β-Hydroxybutyrate Exerts Anti-Tumor Effects in Nasopharyngeal Carcinoma Through Caspase-3-Mediated Apoptosis

Abstract

Background: Ketogenic enzymes are downregulated and act as tumor suppressors in nasopharyngeal carcinoma (NPC), yet the antitumor mechanisms of the ketone body β-hydroxybutyrate (β-HB) in NPC remain unclear.

Methods: Network pharmacology, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment, and molecular docking were used to identify candidate β-HB–NPC targets. In vitro, the effects of β-HB on cell viability, colony formation, caspase-3 enzymatic activity, and apoptosis were assessed in NPC cells. Dose- and time-response cell viability analyses were also performed using NP69 cells. Caspase-3 involvement was evaluated using Z-DEVD-FMK and CASP3 siRNA. Two independent NPC C17 patient-derived xenograft (PDX) experiments used alternate-day fasting or a ketogenic diet to induce ketosis. Epstein–Barr virus (EBV) lytic-gene expression, EBV DNA copy number, and tumor EBV-encoded RNAs (EBER) status were also assessed.

Results: We identified 177 overlapping β-HB–NPC targets and five hub targets, with caspase-3 prioritized as an apoptosis-associated functional node. Molecular docking predicted a compatible binding pose for β-HB within caspase-3, but did not establish direct binding. In vitro, β-HB suppressed cell viability and clonogenic growth without reducing NP69 viability under the tested conditions. It increased caspase-3 activity, cleaved caspase-3, PARP-1, and promoted apoptosis. Both Z-DEVD-FMK and CASP3 silencing attenuated β-HB-induced apoptosis. In vivo, both independent PDX experiments demonstrated tumor suppression accompanied by elevated ketone-related measures. Tumors from both intervention groups exhibited reduced Ki-67 expression, and increased terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) positivity. β-HB also upregulated the EBV immediate-early lytic gene expression (BZLF1 and BRLF1), while a nonsignificant trend toward increased EBER positivity was observed in fasting-treated tumors.

Conclusion: β-HB suppresses NPC cell growth and promotes apoptosis, with caspase-3 serving as a functional mediator. In vivo, both dietary interventions suppressed tumor growth and were accompanied by increases in ketone-related measures. β-HB also induces EBV immediate-early lytic gene expression, supporting further investigation of ketone metabolism as a potential therapeutic strategy for NPC.

Keywords

nasopharyngeal carcinoma / β-hydroxybutyrate / caspase-3 / apoptosis / patient-derived xenograft / EBV

1 Introduction

Among head and neck cancers, nasopharyngeal carcinoma (NPC) is notable for its distinctive geographical distribution^[1] and is particularly common in southern China^[2,^3]. NPC is also strongly linked to latent Epstein–Barr virus (EBV) infection^[1,^4]. Although clinical strategies have steadily advanced, radiation therapy-based treatment, typically in combination with chemotherapy, remains the mainstay of treatment for most patients. However, distant metastasis still occurs in approximately 20%–30% of patients and remains a major cause of treatment failure and poor long-term survival^[5]. Although recent advances in chemotherapy and immunotherapy have improved management of recurrent/metastatic NPC, the overall benefit remains limited, and long-term durable responses are still restricted to a subset of patients^[6,^7]. These clinical challenges highlight the necessity for biologically sound adjunctive strategies that can supplement current treatment methods.

Metabolic reprogramming is considered a core hallmark of malignant tumor progression^[8,^9]. Increasing evidence indicates that NPC similarly undergoes profound metabolic reprogramming, such as enhanced glycolysis, dysregulated lipid and amino acid metabolism^[10,^11]. As the major etiological factor in NPC, EBV infection itself also contributes to metabolic remodeling. EBV-encoded oncoproteins such as LMP1 and LMP2A have been shown to reprogram glycolytic and lipid metabolic pathways, thereby promoting tumor progression and metabolic adaptation in NPC cells^[4,¹²-^14]. Among these metabolic alterations, ketone body metabolism shows an underappreciated yet potentially actionable pathway. In our previous studies, we demonstrated that the key ketogenesis-related enzymes ACAT1 and HMGCL were downregulated and functionally inactivated in NPC, suggesting an overall reduction in endogenous β-hydroxybutyrate (β-HB) availability. Consistent with this observation, both endogenous ketogenesis restoration and exogenous supplementation with β-HB suppressed malignant phenotypes of NPC, including proliferation and migration^[15,^16]. These findings provided an important rationale for our subsequent investigation of the biological role of β-HB in NPC. β-HB, the major ketone body in circulation, has long been viewed as a transient intermediate metabolite in cellular energy metabolism, but is now increasingly recognized as an endogenous small-molecule metabolite with important signaling and therapeutic potential^[17]. Beyond its role as an alternative metabolic substrate for energy production during fasting or nutritional ketosis, β-HB can modulate oxidative stress, inflammation, epigenetic remodeling, and gene transcription. For example, β-HB has been shown to act as an endogenous inhibitor of class I histone deacetylases (HDACs) and to induce oxidative stress resistance–related transcriptional programs^[18], while also suppressing NLRP3 inflammasome-mediated inflammatory responses^[19]. Antitumor effects of β-HB or ketogenic interventions were also reported in several cancer types, where they may inhibit cell growth, promote apoptosis, or reshape tumor metabolism^[20-^22]. However, the biological effects of β-HB appear to be highly context-dependent and may vary across tumor types^[23]. Despite these emerging insights, the candidate target spectrum and dominant effector pathways of β-HB in NPC remain poorly understood.

Network pharmacology has emerged as a useful systems-level framework for predicting candidate targets and characterizing the mechanisms of bioactive molecules via analysis of drug–target and disease-associated networks^[24]. In the present study, we therefore applied a network pharmacology-based strategy to investigate potential targets and signaling pathways of β-HB in NPC. This analysis highlighted apoptosis as a major candidate biological process and identified caspase-3 (CASP3) as a consensus apoptosis-associated node. We subsequently combined molecular docking, in vitro functional assays, pharmacological caspase-3 inhibition, and siRNA silencing to characterize the functional involvement of caspase-3 in β-HB-induced apoptosis. We further applied two independent experiments in the NPC C17 PDX model to evaluate tumor growth and apoptosis in response to alternate-day fasting or a ketogenic diet. In addition, given the close association between NPC and latent EBV infection, we further investigated whether β-HB affects EBV lytic gene expression in NPC cells^[4].

2 Materials and Methods

2.1 Network pharmacology analysis

Potential therapeutic targets for β-HB in NPC were identified using an integrated network pharmacology approach. The SMILES string of β-HB (PubChem CID: 441) was retrieved from the PubChem database and submitted to SwissTargetPrediction, ChEMBL, and TargetNet. All databases were accessed on May 25, 2023, and searches were restricted to Homo sapiens. SwissTargetPrediction, ChEMBL, and TargetNet returned 23, 247, and 353 targets, respectively, using the following thresholds: probability > 0 for SwissTargetPrediction, Tanimoto coefficient > 0.5 for ChEMBL, and probability > 0.5 for TargetNet. The three target lists were then merged, and duplicate gene symbols were removed, yielding 596 unique β-HB-related targets (Suppl. Table 1).

NPC-related targets were collected from the GeneCards, MalaCards, and CTD, using the keyword “nasopharyngeal carcinoma”. All databases were accessed on May 29, 2024. GeneCards, CTD, and MalaCards returned 2,921, 1,373, and 186 original gene hits, respectively. GeneCards genes with relevance scores greater than the median and CTD targets with inference scores > 10 were retained. All gene identifiers were converted to HGNC-approved gene symbols. The three gene lists were merged and duplicate gene symbols were removed, yielding 3,800 unique NPC-related genes (Suppl. Table 2). The intersection of the 596 β-HB-related targets and 3,800 NPC-related genes identified 177 overlapping targets of β-HB in NPC (Suppl. Table 3).

To identify candidate targets, the overlapping targets were imported into the STRING database to construct a protein–protein interaction (PPI) network, with the organism set to Homo sapiens and the minimum required interaction score set at 0.4. The resulting PPI network was visualized using Cytoscape (version 3.10.2).

Hub candidates were independently screened using three complementary Cytoscape plugins. First, CytoNCA (Cytoscape plugin v2.1.6) was applied using degree centrality (DC), betweenness centrality (BC), and closeness centrality (CC), with a threshold of the top 10% for each metric. Second, cytoHubba (Cytoscape plugin v0.1) was applied using the Maximal Clique Centrality (MCC) algorithm, selecting the top 13 nodes. Third, MCODE (Cytoscape plugin v2.0.2) was applied with the following parameters: degree cutoff = 2, node score cutoff = 0.2, k-core = 2, and max depth = 100; nodes in the highest-scoring module were retained as MCODE candidates. Under the final consensus rule, only genes identified by all three algorithms were designated as consensus hub genes. The PPI analysis revealed five hub targets: CASP3, CYCS, CASP8, CASP9, and TP53.

To further explore the biological functions and signaling pathways associated with the five hub targets, Gene Ontology (GO) functional annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed using the DAVID database (accessed August 9, 2026). Enriched terms with a false discovery rate (FDR) < 0.05 were considered statistically significant. The enrichment results were visualized using the online Bioinformatics Platform (accessed August 9, 2026).

2.2 Molecular docking

Molecular docking simulations were performed to evaluate the binding potential of β-HB to each of the five consensus hub targets. The three-dimensional structures of the target proteins were downloaded from the Protein Data Bank (PDB). Protein preparation was carried out in AutoDockTools (version 1.5.7) by removing water molecules and co-crystallized ligands and adding polar hydrogen atoms. The three-dimensional structure of β-HB was obtained from PubChem and energy-minimized prior to docking. Docking calculations were conducted using AutoDock Vina (version 1.2.5). The optimal docking conformations and intermolecular interactions were visualized using PyMOL and Discovery Studio Visualizer. More negative docking scores were interpreted as stronger predicted binding affinity, rather than evidence of physical binding.

2.3 Cell culture and β-HB exposure conditions

The NPC cell lines 5-8F and HK1, together with their corresponding EBV-positive derivatives, and the immortalized non-malignant nasopharyngeal epithelial cell line NP69 were obtained from the Key Laboratory of Early Prevention and Treatment for Regional High Frequency Tumor (Guangxi Medical University), Ministry of Education. 5-8F and NP69 cells were maintained in DMEM (Gibco, Cat# C11995500BT), whereas HK1 cells were maintained in RPMI 1640 (Gibco, Cat# C22400500BT), supplemented with 10% fetal bovine serum (Gibco, Cat# 10091148) and 1% penicillin–streptomycin (Solarbio, Cat# P1400). EBV-positive cells were maintained under G-418 selection (800 μg/mL, MCE, Cat# HY-17561). All cells were incubated at 37 °C with 5% CO₂ and, unless otherwise noted, treated with β-HB (20 mM, Aladdin, Cat# x131756) for 48 h before experiments. The 20 mM concentration was selected based on the dose- and time-response findings and the concentration range used in a previous in vitro study^[20].

2.4 Cell viability assay

Cells were plated in 96-well plates (2 × 10³ cells/well) and cultured for 1–4 days. For dose- and time-response analyses, 5-8F, HK1, and NP69 cells were treated with β-HB at 0, 0.5, 1, 5, 10, and 20 mM, and cell viability was measured at 48, 72, and 96 h. At the indicated time points, CCK-8 reagent (10 μL, APExBIO, Cat# K1018) was added to each well and incubated for 1.5 h at 37 °C in the dark. Cell viability was then quantified by measuring absorbance at 450 nm using a microplate reader. Relative cell viability was expressed as a percentage of the corresponding untreated control.

2.5 Colony formation assay

Cells (300 cells/well) were plated in 6-well plates and cultured for two weeks, then fixed with 4% paraformaldehyde, stained with crystal violet (Solarbio, Cat# G1062), photographed, and counted using ImageJ software. Colonies containing > 50 cells were considered positive.

2.6 Caspase-3 activity assay

To assess caspase-3 activity, cells were lysed on ice and centrifuged to obtain supernatants. Protein concentrations were measured using a Bradford assay kit (Beyotime, Cat# P0006). Equal protein amounts were incubated with reaction buffer and Ac-DEVD-pNA substrate from a colorimetric caspase-3 assay kit (Beyotime, Cat# C1116) for 2 h at 37 °C. Caspase-3 activity was determined by measuring absorbance at 405 nm and calculating released pNA from a standard curve.

2.7 siRNA-mediated CASP3 knockdown

NPC cells (5-8F, 3 × 10⁵ cells/mL) were plated in 6-well plates for 24 h before transfection. At approximately 60% confluence, the medium was replaced with serum-free Opti-MEM (Gibco, Cat# 31985070). CASP3-targeting siRNA (siCASP3) or negative-control siRNA (NC) and Lipofectamine RNAiMAX (Thermo Fisher Scientific, Cat# 13778075) were separately diluted in Opti-MEM, combined, incubated for 20 min at room temperature, and added dropwise to the cells at a total transfection volume of 500 μL/well. After 6 h, the transfection medium was replaced with complete culture medium. Cells were harvested 24 h or 48 h after transfection. CASP3 knockdown efficiency was quantified by RT-qPCR, and apoptosis was assessed by Annexin V-APC/7-AAD flow cytometry after β-HB treatment. The siRNA sequences (Wuhan Paiwei Biotechnology Co., Ltd) were as follows: siCASP3: 5′-GCGUGAUGUUUCUAAAGAAGA-3′; NC: 5′-TTCTCCGAACGTGTCACGT-3′.

2.8 Western blot analysis

Western blot analysis was performed as described previously^[15]. Briefly, total protein was extracted from cells using RIPA buffer supplemented with PMSF and protease inhibitors, and protein concentrations were determined by BCA assay (Epizyme, Cat# ZJ101). Equal amounts of protein were subjected to SDS-PAGE and immunoblotting with antibodies against cleaved caspase-3 (Cell Signaling Technology, Cat# 9661S; expected band 17/19 kDa), PARP-1 (Cell Signaling Technology, Cat# 9532S; the full-length protein is approximately 116 kDa; the cleaved fragment is approximately 89 kDa), and β-actin (Proteintech, Cat# 66009-1-Ig; approximately 42 kDa). Protein bands were visualized using an Odyssey DLx imaging system (LI-COR Biosciences, Lincoln, NE, USA) and quantified by ImageJ software.

2.9 Flow-cytometric apoptosis analysis (Annexin V-APC/7-AAD)

Apoptosis was analyzed using an Annexin V-APC/7-AAD apoptosis detection kit (MultiSciences, Cat# AP105). For compensation setup, untreated cells were incubated with Apoptosis Positive Control Solution on ice for 30 min, mixed with an equal number of viable cells, and used as blank and single-stained controls. For apoptosis analysis, untreated and β-HB-treated cells were collected and stained with both Annexin V-APC and 7-AAD for flow cytometric analysis. Apoptotic cells were defined as Annexin V-APC-positive cells, including both early and late apoptotic populations. Representative gating hierarchies are provided in Suppl. Fig. S1.

2.10 Caspase-3 inhibition experiment

To assess the functional involvement of caspase-3 in β-HB-induced apoptosis, pharmacological inhibition experiments were conducted using Z-DEVD-FMK (MCE, Cat# HY-12466), a cell-permeable irreversible caspase-3 inhibitor. NPC cells were divided into four groups: vehicle control, β-HB alone, β-HB + Z-DEVD-FMK, and Z-DEVD-FMK alone. Cells in the inhibitor-treated groups were preincubated with Z-DEVD-FMK (40 μM) for 1 h prior to β-HB treatment. After 48 h, apoptosis was assessed by Annexin V-APC/7-AAD flow cytometry as described above.

2.11 Quantitative real-time PCR

To assess CASP3 knockdown efficiency, 5-8F cells transfected with siCASP3 or negative-control siRNA were collected 24 h or 48 h after transfection. To evaluate EBV lytic gene expression and detect EBV DNA copy number, 5-8F EBV(+) and HK1 EBV(+) cells were treated with β-HB. Total RNA was extracted using an RNA extraction kit (Seven, Cat# SM132-02), and first-strand cDNA was synthesized using a cDNA synthesis kit (YoungGen, Cat# RT203) for the analysis of lytic gene expression and CASP3 mRNA expression. Genomic DNA was extracted using a DNA extraction kit (Vazyme, Cat# DC102-01) for DNA copy number detection. RT-qPCR analyses of CASP3, BZLF1, and BRLF1 were performed on a QuantStudio 6 Flex system using SYBR Green PCR Master Mix (Applied Biosystems, Cat# A25743) with GAPDH as the internal control. EBV DNA was quantified using Premix Ex Taq (Probe qPCR) (Takara, Cat# RR390A). The primer sequences were as follows:

CASP3-F: 5′-TTCCCAGGTTTTGTTTCCTG-3′;

CASP3-R: 5′-CCTTTCACCGAAACAGCATT-3′;

BRLF1-F: 5′-CCATACAGGACACAACACCTCA-3′;

BRLF1-R: 5′-ACTCCCGGCTGTAAATTCCT-3′;

BZLF1-F: 5′-TTGGGCACATCTGCTTCAACAGGA-3′;

BZLF1-R: 5′-AATGCCGGGCCAAGTTTAAGCAAC-3′;

BAM90-F (EBV DNA): 5′-TCTGCTAAGCCCAACACTC-3′;

BAM90-R (EBV DNA): 5′-TGCCTTCTTAGGAGCTGTC-3′;

BAM90-probe (EBV DNA): 5′-(FAM)CACACACTACACACACCCACCCGTCTC (BHQ-1)-3′;

GAPDH-F (lytic genes): 5′-AAGCTCACTGGCATGGCCTT-3′;

GAPDH-R (lytic genes): 5′-CTCTCTTCCTCTTGTGCTCTTG-3′;

GAPDH-F (EBV DNA): 5′-CTGCCAACGTGTCAGTGGTG-3′;

GAPDH-R (EBV DNA): 5′-TCAGTGTAGCCCAGGATGCC-3′.

The cycling conditions were 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. Relative gene expression was calculated using the 2^−ΔΔCt method, while EBV DNA copy number was determined using the standard curve method.

2.12 NPC C17 PDX experiments

The NPC C17 patient-derived xenograft (PDX) model retaining latent EBV infection was established by subcutaneous implantation of tumor fragments into immunodeficient mice. Male BALB/c nude mice (4–5 weeks old, SPF Biotech Beijing) were used for the two independent dietary-intervention experiments. Tumor tissues harvested from donor mice were cut into approximately 1 mm³ fragments and implanted into the right flank within 3 h. Subsequently, two independent dietary-intervention experiments were conducted using the same implantation, monitoring, and tissue-collection procedures.

On day 14 after implantation, tumor-bearing mice were randomly assigned to the respective intervention groups (n = 6 per group in each experiment). In the alternate-day fasting experiment, mice underwent alternating 24 h periods of fasting and normal feeding for 2 weeks, while control mice received the normal diet (Ke'ao Xieli, Cat# 1016706476803973120). In the ketogenic-diet experiment, mice were randomly assigned to receive either a normal diet or a ketogenic diet (Envigo, Cat# TD.96355) for 2 weeks. The normal diet contained crude protein ≥ 20%, crude fat ≥ 4%, crude fiber ≤ 5%, crude ash ≤ 8%, calcium 1.0%–1.8%, total phosphorus 0.6%–1.2%, and moisture ≤ 10%. The ingredient composition included corn, soybean meal, fish meal, wheat flour, yeast powder, vegetable oil, salt, and a premix of vitamins and minerals. The ketogenic diet provided approximately 90.5% of total energy from fat, 9.2% from protein, and 0.3% from carbohydrates, corresponding to a calculated fat-to-(protein + carbohydrate) energy ratio of 4.25:1.

Tumor volume was calculated using the formula: V (mm³) = length × width² × 0.5. Body weight and tumor volume were measured every other day. Humane endpoints were defined as a tumor length > 15 mm, body weight loss > 20% from baseline, or tumor ulceration or infection. At the end of the corresponding intervention period, or earlier if a humane endpoint was reached, mice were euthanized, and tumors, livers, kidneys, and blood samples were collected for subsequent analyses.

2.13 Measurement of ketone bodies and β-HB

Total ketone body (KB) and β-HB levels in serum, liver, and kidney were determined by ELISA (MEIMIAN, Cat# MM-0967M1 and YaJi Biological, Cat# YS02984B). Liver and kidney tissues were weighed, homogenized in normal saline using a tissue grinder (−10 °C, 60 Hz, 30 s per cycle with 15 s intervals, 2 cycles), and centrifuged to collect the supernatants. Absorbance (450 nm) was measured, and concentrations were calculated from standard curves.

2.14 Immunohistochemistry (IHC) and EBER in situ hybridization (ISH)

Formalin-fixed, paraffin-embedded tissue sections (4 μm) were used for IHC and EBER ISH. For IHC, sections were deparaffinized, rehydrated, and incubated with an anti-Ki-67 antibody (Abcam, Cat# ab15580), followed by an HRP-conjugated secondary antibody. Signals were visualized with DAB (ZSGB-BIO, Cat# ZLI-9018) and counterstained with hematoxylin. The percentage of Ki-67-positive cells was quantified in five randomly selected high-power fields (400×) per section by two independent pathologists.

For EBER ISH, sections were deparaffinized, rehydrated, and treated with proteinase K, followed by hybridization with a fluorescein-labeled EBER oligonucleotide probe (ZSGB-BIO, Cat# ISH-7001). Signals were detected using an alkaline phosphatase-conjugated anti-fluorescein antibody and visualized with NBT/BCIP. EBER-positive cells were quantified in five randomly selected high-power fields per section.

2.15 TUNEL assay

Apoptosis in tumor tissues was assessed using a colorimetric TUNEL assay kit (Beyotime, Cat# C1091). Formalin-fixed, paraffin-embedded tissue sections were deparaffinized, rehydrated, and permeabilized with proteinase K (20 μg/mL; Beyotime, Cat# ST533) for 25 min at 37 °C. Endogenous peroxidase activity was blocked with 3% H₂O₂ for 20 min at room temperature. Sections were then incubated with biotin labeling mixture for 60 min at 37 °C in the dark, followed by stop buffer incubation and treatment with streptavidin-HRP working solution. Signals were visualized with DAB and counterstained with hematoxylin. TUNEL-positive cells were quantified using ImageJ software in three randomly selected high-power fields (400×) per section.

2.16 Statistical analysis

Statistical analyses were performed using GraphPad Prism (version 11.0). All quantitative data are expressed as mean ± SD. Comparisons between two groups were analyzed using the Welch's unpaired two-tailed t-test. Multi-group comparisons were assessed using one-way ANOVA or two-way ANOVA with Tukey's post-hoc test for multiple comparisons. Statistical significance was defined as P < 0.05. Unless otherwise stated, all in vitro experiments were performed using three independent biological replicates (n = 3).

3 Results

3.1 Prediction of potential core targets of β-HB in NPC

To explore the potential pharmacological targets of β-HB, we performed a network pharmacology analysis. A total of 596 putative β-HB targets were identified through the SwissTargetPrediction, ChEMBL, and TargetNet databases. Meanwhile, 3,800 NPC-related disease targets were collected from the GeneCards, MalaCards, and CTD databases. By integrating the predicted β-HB targets with NPC-related targets, we identified 177 overlapping targets, which may represent the potential therapeutic targets of β-HB in NPC (Fig. 1a, Suppl. Tables 1–3).

3.2 PPI network analysis identified five apoptosis-related consensus hub genes

To further characterize the interactions among these overlapping targets and identify the hub functional nodes, the 177 shared targets were subjected to PPI analysis using the STRING database. As shown in Fig. 1b, the resulting PPI network revealed extensive interactions among the candidate targets. Subsequent topological analysis using Cytoscape identified five hub targets, including CASP3, CYCS, CASP9, CASP8, and TP53 (Fig. 1c). These consensus hubs are closely associated with apoptosis-related signaling. These findings suggest that β-HB may exert its antitumor effects, at least in part, through apoptosis-related signaling networks.

Subsequently, GO and KEGG pathway enrichment analyses were performed to investigate the biological functions and regulatory pathways associated with the five potential targets. GO enrichment analysis indicated that these targets were predominantly associated with apoptosis-related functions. In the Biological Process category, the top enriched terms included “positive regulation of neuron apoptotic process” (GO:0043525, adjusted P = 1.81 × 10⁻⁵), “apoptotic process” (GO:0006915, adjusted P = 6.48 × 10⁻⁵) , and “positive regulation of apoptotic process” (GO:0043065, adjusted P = 4.92 × 10⁻⁴). In the Cellular Component category, the key terms included caspase complex, death-inducing signaling complex, and mitochondrion. In the Molecular Function category, the significantly enriched terms were dominated by cysteine-type endopeptidase activity involved in apoptotic process and apoptotic signaling pathway (Fig. 1d).

The KEGG pathway enrichment analysis further revealed significant enrichment of the "p53 signaling pathway" (hsa04115, adjusted P = 1.61 × 10⁻⁷), "Platinum drug resistance" (hsa01524, adjusted P = 1.61 × 10⁻⁷) and "Apoptosis" (hsa04210, adjusted P = 9.28 × 10⁻⁷) (Fig. 1e). Notably, the apoptosis pathway was most consistent with the KEGG and GO results and closely matched the candidate hub targets, including CASP3, CYCS, CASP9, CASP8, and TP53. These data further support apoptosis as a central pathway through which β-HB may exert its anti-NPC effects. The complete enrichment results are provided in Suppl. Tables 4 and 5.

3.3 Molecular docking suggested a potential interaction between β-HB and CASP3

Based on the PPI network, molecular docking was conducted for the five core targets to evaluate their potential interactions with β-HB. The docking results are shown in Fig. 2 and Table 1. Among these predicted core targets, CASP3 yielded the most favorable docking score for β-HB (−8.106 kcal/mol), and was therefore selected for further interaction analysis. This computational result suggests a potentially compatible binding pose but does not by itself demonstrate direct binding.

Specifically, β-HB formed a hydrogen bond with ARG207 of CASP3 (2.6 Å), whereas its carboxylate group formed a salt bridge with ARG64 and a hydrogen bond with GLN161 (1.9 Å). These results provide suggestive structural evidence for a possible interaction between β-HB and CASP3 and identify CASP3 as a candidate target for further validation.

3.4 Exogenous β-HB inhibited NPC cell growth in vitro

To assess the effect of β-HB on NPC cell growth in vitro, CCK-8 and colony formation assays were performed in 5-8F and HK1 cells treated with exogenous β-HB. Dose- and time-response analyses showed that β-HB decreased the viability of 5-8F and HK1 cells, most strongly at 10–20 mM, but had no significantly reduction in NP69 cells at any concentration or time point. Based on the strong inhibition in NPC cell lines without affecting NP69 cell viability, 20 mM β-HB for 48 h was chosen for subsequent experiments (Suppl. Fig. S2). The CCK-8 analysis showed that β-HB treatment significantly reduced cell viability in both cell lines compared with the untreated group (Fig. 3a). In parallel, colony formation assays revealed that β-HB significantly decreased both colony number and colony size in both cell lines (Fig. 3b). Thus, exogenous β-HB inhibits NPC cell growth under these conditions without detectable effects on NP69 cells.

3.5 Alternate-day fasting and a ketogenic diet suppressed tumor growth in the NPC C17 PDX model accompanied by increased ketone-related measures in vivo

Having demonstrated the growth-inhibitory effect of β-HB in vitro, we next evaluated whether two dietary interventions that induce systemic ketosis were associated with tumor suppression in the NPC C17 PDX model in vivo. In the alternate-day fasting experiment, tumors grew more slowly in the fasting group than in the control group. At the endpoint, both tumor volume (control vs. fasting: 378.42 mm³ vs. 114.42 mm³) and tumor weight (control vs. fasting: 0.56 g vs. 0.13 g) were reduced in the fasting group (Figs. 4a–c). The body weight in the fasting group also showed a gradual decline compared with the normal-diet controls (Fig. 4d).

Under alternate-day fasting conditions, serum ketone body levels significantly increased to above 6 mmol/L, whereas those in normally fed controls remained below 4 mmol/L, accompanied by marked elevations in ketone body levels in both the liver and kidney (Fig. 4e). In addition, hepatic β-HB concentration was also significantly higher in the fasting group than in controls (control vs. fasting: 66 μmol/L vs. 104 μmol/L; Fig. 4f). These findings showed that alternate-day fasting suppressed PDX tumor growth, alongside increases in ketone-related measures.

To determine whether this phenotype could be reproduced with an independent dietary intervention, we subsequently performed a separate NPC C17 PDX experiment using a ketogenic diet. Consistent with the fasting experiment, the ketogenic diet also significantly slowed tumor growth and reduced endpoint tumor volume (normal diet vs. ketogenic diet: 1,036.89 mm³ vs. 165.58 mm³) and tumor weight (normal diet vs. ketogenic diet: 0.81 g vs. 0.2 g) compared with the control group (Figs. 4g–i). Mice in the ketogenic diet group also exhibited a gradual decline in body weight (Fig. 4j). Furthermore, β-HB levels were significantly increased in the serum (normal diet vs. ketogenic diet: 78 μmol/L vs. 294 μmol/L), liver (normal diet vs. ketogenic diet: 1,806 μmol/L vs. 3,466 μmol/L), and kidney (normal diet vs. ketogenic diet: 1,766 μmol/L vs. 3,198 μmol/L) in ketogenic-diet-fed mice than in controls (Fig. 4k).

Collectively, both alternate-day fasting and a ketogenic diet suppressed NPC C17 PDX growth and were accompanied by increased circulating and tissue ketone or β-HB levels. The concordant findings from these two independent dietary interventions suggest an association between dietary ketosis and tumor suppression.

3.6 Exogenous β-HB and ketosis-inducing dietary interventions promoted apoptosis in NPC

Since network pharmacology and molecular docking indicated CASP3 as a β-HB-related apoptosis hub, we next tested whether β-HB induces apoptosis and activates caspase-3-associated apoptotic signaling in NPC cells.

At the cellular level, Annexin V-APC/7-AAD double staining showed that β-HB treatment markedly increased the proportion of apoptotic cells in both 5-8F and HK1 cells compared with the untreated group (Fig. 5a). Consistent with this finding, β-HB treatment significantly increased caspase-3 activity in both NPC cell lines (Fig. 5b).

Western blot analysis further revealed increased levels of cleaved caspase-3 and PARP-1 after β-HB treatment in both 5-8F EBV(+) and HK1 EBV(+) cells (Fig. 5c). These results demonstrate that β-HB-induced apoptosis was accompanied by increased caspase-3-associated enzymatic activity and processing.

To further characterize the biological basis of tumor suppression, Ki-67 IHC and TUNEL staining were performed in the two independent NPC C17 PDX experiments. Compared with controls, tumors from both the alternate-day fasting and ketogenic-diet groups showed reduced Ki-67 staining and increased TUNEL positivity (Figs. 5d–g). In both dietary intervention models, tumor suppression was accompanied by decreased proliferative activity and increased apoptosis in vivo.

3.7 Pharmacological inhibition and CASP3 silencing attenuated β-HB-induced apoptosis

Having established that β-HB-induced apoptosis was accompanied by caspase-3-associated activation, we next examined the functional contribution of caspase-3 using pharmacological inhibition and siRNA-mediated gene silencing.

In NPC cell lines, β-HB alone increased apoptosis, whereas co-treatment with Z-DEVD-FMK significantly reduced it (Figs. 6a–d). These pharmacological inhibition data support a functional role for caspase-3 in β-HB-induced apoptosis, though inhibitor-based evidence alone cannot rule out off-target effects.

For genetic validation, CASP3 was silenced by siRNA in 5-8F cells. RT-qPCR confirmed a significant reduction in CASP3 mRNA after siCASP3 transfection (Fig. 6e). In negative control cells, β-HB markedly increased apoptosis. CASP3 silencing attenuated, but did not completely abolish, β-HB-induced apoptosis, whereas siCASP3 alone did not significantly affect basal apoptosis (Figs. 6f–g).

Together, the pharmacological inhibition and siRNA silencing results indicate that caspase-3 contributes, at least in part, to β-HB-induced apoptosis in NPC cells.

3.8 β-HB was associated with early EBV lytic gene induction in NPC

Because NPC is closely associated with latent EBV infection, we examined whether β-HB affects EBV lytic gene expression in EBV-positive NPC cells. β-HB treatment significantly increased the mRNA levels of the immediate-early lytic transcription factors BZLF1 and BRLF1 in both 5-8F EBV(+) and HK1 EBV(+) cells (Fig. 7a). However, EBV copy number was not significantly increased after β-HB treatment in vitro (Fig. 7b). In the NPC C17 PDX model, fasting-treated tumors showed stronger EBER staining and a higher proportion of EBER-positive cells than controls, although the difference did not reach statistical significance (Fig. 7c). These results suggest that β-HB is associated with early EBV lytic gene induction, but do not support full EBV lytic reactivation under the present conditions.

4 Discussion

The present study integrates computational prediction, in vitro assays, pharmacological inhibition, genetic loss-of-function analysis, and two independent dietary PDX experiments. Network pharmacology identified apoptosis as the prominent biological process in the β-HB–NPC target network, with CASP3 highlighted as a key candidate node. Molecular docking indicated a potentially compatible binding pose between β-HB and CASP3 catalytic pocket (docking score: −8.106 kcal/mol), but did not prove direct binding. β-HB increased caspase-3 enzymatic activity, cleaved caspase-3, and apoptosis in NPC cells. Both Z-DEVD-FMK and CASP3 silencing reduced β-HB-induced apoptosis, supporting an important but not exclusive role for caspase-3. In parallel, alternate-day fasting and a ketogenic diet each suppressed tumor growth and induced apoptosis, accompanied by increased ketone-related measures. Additionally, β-HB upregulated the EBV immediate-early lytic genes BZLF1 and BRLF1 in EBV-positive NPC cells, with concordant enhancement of EBER signals in fasting-treated PDX tumors, representing a novel NPC-specific finding. Overall, these data implicate caspase-3 activation in β-HB-induced apoptosis in NPC and suggest that β-HB may serve as a potential metabolic mediator of the tumor suppression associated with dietary ketosis.

The network pharmacology approach enabled systematic identification of candidate targets at the interface of β-HB pharmacology and NPC biology. By integrating multiple databases, we identified 177 overlapping β-HB- and NPC-related targets. PPI and enrichment analyses consistently highlighted apoptosis-associated signaling as the dominant functional theme. All five hub targets are closely associated with apoptotic regulation, supporting apoptosis as a central biological process underlying the effects of β-HB in NPC.

Caspase-3 is one of the principal executioner caspases in the apoptotic pathway, and its activation is a pivotal event in the irreversible apoptotic program^[25]. Molecular docking identified CASP3 as the top candidate target (−8.106 kcal/mol) among five hubs, with the predicted CASP3 pose involving ARG207, ARG64, and GLN161. However, this result only indicates structural compatibility between β-HB and CASP3, and remains hypothesis-generating. In vitro, β-HB markedly increased caspase-3 activity, cleaved caspase-3 and PARP-1 levels, and apoptotic cell death in NPC cells. However, total caspase-3 could not be reliably quantified in parallel with cleaved caspase-3; therefore, a cleaved-to-total caspase-3 ratio could not be calculated, limiting the quantitative assessment of caspase-3 processing. Moreover, Z-DEVD-FMK treatment and CASP3 silencing each attenuated β-HB-induced apoptosis. Because this attenuation was incomplete and CASP3 knockdown was confirmed only at the transcript level, these findings indicate caspase-3 as an important but not exclusive functional mediator of β-HB-induced apoptosis. Nevertheless, whether β-HB directly binds CASP3 or activates caspase-3 indirectly through upstream apoptotic pathways remains unresolved.

β-HB is an endogenous inhibitor of Class I HDACs and can increase histone acetylation^[18]. HDAC inhibition can induce pro-apoptotic transcriptional responses, including the pro-apoptotic gene BMF upregulation and the pro-survival gene BCL2A1 downregulation^[26]. Moreover, HDAC inhibition can also increase histone H4 acetylation at the EBV BRLF1 promoter, inducing BRLF1 transcription and EBV lytic activation^[27]. Consistent with this framework, our observations showed that β-HB increased BZLF1 and BRLF1 expression and promoted apoptosis in NPC cells, suggesting an HDAC-related upstream mechanism. However, HDAC activity and promoter acetylation were not directly measured, and other upstream processes, including oxidative stress, mitochondrial, and death-receptor signaling, may also converge on effector-caspase activation. Therefore, the relative contributions of these upstream mechanisms remain unclear.

These findings align with previous reports in other tumor types. In non-small cell lung cancer, β-HB has been reported to enhance apoptosis and elevate levels of cleaved caspase-3^[22], and in clear cell renal cell carcinoma, β-HB similarly triggered apoptosis, which was associated with increased caspase-3 expression^[28]. In hepatocellular carcinoma, β-HB also promoted cisplatin-induced apoptosis together with increased cleaved caspase-3 and caspase-8^[29]. However, the effect of β-HB on caspase-3-associated apoptosis appears to be context-dependent, as D-β-hydroxybutyrate was reported to suppress caspase-3 activity and attenuate apoptosis in oxidatively stressed PC12 cells^[30]. Taken together, our results showed that caspase-3 plays an important role in β-HB-induced apoptosis in NPC, as supported by pharmacological inhibition and CASP3 silencing.

The in vivo findings further supported an association between ketosis-inducing dietary interventions and tumor suppression in NPC. We performed two independent experiments in the NPC C17 PDX model using alternate-day fasting and a ketogenic diet. The alternate-day fasting regimen is a well-established intermittent fasting approach in metabolic intervention studies^[31], whereas a ketogenic diet provides a complementary approach to inducing nutritional ketosis through sustained carbohydrate restriction^[20,^32]. Within each experiment, the intervention significantly increased the circulating and tissue ketone body or β-HB levels compared with the control group. In parallel with these metabolic changes, tumor growth was suppressed, with reduced tumor volume and weight at the endpoint. Histological analyses further showed decreased Ki-67 staining and increased TUNEL-positive cells in tumors from both intervention groups, indicating reduced proliferation and promoted apoptotic cell death in vivo. The similar tumor-suppressive phenotype seen under two different dietary interventions shows that it was not restricted to alternate-day fasting. This difference in exposure levels was considered when interpreting the in vitro and in vivo findings. Although the β-HB concentration (20 mM) used for in vitro mechanistic studies exceeded circulating ketone-related levels measured in vivo, it was chosen based on our dose- and time-response experiments and falls within the range used in previous studies. It should therefore be considered an experimental exposure for mechanistic study, not a concentration intended to reproduce circulating in vivo levels. Together with our in vitro findings, these consistent results support β-HB as a potential metabolic mediator of the tumor suppression associated with dietary ketosis in NPC.

Notably, mice in both the alternate-day fasting and ketogenic diet groups exhibited a gradual decline in body weight during the study period. Because this study did not include exogenous β-HB administration under normal feeding, the independent effects of β-HB could not be clearly separated from those of weight loss, altered energy balance, and other diet-induced metabolic changes. Nevertheless, the consistent tumor-suppressive phenotype across two independent ketosis-inducing interventions strengthens the association between dietary ketosis and tumor suppression, though it does not establish β-HB as the sole mediator. Consistent with this interpretation, previous studies have shown that fasting cycles can retard tumor growth through fasting-associated metabolic changes rather than sustained weight loss per se^[33]. Moreover, ketogenesis triggered by intermittent fasting has been reported to exert tumor suppression, at least in part via mechanisms linked to β-HB^[34]. Similarly, ketogenic diets suppressed colorectal cancer tumor growth in animal models, and this tumor suppression was reproduced by β-HB supplementation under standard diet conditions^[20]. However, ketogenic or fasting-based interventions do not have antitumor effects in all tumor types. Previous studies suggest that the biological consequences of intermittent fasting may vary according to tumor subtype, host metabolic context, and broader systemic networks, including microbiota–metabolite interactions^[31,^35]. Therefore, although our findings support an association between dietary ketosis and tumor suppression in the NPC PDX model, the overall impact of ketogenic interventions in cancer is likely to be context-dependent and mechanistically complex.

An additional NPC-specific exploratory finding was that β-HB appeared to be associated with altered EBV-related transcriptional programs. In EBV-positive NPC cells, β-HB significantly upregulated the immediate-early lytic genes (BZLF1 and BRLF1), two master regulators of the latent-to-lytic switch in EBV^[36,^37]. However, EBV copy number was not significantly increased within the 48-hour treatment period, suggesting that short-term β-HB exposure may be sufficient to initiate early lytic gene expression, but insufficient to induce measurable viral DNA amplification. In vivo, tumors from fasting-treated mice bearing the EBV-positive PDX model showed stronger EBER in situ hybridization signals and a higher proportion of EBER-positive cells, although without statistical significance. Together, these results suggest that elevated β-HB or fasting-induced ketosis may affect EBV-related transcription in NPC, although the in vivo evidence remains inconclusive.

This observation is biologically plausible, given that β-HB is a well-characterized endogenous HDAC inhibitor^[18], and that HDAC inhibition is a recognized trigger of EBV lytic gene expression^[38,^39]. In addition, metabolite-mediated epigenetic changes, such as those induced by sodium butyrate, have been reported to modulate the EBV latent-to-lytic switch^[40]. Given that β-HB also promoted apoptosis in our model, it is possible that these EBV-related changes may coexist with, or potentially contribute to, the pro-death response induced by β-HB. However, this possibility remains speculative and warrants further investigation.

These findings should be interpreted with caution. The differences between the in vitro and in vivo observations may reflect differences in exposure duration and biological context, and the present study did not assess definitive markers of productive EBV lytic replication. Therefore, we cannot conclude that β-HB induces productive EBV lytic reactivation, and the EBV-related findings should be regarded as exploratory rather than mechanistic.

Even with these caveats, the present study offers several features that may advance current understanding of β-HB biology in NPC. Instead of relying exclusively on target prediction, we integrated network pharmacology, molecular docking, functional in vitro assays, pharmacological inhibition, siRNA knockdown, and in vivo analysis to support β-HB-induced caspase-3-associated apoptosis in NPC. These complementary approaches provide stronger functional evidence than is typically presented in purely descriptive network pharmacology studies. The two independent PDX experiments reinforce the study by showing a reproducible tumor-suppressive effect across two distinct ketosis-inducing interventions. In addition, the finding that β-HB induces EBV immediate-early lytic gene expression suggests a previously underappreciated link between ketone body metabolism and EBV-associated transcriptional programs in NPC. Although exploratory, this finding expands the biological context of β-HB action in NPC and may inform future studies on the intersection of metabolic regulation and EBV-associated tumor biology.

Despite these strengths, this study has several limitations. Total caspase-3 could not be reliably quantified alongside cleaved caspase-3, so the cleaved-to-total caspase-3 ratio was not determined. Moreover, molecular docking remains hypothesis-generating, and direct target-engagement studies, including surface plasmon resonance (SPR) and cellular thermal shift assay (CETSA), will be required to distinguish direct CASP3 engagement from indirect activation through upstream apoptotic pathways. In vivo, both alternate-day fasting and the ketogenic diet suppressed tumor growth and increased apoptosis, but caspase-3 activation in tumor tissues was not directly assessed, and a role for caloric restriction cannot be excluded. In addition, the EBV-related findings remain exploratory, as the mechanism underlying the increased EBER signal was not clarified, latent versus lytic EBV programs were not comprehensively distinguished, and definitive markers of productive lytic replication were not evaluated. This context dependence of fasting- and diet-based interventions across tumor types and host metabolic settings has also been emphasized in prior reviews^[41,^42].

5 Conclusion

In conclusion, β-HB exhibits clear antitumor effects in NPC. Network analysis identified CASP3 as one of five apoptosis-associated hubs, and evidence from caspase-3 enzymatic activity, cleaved caspase-3, pharmacological inhibition, and siRNA silencing indicates an important but non-exclusive role for caspase-3. In vivo, alternate-day fasting and a ketogenic diet suppressed NPC C17 PDX tumor growth while increasing circulating and tissue ketone or β-HB levels, implicating β-HB as a potential metabolic mediator rather than the sole cause of the observed tumor suppression. Additionally, β-HB promoted EBV immediate-early lytic gene expression (BZLF1 and BRLF1) in EBV-positive NPC cells, while a nonsignificant trend toward increased EBER positivity was observed in fasting-treated tumors. These exploratory findings suggest that β-HB may influence EBV latency in NPC. Overall, these findings provide experimental support for ketone metabolism–based interventions as a potential adjunctive strategy for NPC treatment.

References

[1] Tao Q , Chan AT . Nasopharyngeal carcinoma: molecular pathogenesis and therapeutic developments. Expert Rev Mol Med, 2007, 9(12): 1–24

[2] Su ZY , Siak PY , Lwin YY , Cheah SC . Epidemiology of nasopharyngeal carcinoma: current insights and future outlook. Cancer Metastasis Rev, 2024, 43((3)): 919–939

[3] Chen YP , Chan ATC , Le QT , Blanchard P , Sun Y , Ma J. . Nasopharyngeal carcinoma.. Lancet, 2019,, 394(10192): 64–80

[4] Su ZY , Siak PY , Leong CO , Cheah SC . The role of Epstein-Barr virus in nasopharyngeal carcinoma. Front Microbiol, .,

[5] Sun XS , Li XY , Chen QY , Tang LQ , Mai HQ. . Future of Radiotherapy in Nasopharyngeal Carcinoma.. Br J Radio,, 2019,, 92(1102): 20190209

[6] Liu X , Shen H , Zhang L , Huang W , Zhang S , Zhang B . Immunotherapy for recurrent or metastatic nasopharyngeal carcinoma. NPJ Precis Oncol, 2024, 8(1): 101

[7] Mai HQ , Chen QY , Chen D . et al. Toripalimab Plus Chemotherapy for Recurrent or Metastatic Nasopharyngeal Carcinoma: The JUPITER-02 Randomized Clinical Trial.. JAMA, 2023, 330(20): 1961–1970

[8] Hanahan D . Hallmarks of Cancer: New Dimensions. Cancer Discov, 2022, 12(1): 31–46

[9] Pavlova NN , Zhu J , Thompson CB . The hallmarks of cancer metabolism: Still emerging. Cell Metab, 2022, 34(3): 355–377

[10] Wang H , Hu J , Zhou W , Qian A . Metabolic reprogramming in the pathogenesis and progression of nasopharyngeal carcinoma: molecular mechanisms and therapeutic implications. Am J Cancer Res, 2024, 14(8): 4049–4064

[11] Liu Q , Bode AM , Chen X , Luo X. . Metabolic reprogramming in nasopharyngeal carcinoma: Mechanisms and therapeutic opportunities.. Biochim Biophys Acta Rev Cancer,, 2023,, 1878(6): 189023

[12] Zhang J , Jia L , Liu T . et al. mTORC2-mediated PDHE1alpha nuclear translocation links EBV-LMP1 reprogrammed glucose metabolism to cancer metastasis in nasopharyngeal carcinoma.. Oncogene, 2019, 38(24): 4669–4684

[13] Yang T , You C , Meng S , Lai Z , Ai W , Zhang J . EBV Infection and Its Regulated Metabolic Reprogramming in Nasopharyngeal Tumorigenesis. Front Cell Infect Microbiol,, 2022, 12: 935205

[14] Zheng S , Matskova L , Zhou X . et al. Downregulation of adipose triglyceride lipase by EB viral-encoded LMP2A links lipid accumulation to increased migration in nasopharyngeal carcinoma.. Mol Oncol,, 2020,, 14(12): 3234–3252

[15] Lu Y , Zhou X , Zhao W . et al. Epigenetic Inactivation of Acetyl-CoA Acetyltransferase 1 Promotes the Proliferation and Metastasis in Nasopharyngeal Carcinoma by Blocking Ketogenesis. Front Oncol, 2021, 11: 667673

[16] Luo W , Qin L , Li B . et al. Inactivation of HMGCL promotes proliferation and metastasis of nasopharyngeal carcinoma by suppressing oxidative stress. Sci Rep, 2017, 7(1): 11954

[17] Newman JC , Verdin E . beta-Hydroxybutyrate: A Signaling Metabolite. Annu Rev Nutr, 2017, 37: 51–76

[18] Shimazu T , Hirschey MD , Newman J . et al. Suppression of oxidative stress by beta-hydroxybutyrate, an endogenous histone deacetylase inhibitor. Science, 2013, 339(6116): 211–214

[19] Youm YH , Nguyen KY , Grant RW . et al. The ketone metabolite beta-hydroxybutyrate blocks NLRP3 inflammasome-mediated inflammatory disease. Nat Med, 2015, 21(3): 263–269

[20] Dmitrieva-Posocco O , Wong AC , Lundgren P . et al. beta-Hydroxybutyrate suppresses colorectal cancer. Nature, 2022, 605(7908): 160–165

[21] Qin J , Huang X , Gou S . et al. Ketogenic diet reshapes cancer metabolism through lysine beta-hydroxybutyrylation.. Nat Metab,, 2024, 6(8): 1505–1528

[22] Huang Y , Ding J , Zhu Y . et al. beta-hydroxybutyrate, a ketone body, suppresses tumor growth, stemness, and invasive phenotypes in non-small cell lung cancer. Cancer Biol Ther, 2025, 26(1): 2516825

[23] Jiang W , Wang M , Wang J . et al. beta-Hydroxybutyrate promotes cancer metastasis through beta-hydroxybutyrylation-dependent stabilization of Snail.. Nat Commun,, 2025, 16(1): 6592

[24] Nogales C , Mamdouh ZM , List M , Kiel C , Casas AI , Schmidt H . Network pharmacology: curing causal mechanisms instead of treating symptoms. Trends Pharmacol Sci, 2022, 43(2): 136–150

[25] Porter AG , Janicke RU . Emerging roles of caspase-3 in apoptosis. Cell Death Differ, 1999, 6(2): 99–104

[26] Bolden JE , Shi W , Jankowski K . et al. HDAC inhibitors induce tumor-cell-selective pro-apoptotic transcriptional responses. Cell Death Dis, 2013, 4(2): e519

[27] Chang LK . Activation of the BRLF1 promoter and lytic cycle of Epstein-Barr virus by histone acetylation. Nucleic Acids Res, 2000, 28(20): 3918–3925

[28] Roohy F , Siri M , Kohansal K . et al. Targeting apoptosis and unfolded protein response: the impact of beta-hydroxybutyrate in clear cell renal cell carcinoma under glucose-deprived conditions. Mol Biol Rep, 2024, 51(1): 168

[29] Mikami D , Kobayashi M , Uwada J . et al. beta-Hydroxybutyrate enhances the cytotoxic effect of cisplatin via the inhibition of HDAC/survivin axis in human hepatocellular carcinoma cells. J Pharmacol Sci, 2020, 142(1): 1–8

[30] Cheng B , Yang X , Hou Z . et al. D-beta-hydroxybutyrate inhibits the apoptosis of PC12 cells induced by 6-OHDA in relation to up-regulating the ratio of Bcl-2/Bax mRNA. Auton Neurosci, 2007, 134(1-2): 38–44

[31] Clifton KK , Ma CX , Fontana L , Peterson LL . Intermittent fasting in the prevention and treatment of cancer. CA Cancer J Clin, 2021, 71(6): 527–546

[32] Otto C , Kaemmerer U , Illert B . et al. Growth of human gastric cancer cells in nude mice is delayed by a ketogenic diet supplemented with omega-3 fatty acids and medium-chain triglycerides. BMC Cancer, 2008, 8(1): 122

[33] Lee C , Raffaghello L , Brandhorst S . et al. Fasting cycles retard growth of tumors and sensitize a range of cancer cell types to chemotherapy. Sci Transl Med, 2012, 4(124): 124ra27

[34] Udumula MP , Singh H , Rashid F . et al. Intermittent fasting induced ketogenesis inhibits mouse epithelial ovarian cancer by promoting antitumor T cell response. iScience, 2023, 26(10): 107839

[35] Liu J , Shao N , Qiu H . et al. Intestinal microbiota: A bridge between intermittent fasting and tumors. Biomed Pharmacother, 2023, 167: 115484

[36] Kenney SC , Mertz JE . Regulation of the latent-lytic switch in Epstein-Barr virus. Semin Cancer Biol, 2014, 26: 60–68

[37] Ragoczy T , Heston L , Miller G . The Epstein-Barr virus Rta protein activates lytic cycle genes and can disrupt latency in B lymphocytes. J Virol, 1998, 72(10): 7978–7984

[38] Hui KF , Cheung AK , Choi CK . et al. Inhibition of class I histone deacetylases by romidepsin potently induces Epstein-Barr virus lytic cycle and mediates enhanced cell death with ganciclovir. Int J Cancer, 2016, 138(1): 125–136

[39] Countryman JK , Gradoville L , Miller G. . Histone hyperacetylation occurs on promoters of lytic cycle regulatory genes in Epstein-Barr virus-infected cell lines which are refractory to disruption of latency by histone deacetylase inhibitors.. J Virol, 2008, 82(10): 4706–4719

[40] Gorres KL , Daigle D , Mohanram S , Miller G. . Activation and repression of Epstein-Barr Virus and Kaposi's sarcoma-associated herpesvirus lytic cycles by short- and medium-chain fatty acids.. J Virol, 2014,, 88(14): 8028–8044

[41] Nencioni A , Caffa I , Cortellino S , Longo VD . Fasting and cancer: molecular mechanisms and clinical application. Nature Reviews Cancer, 2018, 18(11): 707–719

[42] Lien EC , Vander Heiden MG . A framework for examining how diet impacts tumour metabolism. Nature Reviews Cancer, 2019, 19(11): 651–661

Rights & permissions

The Author(s). This article is published by Higher Education Press at journal.hep.com.cn.
This is an open access article distributed under the Creative Commons Attribution License 4.0 (CC BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.