parkes et al., 2000; Su et al., 2018). To reduce the reservoir pressure, it is necessary to discharge the water from the coal seam during the exploitation of CBM well. During the stable production period, the groundwater discharged is generally the water from the original coal seam. The produced water contains abundant microbial information, which can reflect the microbial community structure of the underground coal seam to a certain extent (Beckmann et al., 2019), which provides the possibility for more convenient and rapid study of microbial community structure in coal reservoirs.

At the same time, microbial enhanced methane production also needs to pay attention to the type of CBM in the original coal seam, which can be thermogenic gas, protobiogas, and secondary biogas or a mixture of the three (Glasby, 2006; Wang et al., 2018). The reservoir with secondary biogas is more suitable for microbial enhanced methane production.

Eastern Yunnan and western Guizhouis is an important coal and CBM resources area in southern China, with the CBM geological resources of the Upper Permian accounting for approximately 10% of China’s coal resources. This area has the geological characteristics of multiple and thin coal seams, a wide range of coal ranks, high in situ stress, low water saturation, and complex coal structure (Gao et al., 2009; Yang et al., 2019, 2020). In recent years, the exploration and development of CBM has made important breakthroughs, and the maximum daily production of some vertical wells has exceeded 6000 m3. However, due to the complex coal structure, the effect of coal reservoir transformation is limited to a certain extent, and the gas production effect of some wells is poor, so it is important to explore new reservoir reconstruction technology. Therefore, water samples from 15 CBM wells in four synclines in the study area were collected for anaerobic fermentation and cultivation in the laboratory. By using high-throughput sequencing technology and geochemical analysis methods combined with the environmental characteristics of the formation water in different synclines, the characteristics of bacterial and archaeal community changes, methanogenic pathways and gas production potential were studied and evaluated. This study provides a theoretical basis for microbial-enhanced methane production from the coal seams of the Longtan Formation in eastern Yunnan and western Guizhou.

2 Geological settings

The coal-bearing strata in eastern Yunnan and western Guizhou are the Late Permian Longtan Formation/Xuanwei Formation, with multiple coal seams and many synclines as the main coal-accumulating units. Long-flame coal, gas coal, fat coal, coking coal, thin coal, meager coal, and anthracite all occur. Development test wells in western Guizhou are mainly distributed in Songhe (SH), Zhijin (ZJ), Faer (FE) and northern Guizhou blocks (Fig.1). The Songhe and Faer CBM production wells were selected as the research objects, and the two regions are close. The Songhe block currently has eight CBM production wells, which are a clustered well group in the Tucheng (TC) syncline. Well GP1 and GP2 were put into production in January 2014, and wells GP3 to GP8 were put into production in January 2015. The commingled gas production is typically from 6 to 9 layers. The depth of the bottom coal seam is about 564.5–977.08 m (Tab.1). By October 2020, the maximum daily CBM production was approximately 3000 m3/d, and the stable production was approximately 300 m3/d. Each single well had a cumulative water production of approximately 1400–3300 m3. After January 2018, the GP1 well was subjected to secondary fracturing and was replaced by single-layer drainage of the 1 + 3 coal seam, which is one of the numbers of the main coal seams in Songhe block.

There are two CBM wells in the Faer (FE) syncline, wells YC1 and QC1. Both wells are multi-layer commingled production wells, and the combined production layer is 3 layers. The depth of the bottom coal seam is 659–739 m. Well YC1 was put into operation in January 2017, with a maximum gas production of 5400 m3/d. At present, the YC1 well has a stable production of 1400 m3/d and a cumulative water production of approximately 1100 m3. Well QC1 was put into operation in September 2017, with a maximum gas production of 1000 m3/d. At present, the QC1 well is stable at 420 m3/d, and the cumulative water production is approximately 800 m3 (Tab.1).

There are eight CBM wells in eastern Yunnan, mainly located in the Enhong (EH) and Laochang (LC) syncline (Fig.1). The EHC6 and EHC7 wells are located in the EH syncline and are multi-layer combined mining wells with 3 to 4 layers of production. The depth of the bottom coal seam is 1036–1182 m. The two wells were put into production in January 2018. By October 2020, the maximum gas production reached 300 m3/d, and the cumulative water production of each individual well ranged from 600 to 800 m3 (Tab.1).

LCC1, LCC2, LCC3, LCC4, LCS1, and LCS2 wells are located in the Laochang (LC) syncline, in which LCC4, LCS1, and LCS2 are a well group (Fig.1). All wells adopt multi-layer combined production, and the production layers are generally 3 to 4 layers. The depth of the bottom coal seam is 712.58–832 m. Most of them started drainage in April 2018. By October 2020, the maximum gas production reached 800 m3/d, and the cumulative water production of each individual well ranged from 450 to 5000 m3 (Tab.1).

Among the four synclines, the Enhong and Tucheng synclines mainly develop coking coal, the Faer syncline mainly develops lean coal, while the Laochang (LC) syncline mainly develops anthracite (Tab.1). The four synclines are adjacent to each other.

3 Experiment

3.1 Sample collection

Fifteen samples were collected from five wells in the GP well group of in the Tucheng (TC) syncline, two wells in the Faer (FE) syncline, six wells in the Laochang (LC) syncline in Yunnan and two wells in the Enhong (EH) syncline in late October 2019. Plastic bottles were used to collect 500 mL of produced water directly from the outfall of each of the CBM wells and were then sealed. Three water samples were collected from each well, and one sample was sent directly to the State Key Laboratory of Environmental Geochemistry, Guiyang Institute of Geochemistry, Chinese Academy of Sciences for geochemical testing. The other two samples were transported at low temperature, one of which was enriched in the laboratory. Samples before and after culture were sent to the Sangon (Shanghai) CO., Ltd for 16S rRNA amplicon sequencing. Gas samples were collected by the drainage and gas gathering method and were then sent to the Key Laboratory of Oil and Gas Resources Research, Chinese Academy of Sciences, for testing.

3.2 Geochemical test of produced gas and produced water

The test contents of water samples were hydrogen and oxygen isotopes, dissolved inorganic carbon isotopes and trace elements of water. Hydrogen and oxygen isotopes were measured by laser liquid isotope mass spectrometer (MAT253, USA) and dissolved inorganic carbon isotopes were measured by gas isotope mass spectrometer (MART252, USA). The trace element detection instrument was inductively coupled plasma mass spectrometer (NexION300X ICP-MS). Test procedures were strictly in accordance with national norms. Gas sample testing included carbon and hydrogen isotope tests of alkanes. The carbon and hydrogen isotopes of alkane gas were tested by a Delta V Advantage isotope mass spectrometer. The detection was based on the general rule of mass spectrometry analysis method GB/T 6041–2002. Test results wre shown in Tab.2.

3.3 Enrichment culturing of microorganisms and 16S rRNA amplicon sequencing

3.3.1 Enrichment culturing of microorganisms

One of the water samples collected from CBM wells was sealed and transported to the laboratory at low temperature. After sterilization, the added nutrients were weighed in a triangular flask, and the water samples were transferred to a triangular flask and placed in a constant temperature incubator at 35°C for 4 days. The specific components of nutrient solution are as follows: 1000 mL of distilled water was added to 1.5 g of triglycolamic acid, 0.5 g of MnSO4·2H2O, 3.0 g of MgSO4·7H2O, 0.1 g of FeSO4·7H2O, 1.0 g of NaCl, 0.1 g of CoCl2·6H2O, 0.1 g of CaCl2·2H2O, 0.01 g of CuSO4·5H2O, 0.1 g of ZnSO4·7H2O, 0.05 g of H3BO3, 0.01 g of AlK(SO4)2, 0.02 g of NiCl2·6H2O, and 0.05 g of Na2MoO4. Thirty milliliters of the cultured sample was poured into a centrifuge tube, subjected to deoxidation sealing treatment and then sent to be tested after culturing.

3.3.2 16S rRNA amplicon sequencing

16S amplicon sequencing analysis of the water samples from six CBM wells of the GP well group was carried out. The sequencing was completed at Sangon Biotech (Shanghai) Co., Ltd. DNA extraction was achieved using a kit (E.Z.N.ATM Mag-Bind Soil DNA Kit). Archaea and bacteria detection was conducted by polymerase chain reaction (PCR) with three rounds of amplification. In the first round, the M-340F and GU1ST-1000R primers were used for amplification, and in the second round, the first round PCR primers were used for amplification. The primers used were fused with the V3–V4 universal primers of the Miseq sequencing platform, including the primers 341F: CCCTACACGACGCTCTTCCGATCTG (barcode) CCTACGGGNGGCWGCAG and primers 805R: GACTGGAG TTCCTTGGC ACCCGAG AATTCCA GACTACHVGGGTATCTAATCC. A 30 μL of reaction mixture for PCR amplification contained 15 μL of Taq master Mix, 1 μL of Bar-PCR primers F (10 μMol/L), 1 μL of primers R (10 μMol/L), 10–20 ng of bulk DNA solution, and add water to 30 μL. The PCR conditions were initial denaturation at 94°C for 3 min, followed by denaturation at 94°C for 30 s, denaturation at 45°C for 20 s, denaturation at 65°C for 30 s and extension at 72°C for 5 min. The PCR conditions were initial denaturation at 94°C for 3 min, followed by denaturation at 94°C for 30 s, denaturation at 45°C for 20 s, denaturation at 65°C for 30 s and extension at 72°C for 5 min.

In the third round, Illumina bridge PCR-compatible primers were introduced. A 30 μL of reaction mixture for PCR amplification contained 15 μL of Taq master Mix, 1 μL of Bar-PCR primers F(10 μMol/L), 1 μL of primers R(10 μMol/L), the second round PCR primers, and add water to 30 μL. The PCR conditions were initial denaturation at 94°C for 3 min, denaturation at 94°C for 20 s, denaturation at 55°C for 20 s, denaturation at 72°C for 30 s, and extension at 72°C for 5 min.

3.3.3 Sequencing data analysis

The PCR products were checked using electrophoresis in 1% (w/v) agarose gels. Total DNA products recovery was performed using a magnetic bead nucleic acid purification kit. The concentration of DNA was measured using a Qubit 2.0 (life, USA). Sequencing was performed using the Illumia Miseq system (Illumia Miseq, USA).

After all samples were sequenced, effective sequences were obtained for subsequent analysis after quality control. The sequences were clustered into operational taxonomic units (OTUs). On the basis of OTU clustering results, the most abundant sequence was selected as the representative sequence of OTU, and various analyses were carried out. Chao index and ACE index were used to evaluate the richness of the microbial community. The larger values of Chao 1 index and ACE index represent more microbial biomass. Shannon index and Simpson index were used to evaluate the diversity of microbial community. The larger values of Shannon index represent richer community diversity, while Simoson index is the opposite. The test results are shown in Tab.3.

3.4 Realtime fluorescence quantification PCR

To detect the changes of biomass before and after culture, realtime fluorescence quantitative PCR was carried out. The primers of archaea used in this experiment are 340F: CCCTACGGGGYGCASCAG and 519R: TTACCGCGGCKGCTG. The primers were designed and synthesized by Sangon (Shanghai) CO., Ltd using primer premier 5.0 software. The quantitative PCR reagent used was 2xsg fast qPCR Master Mix (b639271, BBI, Roche Roche), and the quantitative PCR instrument was lightcycler480 II fluorescent quantitative PCR (Roche, rotkreuz, Switzerland). The DNA sample was diluted 10 times as a template for detection. PCR conditions consisted of an initial denaturation step of 95°C for 3 min, and followed by 95°C for 5 s, 60°C for 30 s. The final samples were detected by realtime fluorescence quantitative PCR.

The realtime fluorescence quantitative PCR test of archaea in the produced water of 15 CBM wells collected in October 2019 was carried out, including a total of 30 samples of before and after enrichment culture in the laboratory. The test results are shown in Tab.3.

4 Results

4.1 Community structure of archaea in uncultured water

In the water produced from the CBM wells, a total of seven archaeal phyla were detected, among which Euryarchaeota was the dominant archaeal phylum with an average relative abundance of 90.56%, and methanogens belong to Euryarchaeota. In addition, Thaumarchaeota, Crenarchaeota, and Woeserchaeota were detected in all samples, while Pacearchaeota, Nanohalorchaeota, and Dipherotrites were only detected in some samples. The relative abundances of Thaumarchaeota and Crenarchaeota in the water produced from well GP2 in western Guizhou Province were relatively high, and the relative abundances of Euryarchaeota in the water produced from the other wells were above 85% (Fig.2).

Methanogens can be divided into six orders, namely, Methanobacteriales (36.42%), Methanomicrobiales (29.99%), Methanosarcinales (13.885%), Methanomassiliicoccales (7.69%), Methanococcales (0.03%), and Methanocellales (0.03%). The average relative abundances of Methanobactales, Metonomicrobiales, Metonosarcinales, and Methanogasiliccacales were high, and they were detected in all samples (Fig.3). Methanococcales and Methanocellales were detected in some samples. Some archaea belonging to other phyla were also determined to have high relative abundances. For example, Nitrososphaerales, which belong to Thaumarchaeota, had a relative abundance of 34%–35% in the water samples from GP2 well (Fig.3). Nitrososphaerales are important ammonia oxidizing archaea and play an important role in nitrogen and carbon circulation (Zhang and He, 2012). Halobacteria, which belong to Euryarchaeota, had an average relative abundance of 1.72%, are extremely halophilic, and their optimum NaCl concentration is 3–4 mol/L. Halobacteria grow in salt lakes, salt fields, and salted fish. High concentrations of electrolytes are used to maintain the structural integrity of the plasma membrane and ribosomes of Halobacteria. The relative abundance of Halocharacteria in the GP well group is higher than that in other areas, which reflected the water from GP well group has higher total dissolved solids (TDS).

Various methanogens constituted the main archaea in each sample within genera. The dominant archaeal genera in the produced water from different wells in the study area were mainly Methanobacterium, Methanoculleus, Methanobrevibacter, Methanothrix, and Methanoregula. Methanobacterium has been detected as a dominant archaea in the produced water of many CBM wells and can utilize both H2 and methyl compounds for metabolism. Methanobacterium is a hydrogenotrophic and methyltrophic methanogen. Methanoculleus, Methanobrevibacter, and Methanoregula are hydrogenotrophic methanogens, while Methanothrix is an acetoclastic methanogen. These four dominant archaeal genera were detected to different degrees in all the produced water samples, which indicates that there are abundant methanogenic pathways in the coal seams of eastern Yunnan and western Guizhou. In addition, Methanosarcina was also detected in all the wells containing produced water and has three methane synthesis pathways and can utilize at least nine different substrates. And many types of methanogens were found in anthracite.

4.2 Community structure of archaea in cultured water

To verify the experimental anaerobic culture results, the changes in the microbial community structure before and after cultivation were compared. After four days of enrichment, the water samples were sequenced.

After enrichment culture, Euryarchaeota was enriched to a certain extent within phyla. Crenarchaeota and Thaumarchaeota were only found in the GP1, GP6, and GP7 well samples. Euryarchaeota accounted for the majority of in water samples from other wells, with relative abundances above 99% (Fig.4).

The average relative abundances of Methanomicrobiales and Methanobacteriales were the highest within orders, and the other methanogens were mainly distributed among Methanosarcinales, Methanogasilicccales, and Methanocellales. Other archaea detected in the produced water, including Thermoproteales, Nitrososphaerales, Halobacteria, Desulfurococcales, and Haloferacals, were also detected in the cultured water. The relative abundances of Methanobacteriales and Methanomicrobiales increased to some extent. The dominant archaeal genera were Methanobacterium, Methanoregula, Methanobrevibacter, and Methanospirillum. Among them, the dominant archaea in the YC1 well and six wells in the LC area were Methanobacterium, and their relative abundances were high (Fig.5).

4.3 Community structure of bacteria in cultured water

The 16S rRNA gene of bacteria in the water produced from CBM wells was not amplified, which indicated that the bacteria in the produced water were lower than the detection level. After completion of collection, the produced water samples were sent to the laboratory for enrichment culture without contacting other bacterial sources. Therefore, the bacteria in the water samples after enrichment culture can also reflect bacterial communities in the coal-seam water to a certain extent, even if the microbial community structures change during the enrichment and cultivation processes. Because of the complexity of the bacterial community structures in the cultured water, a heatmap was used to represent this complexity, which is shown in Fig.6. Most of the bacteria were distributed among Proteobacteria, Bacteroidetes, and Firmicutes, and other bacteria with low relative abundances were detected, such as Synergistetes, Spirochaetes, Fusobacteria, and Acinobacteria. These bacteria are commonly associated bacteria in coal seams or coalbed water, and their common characteristics are diverse metabolic activities and hydrocarbon degradation abilities.

Bacteroidetes are common in sediments and are chemoautotrophic microorganisms. Bacteroidetes found in coalbed water are mainly involved in the degradation of macromolecular substances, such as proteins, sugars and cellulose, which are fermented into formic acid, hydrogen, and carbon dioxide (Guo et al., 2012). Macellibacteroides, which belongs to Bacteroidetes, was the dominant genus in most samples. The relative abundance of Dysgonomonas was also high. Macellibacteroides are acetogenic bacteria and are the main bacteria in the hydrogen and acetic acid synthesis stages. The function of Macellibacteroides is to ferment macromolecular soluble organic matter, such as short chain cellulose to produce pyruvic acid and fumaric acid to produce small-molecule acetic acid, propionic acid, butyric acid and other fatty acids (Jabari et al., 2012).

Proteobacteria are closely associated with methanogens (Guo et al., 2012), which are abundant bacteria. The Proteobacteria detected in this study were mainly Epsiloproteobacteria, Deltaproteobacteria, and Gammaproteobacteria. Deltaproteobacteria contain a variety of sulfate reduction microorganisms that can also degrade naphthalene or other aromatic hydrocarbons. Desulfocibrio, which belong to Deltaproteobacteria, were detected in all samples. Desulfovibrio have the potential to metabolize heterotrophic energy under sulfate reduction conditions. Desulfovibrio cannot only metabolize complex carbohydrates but can also be cocultured with methanogenic archaea to metabolize simple compounds, such as lactic acid and ethanol, to produce methane (Green et al., 2008).

Firmicutes are important bacteria involved in biogenic methane. The bacterial genus in Synergistetes is mainly Dethiosulfovibrio, which is an important amino acid-degrading and acetogenic bacterium in anaerobic systems (Wang, 2009). Hydrogen-producing acetic acid-producing bacteria can further degrade propionic acid, butyric acid and other volatile organic acids (VFAs) as well as ethanol produced in the previous stage into acetic acid, carbon dioxide and hydrogen, which provide direct substrates for methanogens in the last stage (Strąpoć et al., 2011).

The main bacteria in Spirochaetes were Sphaerochaeta. It has been reported that Spirochaeta can degrade carbohydrates and produce ethanol, acetic acid, lactic acid, hydrogen and carbon dioxide (Li et al., 2019).

Compared with the bacterial communities detected by many other scholars in coal or coal seam water, the detection results lack many sulfate reducing and denitrifying bacteria. Only part of Desulfovibrio was detected in the sequencing results. The sulfate reducing bacteria detected in coal seam water mainly include Desulfaculales, Desulfobacteria, Desulfovibrionales, and Desulfurmonadales (Penner et al., 2010). Denitrifying bacteria detected in coal seam water mainly include Pseudomonas, Thauera, Janthinobacterium, and Mesorhizobium. The low abundance of these two kinds of bacteria reflects the low efficiency of sulfur and nitrogen cycle in the production horizon in the study area. It can also be seen from the geochemical test of produced water that the concentrations of SO42 and NO3 in almost all wells are low or even undetectable. It has been found that sulfate reduction and denitrification process can significantly inhibit the activity of methanogens (Vizza et al., 2017). However, they are also important microorganisms in the gas production stage, so the effect of these microorganisms on the methane production efficiency needs to be further studied.

In all the samples, the three bacteria with the highest relative abundances after anaerobic enrichment culture were Macrobacteria, Citrobacter, and Clostridium sense stricto, which belong to Bacteroidetes, Proteobacteris, Firmicutes. Due to the lack of genetic information on microbial communities in in situ coalbed water, it was impossible to compare the effects of enrichment culture on the bacterial community structure in the laboratory. Penner et al. (2010) compared microbial communities before and after enrichment culture of coal samples and found that after anaerobic enrichment culture in the laboratory, the bacterial microbial population changed from oligotrophic and chemotrophic Proteobacteria to heterotrophic fermentation Firmicutes and Bacteroidetes. Therefore, it can be inferred that Macellibacteroides, with higher abundances in the sequencing results, were strengthened by the nutrient solution.

5 Discussion

5.1 Changes in the archaeal community before and after culturing

Shannon index and Simpson index are two commonly used Alpha diversity assessment indices to estimate microbial diversity in samples. They generally do not focus on comparison, but only evaluate the degree of diversity in the environment. The Shannon index is used to describe the disorder and uncertainty of individual species. The higher the uncertainty, the higher the diversity, that is, the greater the Shannon index, indicating the higher the community diversity. The Simpson index describes the probability that the number of individuals obtained from two consecutive samplings of a community species belongs to the same type. The larger the Simpson index value is, the lower the community diversity is (Simpson, 1949; Chao and Shen, 2003).

Comparing the changes of the Shannon index and the Simpson index before and after enrichment culture, it was found that the diversity of archaea community in most samples decreased after anaerobic enrichment culture (Fig.7).

To characterize the abundance of Archaea before and after anaerobic culture more precisely, the biomass was measured by realtime fluorescence quantitative PCR. It is found that the biomass of Archaea community in the produced water of different CBM wells has little difference, and the distribution range is 424.50–675.70 copies/μg, and the average value is 25 copies/μg. The low value of biomass appeared in GP2 well and Laochang area. After 4 days of enrichment culture, the biomass increased significantly, which was between 1665.41–587858.80 copies/μg, and the average value is 11 copies/μg. The biomass of nine wells exceeded 10000 copies/μg (Fig.8).

The reason is that in the process of enrichment culture, a large number of ions or elements that were missing or less in the original coal seam water were added according to the best living conditions of methanogens. The sensitivity of archaea to different ions or elements and culture temperature in anaerobic incubator was different. The optimal enrichment culture conditions of different archaea are not consistent, which leads to the enhancement of some archaea and the disappearance or decrease of the relative abundance of other archaea, that is, the decline of Archaea community diversity. On the whole, nutrient solution and culture environment were suitable for the growth and reproduction of archaea, and the abundance of microbial community increased rapidly in a short time.

Lefse and Welch’s t-test analysis were used to evaluate the significance of laboratory anaerobic culture on the changes in archaeal community structures (Fig.9 and Fig.10). The results showed that the transformations were mainly from Methanoregula to Methanobacterium within genera and from Methanomicrobia to Methanobacteria within orders.

Four methanogens had high relative abundances: Methanobacterium, Methanoregula, Methanospirillum, and Methanobrevibater. Among them, only the relative abundance of Methanobacteria increased significantly, while the relative abundances of Methanobacteria, Methanopirillum, and Methanobrevibater decreased significantly. All of these results indicated that after anaerobic culture, archaeal diversity decreased, the relative abundances of many methanogens decreased, and the relative abundancs of Methanobacteria with two metabolic pathways, hydrogen and methyl, increased.

5.2 Evaluation of biogenic enhancement of methane production potential

5.2.1 Methanogenic pathway of secondary biogas

Methanogens can survive in most natural environments and even in some extreme environments. In recent years, there have been an increasing number of reports on the diversity of methanogens in coal seams or coalbed water, and high-abundance methanogens have been found in some high-rank bituminous coal and anthracite mining areas (McInerney et al., 1981; Xiao et al., 2013; Su et al., 2018; Nie et al., 2019). A large number of methanogens, such as LC syncline CBM development wells, were detected in the anthracite area of eastern Yunnan and western Guizhou for the first time. However, whether there is a large amount of secondary biogas produced by methanogens in the study area is the basic condition for microbial-enhanced methane production. Therefore, it is necessary to discuss the genetic types of CBM in the study area.

The carbon and hydrogen isotopic characteristics of methane in CBM can be used to identify the genetic types. According to the template of Whiticar et al. (1986), the gas produced in CBM wells of the Tucheng, Faer, Enhong, and Laochang areas was identified. It can be seen from Fig.11 that most of the gas in the study area is thermogenic gas, some wells in the Enhong area are located in the range of mixed gas, and wells in Tucheng area are close to the range of mixed gas. However, the use of methane carbon and hydrogen isotopes to directly distinguish thermogenic gas and biogenic gas has certain limitations. The secondary biogenic gas is that during the burial process of coal seam, due to the tectonic uplift, it receives surface water supply, so that microorganisms can enter the coal seam, and under specific reservoir conditions, methane is generated through carbon dioxide reduction or acetic acid fermentation. If the generated secondary biogenic gas is mixed with the previously formed thermogenic gas, the content of δ13C will be reduced, and then the gas genetic identification will be biased.

Some scholars have proposed a method to identify biogenic gas based on the content of δ13CDIC in produced water (Golding et al., 2013; Yang et al., 2019). In the process of microbial fermentation to produce biogenic gas, methanogens could preferentially use 12C, making 13C gradually enriched in water, resulting in a higher positive value of δ13CDIC. Studies have shown that the presence of biogenic gas can be indicated when the δ13CDIC value is higher than 10‰. (Yang et al., 2019, 2020). It can be seen from Fig.12 that the δ13CDIC in Enhong area is greater than 10‰, and the average value of δ13CDIC in Tucheng synclines is 7.29‰, with the maximum value of 14.99‰. Therefore, it can be considered that there is biogenic gas in Tucheng and Enhong synclines. The δ13CDIC values of Faer and Laochang areas are negative, indicating that they did not have a lot of biogenic gas formation or preservation in their geological history.

Based on the mixed model proposed by Tao et al. in 2007, the proportions of biogas and thermogenic gas in the coal seams in the TC and EH areas were quantitatively estimated. The mixing formula is as follows (Eq. (1))

Ax+B(1 x)=C,

δ 13C(CH4 )=22 .42lg R0 34.8 .

In Eq. (1), A is the end member of the δ13C-CH4 value of biogas, which is −70‰. B is the end member of the δ13C-CH4 value of thermogenic gas, which is calculated by the regression formula for coal rock thermal simulation of primary CBM, without an obvious secondary transformation effect, in Eq. (2) (Liu and Xu, 1999). The C value represents the δ13C-CH4 value of CBM that was obtained from experimental tests, and the calculated x value is the proportion of biogas in the CBM. The results show that the proportion of biogas in the TC area is 16.83%–30.52% and that in the EH area is 27.95%–48.46%. The proportion of secondary biogas in Enhong area is higher than that in Songhe area, which is related to the low rank of coal in Enhong area.

Further analysis of the secondary biogenic methane production pathway is the basis for evaluating the microbial-enhanced methane production. In the final stage of gas production, hydrogenotrophic methanogens can use H2 and formic acid as electron donors to reduce CO2 to produce methane; acetoclastic methanogens decompose acetic acid, oxidize hydroxyl groups in acetic acid to CO2, and reduce methyl groups to methane; and methylotrophic methanogens produce methane by H2 reduction of methyl compounds or by disproportionation of methyl compounds. In many basins around in the world, CO2 reduction is more extensive than the acetic acid/methyl fermentation pathway for forming biogas, such as the Bowen Basin (Kinnon et al., 2010; Golding et al., 2013), Sydney Basin (Faiz and Hendry, 2006), and Power River Basin (Flores et al., 2008; Rice et al., 2008; Bates et al., 2011 ).

Among the top five methanogens with high relative abundances in the produced water from the CBM wells in the Tucheng and Enhong areas, only Methanthrix is an acetoclastic methanogen. Most of the other methanogens are hydrogenotrophic and use CO2 to reduce H2 to produce methane. The hydrogen atoms in CH4 that are produced by hydrogenotrophic methanogens all come from a symbiotic water medium, and the relationship follows Eq. (3) (Whiticar, 1999; Golding et al., 2013):

δD( CH4)=δD( H2O)160±10 .

Combined the sampling results of the research group at other times in 2019 (Fig.13 and Fig.14), it was determined that these areas are located near the hydrogentrophic methane, which do not completely fall into this range. The reason is that gas produced by the CBM wells in these two areas is a mixed genetic gas, and the isotopic composition of different time periods is also affected by precipitation.

Based on the results of 16S rRNA amplicon sequencing and the geochemical characteristics of the produced gas and water, it is concluded that the two areas are dominated by hydrogenotrophic methanogens. CO2 reduction is the main method of biogas production, and there is also thermogenic gas, which is consistent with the conclusion that most biogas is produced by hydrogenotrophic methanogens (Kirk et al., 2012).

5.2.2 Feasibility of microbial-enhanced methane production

In thermokinetics, Gibbs free energy is used to determine whether a chemical reaction will occur spontaneously. At a constant temperature, when the Gibbs free energy of a reaction is negative, the reaction can proceed spontaneously. Methanogens act on the last stage of microbial degradation of organic matter in coal. Although there are large differences in the phylogeny of different methanogens, most of their final products are CH4 and CO2, and few substrates can be utilized. The Gibbs free energy levels are different in the processes of methanogens that use different substrates (Tab.4). Gibbs free energy can reflect the difficulty of a reaction. The lower the Gibbs energy is, the easier the reaction is. The gas production reaction of hydrogentrophic methanogens was the most likely to occur, followed by methyltrophic methanogens and acetoclastic methanogens.

In the study area, there were mainly hydrogenotrophic methanogens in the produced water from the CBM wells, and there were also methanogens with acetic acid and methyl nutrition. The metabolic pathways of methane production are diversified. After anaerobic culture, Methanobacterium was highly enriched, and the other methanogens exhibited higher relative abundances, such as Methanoregula, Methanobrevibacter and Methanospirillum, which are hydrogenotrophic methanogens. After anaerobic enrichment culture, although the diversity of the methanogenic pathways decreased, the number of hydrogentrophic methanogens increased. Compared with the methyltrophic and acetoclastic methanogens, these methanogens can produce higher energy in the methanogenesis process, and the reaction is easier, which indicates that adding nutrient solutions could improve the methane production potential of microorganisms.

Most methanogens are extremely anaerobic microorganisms that are sensitive to the environment and can survive only in specific reservoir environments. First, coal rank affects the methanogen community structure. Low-rank coal contains more hydrogen, oxygen and nitrogen. With increasing coal rank, the numbers of hydrogen and oxygen side chains in coal decrease, and the available nutrients of microorganisms are reduced. Scott et al. (1994) found that the Ro,max of coal rock generated by secondary biogas was 0.3%–1.5%. Compared with domestic data analysis, Li Guihong and Zhang Hong (2013) found that the coal rock Ro,max generated by secondary biogas was 0.29%–2.01%. The Ro,max distribution range of five wells in the Tucheng area was 1.4%–1.69% and that of two wells in the Enhong area was approximately 1.21%, which are suitable for secondary biogas generation.

The survival of methanogens also requires suitable temperatures, TDS, trace elements, and other environmental conditions. When the reservoir temperature is between 35°C and 42°C, methanogens are most likely to survive. Tang et al. (2012) selected 35°C as the optimal temperature for anaerobic fermentation of methanogens. A higher TDS can inhibit the growth of microorganisms. With increasing TDS, methane production gradually decreases. Some trace elements are indispensable elements in the process of microbial growth. Su et al. (2018) found that Fe and Ni are involved in the synthesis of several key enzymes in the metabolism of microorganisms. The producing layers of CBM wells in the study area are generally less than 1000 m deep. The average temperature range of the production layers that span the TC area is 30.87°C–35.9°C, and that in the EH area is 23.6°C–27.43°C. The TDS concentrations are generally 4500 mg/L in the Tucheng area and are lower in the Enhong area, with values of 1594 mg/L and 2237 mg/L in the two wells, respectively. High Fe and Ni contents were detected in the produced water. The geological conditions in the producing layers in TC and EH are suitable for survival of the methanogen community, so engineering tests of enhanced methane production by nutrient injection can be carried out.

6 Conclusions

In this study, produced water from 15 CBM wells of four synclines in eastern Yunnan and western Guizhou was taken as the research object. Through laboratory cultivation of the produced water, the bacterial and archaeal community structures in the water before and after cultivation were tested by 16S rRNA amplicon sequencing and realtime fluorescence quantitative PCR. Combined with the geochemical characteristics of the produced water and gas, the potential and feasibility of microbial-enhanced methane production were discussed. The following conclusions are drawn.

1) The bacterial DNA content in uncultured produced water was lower than the detection level, so it is difficult to detect. After enrichment, the dominant bacteria phyla were Proteobacteria, Bacteroidetes, Firmicutes, and other low abundance bacteria were also detected.

2) A total of seven phyla were detected in the uncultured produced water of CBM wells, and the dominant archaeal phylum was Euyarchaeota, with an average relative abundance of 90.56%. Methanogens were the main component of archaea in each sample. The dominant archaeal genera were Methanobacterium, Methanoculleus, and Methanobrevibacter. The community structure of the archaea changed noticeably after enrichment culture. The relative abundance of Euryarchaeota increased to 99% in most samples after enrichment culture. Meanwhile, archaea grew rapidly, but the species diversity decreased. Using LefSe and Welch’s t-test analysis, it was found that there was a transition from Methanoregula to Methanobacterium within genera. The relative abundances of many methanogens decreased, but the relative abundance of Methanobacterium increased, which can produce hydrogenotrophic methane.

3) Combined with the isotopic composition of the produced water and gas, it is considered that the CBM in the Tucheng and Enhong synlines consists of a mixture of thermogenic gas and biogas. The proportion of secondary biogas in the Tucheng area is estimated to range from 10.89% to 35.35%, and that in the Enhong area is estimated to range from 29.58% to 49.62%. There are mainly hydrogentrophic methanogens in the study area, and CO2 reduction is the main method of microbial gas production. This provides a basis for microbial-enhanced methane production.

4) The CBM wells in the Tucheng and Enhong areas are classified as coking coal, with suitable reservoir temperatures, low TDS and rich trace element contents, which can provide a suitable living environment for methanogen growth. After enrichment culture of produced water in the study area, the hydrogenotrophic methanogens were enriched. These two areas have strong potential for microbial-enhanced methane production.

References

[1]

Bates B, Mcintosh J C, Lohse K A, Brooks P B (2011). Influence of groundwater flowpaths, residence times and nutrients on the extent of microbial methanogenesis in coal beds: Powder River Basin, USA. Chem Geol, 284(1–2): 45–61

[2]

Beckmann S, Luk A W S, Gutierrez-Zamora M L, Chong N H H, Thomas T, Lee M, Manefield M (2019). Long-term succession in a coal seam microbiome during in situ biostimulation of coalbed-methane generation.ISME J, 13(3): 632–650

[3]

Chao A, Shen T J (2003). Nonparametric estimation of Shannon’s index of diversity when there are unseen species in sample.Environ Ecol Stat, 10(4): 429–443

[4]

Cheng L, Zheng Z Z, Wang C, Zhang H (2016). Recent advances in methanogens. Microbio China, 43: 262–283 (in Chinese)

[5]

Faiz M, Hendry P (2006). Significance of microbial activity in Australian coal bed methane reservoirs: a review.Bull Can Pet Geol, 54(3): 261–272

[6]

Flores R M, Rice C A, Stricker G D, Warden A, Ellis M S (2008). Methanogenic pathways of coal-bed gas in the Powder River Basin, United States: the geologic factor. Int J Coal Geol, 76(1–2): 52–75

[7]

Fry J C, Horsfield B, Sykes R, Cragg B A, Heywood C, Kim G T, Mangelsdorf K, Mildenhall D C, Rinna J, Vieth A, Zink K, Sass H, Weightman A J, Parkes R J (2009). Prokaryotic populations and activities in an interbedded coal deposit, including a previously deeply buried section (1.6–2.3 km) above-150 Ma basement rock.Geomicrobiol J, 26(3): 163–178

[8]

Gao D, Qin Y, Yi T S (2009). Geological condition, exploration and exploitation strategy of coal-bed methane resources in Guizhou, China. Coal Geol China, 21: 20–23+5 (in Chinese)

[9]

Glasby G P (2006). Abiogenic origin of hydrocarbons: an historical overview.Resour Geol, 56(1): 83–96

[10]

Golding S D, Boreham C J, Esterle J S (2013). Stable isotope geochemistry of coal bed and shale gas and related production waters: a review.Int J Coal Geol, 120: 24–40

[11]

Green M S, Flanegan K C, Gilcrease P C (2008). Characterization of a methanogenic consortium enriched from a CBM well in the Powder River Basin, USA.Int J Coal Geol, 76(1–2): 34–45

[12]

Guo H G, Liu R Y, Yu Z S, Zhang H X, Yun J L, Li Y M, Liu X, Pan J G (2012). Pyrosequencing reveals the dominance of methylotrophic methanogenesis in a coal bed methane reservoir associated with eastern Ordos Basin in China.Int J Coal Geol, 93: 56–61

[13]

Jabari L, Gannoun H, Cayol J L C, Hedi A, Sakamoto M, Falsen E, Ohkuma M, Hamdi M, Fauque G, Ollivier B, Fardeau M L (2012). Macellibacteroides fermentans gen. nov., sp. nov., a member of the family Porphyromonadaceae isolated from an upflow anaerobic filter treating abattoir wastewaters.Int J Syst Evol Microbiol, 62(Pt_10): 2522–2527

[14]

Kinnon E C P, Golding S D, Boreham C J, Baublys K A, Esterle J S (2010). Stable isotope and water quality analysis of coal bed methane production waters and gases from the Bowen Basin, Australia. Int J Coal Geol, 82(3–4): 219–231

[15]

Kirk M F, Martini A M, Breecker D O, Colman D R, Takacs-Vesbach C, Petsch S T (2012). Impact of commercial natural gas production on geochemistry and microbiology in a shale-gas reservoir. Chem Geol, 332–333: 15–25

[16]

Klein D A, Flores R M, Venot C, Gabbert K, Schmidt R, Stricker G D, Pruden A, Mandernack K W (2008). Molecular sequences derived from Paleocene Fort Union Formation coals vs associated produced waters: implications for CBM regeneration. Int J Coal Geol, 76(1–2): 3–13

[17]

Li D M, Hendry P, Faiz M (2008). A survey of the microbial populations in some Australian coalbed methane reservoirs. Int J Coal Geol, 76(1–2): 14-24

[18]

Li G H, Zhang H (2013). The origin mechanism of coalbed methane in the eastern edge of Ordos Basin.Sci China Earth Sci, 56(10): 1701–1706

[19]

Li Y, Shi W, Tang S (2019). Microbial geochemical characteristics of the CBM in the Shizhuangnan block of Qinshui Basin, north China and their geological implications.Acta Geol Sin (English Edition), 93(3): 660–674

[20]

Liu W H, Xu Y C (1999). A two stage model of carbon isotopic fractionation in coal gas. Geochimica, 4: 359–366 (in Chinese)

[21]

Liu Y F, Wang B B, Zhang H X, Yu Z S (2019). Study on the microbial community and the type of methanogenesis associated with biogenic gas in Luling Coalfield, China.Acta Microbiol Sin, 59: 1174–1187

[22]

McInerney M J, Bryant M P, Hespell R B, Costerton J W (1981). Syntrophomonas wolfei gen. nov. sp. nov., an anaerobic, syntrophic, fatty acid-oxidizing bacterium.Appl Environ Microbiol, 41(4): 1029–1039

[23]

Nie Z Q, Yang X Q, Han Z Y (2019). Function and diversity of microbial community in biogenic coal-bed methane with different coal ranks: a review. Microbio China 46: 160–168 (in Chinese)

[24]

Parkes R J, Cragg B A, Wellsbury P (2000). Recent studies on bacterial populations and processes in subseafloor sediments: a review.Hydrogeol J, 8(1): 11–28

[25]

Penner T J, Foght J M, Budwill K (2010). Microbial diversity of western Canadian subsurface coal beds methanogenic coal enrichment cultures. Int J Coal Geol, 82(1–2): 81–93

[26]

Rice C A, Flores R M, Stricker G D, Ellis M S (2008). Chemical and stable isotopic evidence for water/rock interaction and biogenic origin of coalbed methane, Fort Union Formation, Powder River Basin, Wyoming and Montana U.S.A.Int J Coal Geol, 76(1–2): 76–85

[27]

Ritter D, Vinson D, Barnhart E, Akob D M, Fields M W, Cunningham A B, Orem W, Mcintosh J C (2015). Enhanced microbial coalbed methane generation: a review of research, commercial activity, and remaining challenges.Int J Coal Geol, 146: 28–41

[28]

Scott A R, Kaiser W R, Ayers W (1994). Thermogenic and secondary biogases, San Juan Basin, Colorado and New Mexico-implica-tions for coalbed gas producibility.AAPG Bull, 78: 1186–1209

[29]

Shimizu S, Akiyama M, Naganuma T, Fujioka M, Nako M, Ishijima Y (2007). Molecular characterization of microbial communities in deep coal seam groundwater of northern Japan.Geobiology, 5(4): 423–433

[30]

Simpson E H (1949). Measure of diversity.Nature, 163(4148): 688

[31]

Strąpoć D, Mastalerz M, Dawson K, Macalady J L, Callaghan A V, Wawrik B, Turich C, Ashby M (2011). Biogeochemistry of microbial coal-bed methane.Annu Rev Earth Planet Sci, 39(1): 617–656

[32]

Strąpoć D, Picardal F W, Turich C, Schaperdoth I, Macalady J L, Lipp J S, Lin Y S, Ertefai T F, Schubotz F, Hinrichs K U, Mastalerz M, Schimmelmann A (2008). Methane-producing microbial community in a coal bed of the Illinois Basin.Appl Environ Microbiol, 74(8): 2424–2432

[33]

Su X B, Xia D P, Zhao W Z, Fu H J, Guo H G, He H, Bao Y, Li D, Wei G Q (2020). Research advances of coalbed gas bioengineering.Coal Sci Technol, 48: 1–30

[34]

Su X, Zhao W, Xia D (2018). The diversity of hydrogen-producing bacteria and methanogens within an in situ coal seam.Biotechnol Biofuels, 11(1): 245

[35]

Sun B, Li J S, Cheng L, Yang Q, Tian W G, Li X, Chen H, Qi L (2018). The feasibility of biological gas recovery in low-rank coal: a case study of Jiergalangtu depression in Erlian Basin.Acta Petrol Sin, 39: 1272–1278

[36]

Tang Y Q, Ji P, Lai G L, Chi C Q, Liu Z S, Wu X L (2012). Diverse microbial community from the coalbeds of the Ordos Basin, China. Int J Coal Geol, 90–91: 21–33

[37]

Tao M X, Shi B G, Li J Y, Wang W C, Li X B, Gao B (2007). Secondary biological coalbed gas in the Xinji area, Anhui Province, China: evidence from the geochemical features and secondary changes. Int J Coal Geol, 71(2–3): 358–370

[38]

Vick S H W, Greenfield P, Tran-Dinh N, Tetu S G, Midgley D J, Paulsen I T (2018). The coal seam microbiome (CSMB) reference set, a lingua franca for the microbial coal-to-methane community.Int J Coal Geol, 186: 41–50

[39]

Vizza C, West W E, Jones S E, Hart J A, Lamberti G A (2017). Regulators of coastal wetland methane production and responses to simulated global change.Biogeosciences, 14(2): 431–446

[40]

Wang A K, Shao P, Lan F J, Jin J (2018). Organic chemicals in coal available to microbes to produce biogenic coalbed methane: a review of current knowledge.J Nat Gas Sci Eng, 60: 40–48

[41]

Wang S (2009). Construction of Dominant Hydrogen-Producing Acetogens and the Bioaugmentation for Developing the Efficacy of Anaerobic Wastewater Treatment System. Dissertation for the Master’s Degree. Harbin: Harbin Institute of Technology (in Chinese)

[42]

Whiticar M J, Faber E, Schoell M (1986). Biogenic methane formation in marine and fresh watere environments: CO2 reduction vs. acetate fermentation-Isotopic evidence.Geochimica et Cosmochimica Acta, 50(5): 693–709

[43]

Whiticar M J (1999). Carbon and hydrogen isotope systematics of bacterial formation and oxidation of methane.Chem Geol, 161(1–3): 291–314

[44]

Xiao D, Peng S P, Wang B Y, Yan X X (2013). Anthracite bio-degradation by methanogenic consortia in Qinshui Basin.Int J Coal Geol, 116–117: 46–52

[45]

Yang Z B, Qin Y, Qin Z H, Yi T S, Li C L, Zhang Z G (2020). Characteristics of dissolved inorganic carbon in produced water from coalbed methane wells and its geological significance.Pet Explor Dev, 47(5): 1074–1083

[46]

Yang Z B, Qin Y, Wu C C, Qin Z H, Li G, Li C L (2019). Geochemical response of produced water in the CBM well group with multiple coal seams and its geological significance——a case study of the Songhe well group in westren Guizhou.Int J Coal Geol, 207: 39–51

[47]

Zhang J, Liang Y N, Pandey R, Harpalani S (2015). Characterizing microbial communities dedicated for conversion of coal to methane in situ and ex situ.Int J Coal Geol, 146: 145–154

[48]

Zhang L, He J (2012). A novel archaeal phylum: thaumarchaeota——a review.Acta Microbio Sin, 52(4): 411–421

RIGHTS & PERMISSIONS

Higher Education Press

PDF (5941KB)

1639

Accesses

0

Citation

Detail

Sections
Recommended

/