Please wait a minute...

Frontiers of Environmental Science & Engineering

Front. Environ. Sci. Eng.    2020, Vol. 14 Issue (4) : 67     https://doi.org/10.1007/s11783-020-1246-9
RESEARCH ARTICLE
Validation of Bacteroidales-based microbial source tracking markers for pig fecal pollution and their application in two rivers of North China
Youfen Xu, Zong Li, Ruyin Liu(), Hongxia Liang, Zhisheng Yu, Hongxun Zhang
College of Resources and Environment, University of Chinese Academy of Sciences, Beijing 100049, China
Download: PDF(348 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

• Pig feces is the predominant excrement produced by animal husbandry in China.

• The PF, Pig-1-BacTaqMan, and Pig-2-BacTaqMan MST assays showed better performance.

• The pig-specific MST assays can contribute to managing the pig fecal pollution.

In China, pig feces is the predominant source of excrement produced by animal husbandry. Improper use or direct discharge of pig feces can result in contamination of natural water systems. Microbial source tracking (MST) technology can identify the sources of fecal pollution in environmental water, and contribute to the management of pig fecal pollution by local environmental protection agencies. However, the accuracy of such assays can be context-dependent, and they have not been comprehensively evaluated under Chinese conditions. We aimed to compare the performance of five previously reported pig-specific MST assays (PF, Pig-Bac1SYBR, Pig-Bac2SYBR, Pig-1-BacTaqMan, and Pig-2-BacTaqMan, which are based on Bacteroidales 16S rRNA gene markers) and apply them in two rivers of North China. We collected a total of 173 fecal samples from pigs, cows, goats, chickens, humans, and horses across China. The PF assay optimized in this study showed outstanding qualitative performance and achieved 100% specificity and sensitivity. However, the two SYBR green qPCR assays (Pig-Bac1SYBR and Pig-Bac2SYBR) cross-reacted with most non-pig fecal samples. In contrast, both the Pig-1-BacTaqMan and Pig-2-BacTaqMan assays gave 100% specificity and sensitivity. Of these, the Pig-2-BacTaqMan assay showed higher reproducibility. Our results regarding the specificity of these pig-specific MST assays differ from those reported in Thailand, Japan, and America. Using the PF and Pig-2-BacTaqMan assays, a field test comparing the levels of pig fecal pollution in rivers near a pig farm before and after comprehensive environmental pollution governance indicated that pig fecal pollution was effectively controlled at this location.

Keywords Microbial source tracking      Pig fecal pollution      16S rRNA gene markers      Pig-specific Bacteroidales     
Corresponding Author(s): Ruyin Liu   
Issue Date: 17 April 2020
 Cite this article:   
Youfen Xu,Zong Li,Ruyin Liu, et al. Validation of Bacteroidales-based microbial source tracking markers for pig fecal pollution and their application in two rivers of North China[J]. Front. Environ. Sci. Eng., 2020, 14(4): 67.
 URL:  
http://journal.hep.com.cn/fese/EN/10.1007/s11783-020-1246-9
http://journal.hep.com.cn/fese/EN/Y2020/V14/I4/67
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Youfen Xu
Zong Li
Ruyin Liu
Hongxia Liang
Zhisheng Yu
Hongxun Zhang
Fig.1  Sampling locations for environmental waters.
Assay Primers or probes Sequence (5′– 3′) Final concentration Annealing temperature (°C) Amplicon size (bp)
PF (Bernhard and Field, 2000; Dick et al., 2005) PF163F GCGGATTAATACCGTATGA 1 mol/L 62 563
Bac708R CAATCGGAGTTCTTCGTG 1 mol/L
Pig-Bac1SYBR (Okabe et al., 2007) PS422F CGGGTTGTAAACTGCTTTTATGAAG 1 mol/L 62 150
Bac581R CGCTCCCTTTAAACCCAATAAA 1 mol/L
Pig-Bac2SYBR (Okabe et al., 2007) Bac41F TACAGGCTTAACACATGCAAGTCG 1 mol/L 62 150
PS183R CTCATACGGTATTAATCCGCCTTT 1 mol/L
Pig-1-BacTaqMan (Mieszkin et al., 2009) Bac32F AACGCTAGCTACAGGCTTAAC 0.2 mol/L 60 129
Bac108R CGGGCTATTCCTGACTATGGG 0.2 mol/L
Bac44p (FAM)ATCGAAGCTTGCTTTGATAGATGGCG(BHQ-1) 0.2 mol/L
Pig-2-BacTaqMan (Mieszkin et al., 2009) Bac41F2 GCATGAATTTAGCTTGCTAAATTTGAT 0.3 mol/L 60 116
Bac163R ACCTCATACGGTATTAATCCGC 0.3 mol/L
Bac113p (VIC)TCCACGGGATAGCC(NFQ-MGB) 0.2 mol/L
Tab.1  Sequences of primers and probes used for pig-specific Bacteroidales assays
Assay Number of samples showing positive results Specificity Sensitivity Accuracy
Organism of origin
Pigs
(n=80)
Cows
(n=23)
Goats
(n=25)
Chickens
(n=21)
Humans
(n=20)
Horses
(n=4)
PF 80 0 0 0 0 0 100% 100% 100%
Pig-Bac1 77 19 14 11 16 4 35% 96% 61%
Pig-Bac2 80 22 16 18 19 4 15% 100% 54%
Pig-1-Bac 80 0 0 0 0 0 100% 100% 100%
Pig-2-Bac 80 0 0 0 0 0 100% 100% 100%
Tab.2  Performance of pig-specific Bacteroidales assays for detecting fecal samples
Assays C0a (log10 GC/g wet feces) Mean Ctb %CVc
Pig-1-Bac 7.95±1.55 20.60 21.30
Pig-2-Bac 9.20±1.03 20.73 17.94
P value of t-test 0.074 (>0.05)
Tab.3  Quantitative comparison of Pig-1-BacTaqMan and Pig-2-BacTaqMan assays for analyzing pig fecal samples
Fig.2  Boxplot representation of pig-specific marker concentration in fecal samples detected by Pig-1-BacTaqMan and Pig-2-BacTaqMan assays.
PF assay(n= 3) Sampling sites
H-1 H-2 H-3 H-4 H-5 J-6 J-7
Number of positive samples 2 3 1 3 3 0 3
Intensity of target band + + + + + + + + + + + +
Tab.4  Qualitative PF assay for environmental water samples before environmental governance.
Fig.3  Boxplot representation of concentration of the marker Pig-2-Bac in environmental water samples before environmental governance.
1 A E Bernhard, K G Field (2000). A PCR assay to discriminate human and ruminant feces on the basis of host differences in Bacteroides-Prevotella genes encoding 16S rRNA. Applied and Environmental Microbiology, 66(10): 4571–4574
https://doi.org/10.1128/AEM.66.10.4571-4574.2000
2 A B Boehm, L C Van de Werfhorst, J F Griffith, P A Holden, J A Jay, O C Shanks, D Wang, S B Weisberg (2013). Performance of forty-one microbial source tracking methods: A twenty-seven lab evaluation study. Water Research, 47(18): 6812–6828
https://doi.org/10.1016/j.watres.2012.12.046
3 L K Dick, A E Bernhard, T J Brodeur, J W Santo Domingo, J M Simpson, S P Walters, K G Field (2005). Host distributions of uncultivated fecal Bacteroidales bacteria reveal genetic markers for fecal source identification. Applied and Environmental Microbiology, 71(6): 3184–3191
https://doi.org/10.1128/AEM.71.6.3184-3191.2005
4 S Dorai-Raj, J O Grady, E Colleran (2009). Specificity and sensitivity evaluation of novel and existing Bacteroidales and Bifidobacteria-specific PCR assays on feces and sewage samples and their application for microbial source tracking in Ireland. Water Research, 43(19): 4980–4988
https://doi.org/10.1016/j.watres.2009.08.050
5 B Fremaux, J Gritzfeld, T Boa, C K Yost (2009). Evaluation of host-specific Bacteroidales 16S rRNA gene markers as a complementary tool for detecting fecal pollution in a prairie watershed. Water Research, 43(19): 4838–4849
https://doi.org/10.1016/j.watres.2009.06.045
6 D Gao, Y Tao (2012). Current molecular biologic techniques for characterizing environmental microbial community. Frontiers of Environmental Science & Engineering, 6(1): 82–97
https://doi.org/10.1007/s11783-011-0306-6
7 M Gourmelon, M P Caprais, R Segura, C Le Mennec, S Lozach, J Y Piriou, A Rince (2007). Evaluation of two library-independent microbial source tracking methods to identify sources of fecal contamination in french estuaries. Applied and Environmental Microbiology, 73(15): 4857–4866
https://doi.org/10.1128/AEM.03003-06
8 H C Green, L K Dick, B Gilpin, M Samadpour, K G Field (2012). Genetic markers for rapid PCR-based identification of gull, Canada goose, duck, and chicken fecal contamination in water. Applied and Environmental Microbiology, 78(2): 503–510
https://doi.org/10.1128/AEM.05734-11
9 V J Harwood, C Staley, B D Badgley, K Borges, A Korajkic (2014). Microbial source tracking markers for detection of fecal contamination in environmental waters: Relationships between pathogens and human health outcomes. FEMS Microbiology Reviews, 38(1): 1–40
https://doi.org/10.1111/1574-6976.12031
10 C D Heaney, K Myers, S Wing, D Hall, D Baron, J R Stewart (2015). Source tracking swine fecal waste in surface water proximal to swine concentrated animal feeding operations. Science of the Total Environment, 511: 676–683
https://doi.org/10.1016/j.scitotenv.2014.12.062
11 Y Huang (2017). Current situation and development trend of pig industry in China. Livestock and Poultry Industry, 28(8): 102–104 (in Chinese)
12 B J Kildare, C M Leutenegger, B S McSwain, D G Bambic, V B Rajal, S Wuertz (2007). 16S rRNA-based assays for quantitative detection of universal, human-, cow-, and dog-specific fecal Bacteroidales: A Bayesian approach. Water Research, 41(16): 3701–3715
https://doi.org/10.1016/j.watres.2007.06.037
13 B A Layton, Y Cao, D L Ebentier, K Hanley, E Balleste, J Brandao, M Byappanahalli, R Converse, A H Farnleitner, J Gentry-Shields, M L Gidley, M Gourmelon, C S Lee, J Lee, S Lozach, T Madi, W G Meijer, R Noble, L Peed, G H Reischer, R Rodrigues, J B Rose, A Schriewer, C Sinigalliano, S Srinivasan, J Stewart, L C Van De Werfhorst, D Wang, R Whitman, S Wuertz, J Jay, P A Holden, A B Boehm, O Shanks, J F Griffith (2013). Performance of human fecal anaerobe-associated PCR-based assays in a multi-laboratory method evaluation study. Water Research, 47(18): 6897–6908
https://doi.org/10.1016/j.watres.2013.05.060
14 X Li, S Song (2018). Hazards and countermeasures of livestock manure pollution. Pollution Prevention Technique, 31(5): 86–90 (in Chinese)
15 B Malla, R Ghaju Shrestha, S Tandukar, D Bhandari, D Inoue, K Sei, Y Tanaka, J B Sherchand, E Haramoto (2018). Validation of host-specific Bacteroidales quantitative PCR assays and their application to microbial source tracking of drinking water sources in the Kathmandu Valley, Nepal. Journal of Applied Microbiology, 125(2): 609–619
https://doi.org/10.1111/jam.13884
16 M C Mattioli, A J Pickering, R J Gilsdorf, J Davis, A B Boehm (2013). Hands and water as vectors of diarrheal pathogens in Bagamoyo, Tanzania. Environmental Science & Technology, 47(1): 355–363
https://doi.org/10.1021/es303878d
17 S Mieszkin, J P Furet, G Corthier, M Gourmelon (2009). Estimation of pig fecal contamination in a river catchment by real-time PCR using two pig-specific Bacteroidales 16S rRNA genetic markers. Applied and Environmental Microbiology, 75(10): 3045–3054
https://doi.org/10.1128/AEM.02343-08
18 J P Nshimyimana, M C Cruz, R J Thompson, S Wuertz (2017). Bacteroidales markers for microbial source tracking in Southeast Asia. Water Research, 118: 239–248
https://doi.org/10.1016/j.watres.2017.04.027
19 M Odagiri, A Schriewer, K Hanley, S Wuertz, P R Misra, P Panigrahi, M W Jenkins (2015). Validation of Bacteroidales quantitative PCR assays targeting human and animal fecal contamination in the public and domestic domains in India. Science of the Total Environment, 502: 462–470
https://doi.org/10.1016/j.scitotenv.2014.09.040
20 S Okabe, N Okayama, O Savichtcheva, T Ito (2007). Quantification of host-specific Bacteroides-Prevotella 16S rRNA genetic markers for assessment of fecal pollution in freshwater. Applied Microbiology and Biotechnology, 74(4): 890–901
https://doi.org/10.1007/s00253-006-0714-x
21 C M Ridley, R C Jamieson, L Truelstrup Hansen, C K Yost, G S Bezanson (2014). Baseline and storm event monitoring of Bacteroidales marker concentrations and enteric pathogen presence in a rural Canadian watershed. Water Research, 60: 278–288
https://doi.org/10.1016/j.watres.2014.04.039
22 O C Shanks, K White, C A Kelty, S Hayes, M Sivaganesan, M Jenkins, M Varma, R A Haugland (2010). Performance assessment PCR-based assays targeting Bacteroidales genetic markers of bovine fecal pollution. Applied and Environmental Microbiology, 76(5): 1359–1366
https://doi.org/10.1128/AEM.02033-09
23 P Somnark, N Chyerochana, A Kongprajug, S Mongkolsuk, K Sirikanchana (2018a). PCR data and comparative performance of Bacteroidales microbial source tracking genetic markers. Data in Brief, 19: 156–169
https://doi.org/10.1016/j.dib.2018.04.129
24 P Somnark, N Chyerochana, S Mongkolsuk, K Sirikanchana (2018b). Performance evaluation of Bacteroidales genetic markers for human and animal microbial source tracking in tropical agricultural watersheds. Environmental Pollution, 236: 100–110
https://doi.org/10.1016/j.envpol.2018.01.052
25 US EPA (2016). Definition and procedure for the determination of the method detection limit. Available at the website of www.epa.gov/sites/production/files/2016-12
26 H Wang, L Jia, R Wu, J Wang, Z Ning (2014). Study on sensitivity and specificity of the Bacteroidales biomarkers for microbial source tracking in the Pearl River Delta region. China Environmental Science, 34(8): 2118–2125
27 G Wilkes, J Brassard, T A Edge, V Gannon, C C Jokinen, T H Jones, R Marti, N F Neumann, N J Ruecker, M Sunohara, E Topp, D R Lapen (2013). Coherence among different microbial source tracking markers in a small agricultural stream with or without livestock exclusion practices. Applied and Environmental Microbiology, 79(20): 6207–6219
https://doi.org/10.1128/AEM.01626-13
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed