Cloning and functional analysis of the genes involved in signal transduction in tomato Cf-4-Avr4 pathosystem

Qing LIU , Dongxin FENG , Xiaowu WANG , Yongchen DU

Front. Agric. China ›› 2007, Vol. 1 ›› Issue (1) : 52 -57.

PDF (764KB)
Front. Agric. China ›› 2007, Vol. 1 ›› Issue (1) :52 -57. DOI: 10.1007/s11703-007-0009-8
Research article
Research article
Cloning and functional analysis of the genes involved in signal transduction in tomato Cf-4-Avr4 pathosystem
Author information +
History +
PDF (764KB)

Abstract

Hypersensitive response (HR) is one of the most efficient and common resistance mechanisms in plants. Cloning signaling genes are very important to elucidate the resistance mechanisms. A gene in tomato homologous to several resistance proteins in plant was involved in HR and named as RGL (Resistance Gene Like). RGL protein was used as a bait to screen interacting protein(s) from tomato cDNA library through the yeast two-hybrid system. Two interacting proteins were found, which were called as RGLIP-1 and RGLIP2 (RGL Interacting Protein), respectively. RGLIP-1 is a protein of 291 amino acids with significant homology with thylakoid lumen protein. RGLIP-2 is a protein of 248 amino acids with significant homology with transducin protein. Virus-Induced Gene Silencing (VIGS) of the two genes results in a partial and complete suppression of Avr4induced HR, which indicates that both genes are involved in hypersensitive response.

Keywords

tomato / Cladosporium fulvum / hypersensitive response / yeast two-hybrid system / virus-induced gene silencing

Cite this article

Download citation ▾
Qing LIU, Dongxin FENG, Xiaowu WANG, Yongchen DU. Cloning and functional analysis of the genes involved in signal transduction in tomato Cf-4-Avr4 pathosystem. Front. Agric. China, 2007, 1 (1) : 52-57 DOI:10.1007/s11703-007-0009-8

登录浏览全文

4963

注册一个新账户 忘记密码

1 Introduction

Leaf mold is one of the most important diseases in tomato production, and the Cladosporium fulvum-tomato interaction mechanism is a hypersensitive response (HR). As one of the most efficient and common resistance mechanisms in plants, the HR is an active defense response and is triggered upon recognition of a virulence factor (AVR) of C. fulvum and a matching resistance Cf gene in plant. The interaction between the pathogenic fungus Cladosporium fulvum and tomato has served as a model system for studying the mechanism of HR. Four avirulence genes (Avr2, Avr4, Avr4E, and Avr9) in the pathogen and the corresponding resistant genes (Cf-2, Cf-4, Cf-4E, and Cf-9) in plants have been cloned (Jones et al., 1994; Cai et al., 2001; Luderer et al., 2002; Westerink, 2003). As reported, the interaction of Cf and AVR can cause cell death in potato and tobacco and the signaling transduction pathway is conservative in Solanaceae plants (Piedras et al., 1998; De Jong et al., 2000). Therefore, cloning the genes involved in the HR pathway is significant to understand the HR mechanism and improve the resistance of the variety. Because the signal transduction of the HR is still obscure as to how this process is initiated and executed, it is necessary to study the unknown components.

The yeast two-hybrid system is a molecular genetic tool that facilitates the study of protein-protein, protein-nucleic acid, and protein-small molecule ligand interactions, especially in the field of signal transduction. Virus-Induced Gene Silencing (VIGS) has recently been developed as a powerful method for the identification of resistant gene functions in plants (Ratcliff et al., 2001; Holzberg et al., 2002; Jin et al., 2003).

Frank analyzed the functions of differentially expressed genes in the proceeding of HR by VIGS and identified 20 fragments suppressing HR. In this study, five full-length cDNAs of these fragments were isolated, from which one RGL (Resistance Gene Like) was screened, and the interaction proteins were analyzed by the yeast two-hybrid system and VIGS.

2 Materials and methods

2.1 Materials

Experimental materials used in this study were eukaryotic expressing vector pGBKT7, yeast strain PJ69-4a, full-length cDNAs tomato library inoculated by aphids, transgenic tobacco with Cf-4, Agrobacterium tumefaciens GV3101 containing binary vector pRH78:Avr4, Agrobacterium tumefaciens GV3101 containing different VIGS vector, empty virus vector containing TRV:00, virus vector containing RGL (TRV:RGL), which were all afforded by the Laboratory of Phytopathology, Wageningen University and Research Center. High fidelity Taq enzyme was bought from TaKaRa Co. and restriction endonucleases Nco I, Sma I, and Sal I were purchased from Promega Co..

2.2 Methods

2.2.1 Analysis of the gene sequence involved in the hypersensitive response

The five nucleotide sequences involved in the HR were translated into amino acid sequences and submitted to GenBank database, finally, the conservative function domains were found by analyzing the homology with BLASTp.

2.2.2 Construction of recombinant plasmid for yeast two-hybrid system

The primers were designed based on the RGL gene sequence, and Nco I restriction enzyme cutting site was added to the forward primer to make PCR amplification with RGL as a template, and the primer sequence was as follows:

F: 5’- GGGATCCATGGTTGATGTAGGGGTTGA -3’

R: 5’- GGGGCATGTTCAATATGTCT -3’

The PCR product retrieved from the gel was purified, and digested with Nco I, and retrieved after electrophoresis. At the same time, pGBKT7 (BD plasmid) was digested with Nco I and Sma I, respectively, and the product was retrieved after electrophoresis. The bait plasmid pGBKT7/RGL was constructed with these two products. The tomato cDNA phage library was transferred into the activation domain (AD) plasmid library.

2.2.3 Yeast two-hybrid analysis

The bait plasmid and AD plasmid were co-transformed into yeast PJ69-4a strain by lithium acetate method as described in the MATCHMAKER library protocol (Clontech). At first, the strains containing AD plasmid and bait plasmid were screened on the medium lacking L-tryptophan and L-leucine, then screened on the medium Try-/Leu-/Ade-/His-, cultivated for 2 days at 28°C. The colonies more than 2 mm in diameter were rescreened on the medium Try-/Leu-/Ade-/His- and cultivated for 2 days at 28°C, finally the AD plasmid was isolated from the positive colonies for sequence analysis.

2.2.4 Construction of VIGS vector

The primers were designed based on the gene sequence of the two interacting proteins, with BamH I and Asp718 cutting sites added to the forward and backward primers, respectively. The sequences of primers were as follows:

The interacting protein 1:

F: 5’- CTGGATCCGACTGTATACTCTCACTGGA -3’,

R: 5’- CTGGTACCAGTTCATACTTACCAACTCCAG -3’

The interacting protein 2:

F: 5’- CTGGATCCATTCCAAGTTATCGAATCCA -3’,

R: 5’- CTGGTACCGGTAGGTGAAGGCTTCAACT -3’

The two PCR products and VIGS empty vector were digested with BamH I and Asp718, respectively then the digested products of the two PCR products and VIGS empty vector were ligated, respectively with TRV:00 to construct TRV:RGLIP-1 and TRV:RGLIP-2, which were transformed into Agrobacterium tumefaciens GV3101.

2.2.5 Function of the interacting proteins by VIGS analysis

The first and second leaves were inoculated with Agrobacterium tumefaciens GV3101 containing different VIGS vectors in Cf-4 transgenic tobacco by injection, with TRV:00 as negative control and TRV:RGL as positive control. TRV:RGLIP was used to detect the function of RGL interacting proteins in the proceeding of HR. The third and fourth, the fifth and sixth leaves were inoculated with Agrobacterium tumefaciens GV3101 containing pRH78:Avr4 after three and five weeks, respectively, and hypersensitive response was investigated 3-5 days later. This experiment was repeated for three times.

3 Results

3.1 Analysis of the gene sequences involved in HR

The sequence analysis indicated that one gene showed homology with many genes such as Prf, Bs2, and was named RGL. The amino acid from 167 to 439 is the NB-ARC conservative domain which is one kind of signal transduction domain in many resistant genes (Fig. 1). It was chosen as the bait protein for yeast two-hybrid.

3.2 Interacting protein analysis

One million yeast colonies containing two plasmids were obtained, 43 positive colonies were further screened, and 3 positive colonies were obtained by excluding the autonomous transcriptional activity (Plate I-A-B).

Analysis of the screening showed that two interacting proteins, RGLIP-1 and RGLIP-2, were identified from tomato cDNA library. RGLIP-1 was a protein of 291 amino acids with 63% homology with thylakoid lumen protein (Fig. 2). RGLIP-2 was a protein of 248 amino acids with 60%homology with transducin protein (Fig. 3).

3.3 Function analysis by VIGS

HR was induced by treating with Avr4 in Cf-4 transgenic tobacco. In the early days, the leaves withered, then died. The empty vector TRV:00 was found unable to affect the origination of HR (Plate II-C). The positive control TRV:RGL resulted in weakening HR (Plate II-D). RGLIP-1 also showed a partial suppression hypersensitive response by VIGS (Plate II-E), RGLIP-2 suppressed hypersensitive response reaction completely (Plate II-F).

4 Discussion

Five genes involved in HR were screened by VIGS in tomato, the analysis of one RGL sequence suggested that there was a NB-ARC conservative domain, which was one kind of signal transduction domain in many resistant genes. This result proved that there were some proteins interacting with this protein in tomato cells. As reported, this function domain was one kind of regulators of cell death in animals (van der Biezen et al., 1998).

RGL protein was used as bait to screen interacting protein(s) from tomato cDNA library through the yeast two-hybrid system. Two interacting proteins named RGLIP-1 and RGLIP2 (RGL Interacting Protein) were found. RGLIP-1 showed 63% homology with thylakoid lumen protein in the chloroplast. It was reported that the decline of the chloroplast could accelerate HR, the interaction of RGL and RGLIP-1 resulted in chloroplast decline and accelerating HR (Heldin, 1995). It is suggested that NB-ARC is the key regulator to activate cell death in plants and animals especially. The other interacting protein RGLIP-2 had a 60% homology with transduction protein in arabidopsis, named G protein. There are two types of G proteins in the live cell, one type is made of three subunits (α,β,γ), and the other type has only one subunit. As membrane binding proteins, G proteins participate in many kinds of cell signal transduction by coupling with the receptors on the surface of cells (Freissmuth et al., 1989; Neer and Clapham, 1988; Neubig, 1994). It has been reported that small G proteins usually transmit the resistant reaction in plants (Ono et al., 2001) , but it is not clear which type the RGLIP-2 protein is, thereby, it is essential to make further study about it.

In this study, RGL and the two interacting proteins possibly existed in the same signal transduction branch or at the signal transduction branch point. Besides, the HR was suppressed partially, RGL may not be silent effectively and some transcripts may be translated into proteins which expressed the function of RGL. Actually, half of the cDNA library was screened by yeast two-hybrid system, and new interacting proteins would be found if the other half library was screened.

References

[1]

Cai X, Takken F L W, Joosten M H A J, De Wit P J G M (2001). Specific recognition of AVR4 and AVR9 results in distinct patterns of hypersensitive cell death in tomato, but similar patterns of defence-related gene expression. Molecular Plant Pathology, 2(2): 77-86

[2]

De Jong C, Honée G, Joosten M H A J, De Wit P J G M (2000). Early defence responses induced by AVR9 and mutant analogues in tobacco cell suspensions expressing the Cf-9 resistance gene. Physiological and Molecular Plant Pathology, 56(4): 169-177

[3]

Freissmuth M, Casey P J, Gilman A G (1989). G proteins control diverse pathways of transmembrane signaling. FASEB Journal, 3(10): 2125-2132

[4]

Heldin C H (1995). Dimerization of cell surface receptors in signal transduction. Cell, 8(2): 213-223

[5]

Holzberg S, Brosio P, Gross C, Pogue G P (2002). Barley stripe mosaic virus-induced gene silencing in a monocot plant. Plant Journal, 30(3): 315-327

[6]

Jin H L, Liu Y D, Yang K Y, Kim C Y, Barbara B, Zhang S Q (2003). Function of a mitogen-activated protein kinase pathway in N gene-mediated resistance in tobacco. Plant Journal, 33(4): 719-731

[7]

Jones D A, Thomas C M, Hammond-Kosack K E, Balintkurti P J, Jones J D (1994). Isolation of the tomato Cf-9 gene for resistance to Cladosporium fulvum by transposon tagging. Science, 266(5186): 789-793

[8]

Luderer R, Takken F L W, de Wit P J G M, Joosten M H A J (2002). Cladosporium fulvum overcomes Cf-2-mediated resistance by producing truncated AVR2 elicitor proteins. Molecular Microbiology, 45(3): 875-884

[9]

Neer E J, Clapham D E (1988). Roles of G protein subunits in transmembrane signalling. Nature, 333(6169): 129-134

[10]

Neubig R R (1994). Membrane organization in G-protein mechanisms. FASEB Journal, 8(12): 939―946

[11]

Ono E, Wong H L, Kawasaki T, Hasegawa M, Kodama O, Shimamoto K (2001). Essential role of the small GTPase Rac in disease resistance of rice. Proceedings of the National Academy of Sciences of the United States of America, 98(2): 759-764

[12]

Piedras P, Hammond Kosack K E, Harrison K, Jones J D G (1998). Rapid, Cf-9- and Avr9-dependent production of active oxygen species in tobacco suspension cultures. Molecular Plant-Microbe Interaction, 11(12): 1155-1166

[13]

Ratcliff F, Martin-Hernandez A M, Baulcombe D C (2001). Tobacco rattle virus as a vector for analysis gene function by silencing. Plant Journal, 25(2): 237-245

[14]

van der Biezen E A, Jones J D (1998). The NB-ARC domain: a novel signaling motif shared by plant resistance gene products and regulators of cell death in animals. Current Biology, 8(7): R226-227

[15]

Westerink N (2003). The role of AVR4 and AVR4E proteins in virulence and avirulence of the tomato pathogen Cladosporium fulvum. Dissertation for the Doctoral Degree. Wageningen: Wageningen University

RIGHTS & PERMISSIONS

Higher Education Press

PDF (764KB)

1620

Accesses

0

Citation

Detail

Sections
Recommended

/