Please wait a minute...

Frontiers of Environmental Science & Engineering

Front. Environ. Sci. Eng.    2019, Vol. 13 Issue (3) : 38     https://doi.org/10.1007/s11783-019-1124-5
RESEARCH ARTICLE
Degradation of extracellular genomic, plasmid DNA and specific antibiotic resistance genes by chlorination
Menglu Zhang1,2, Sheng Chen1,2, Xin Yu2, Peter Vikesland3(), Amy Pruden3()
1. Key Laboratory of Urban Environment and Health, Institute of Urban Environment, Chinese Academy of Sciences, Xiamen 361021, China
2. University of Chinese Academy of Science, Beijing 100049, China
3. Department of Civil and Environmental Engineering, Virginia Tech, Blacksburg, VA 24060, USA
Download: PDF(1008 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

Extracellular DNA structure damaged by chlorination was characterized.

Integrity of extracellular ARG genetic information after chlorination was determined.

Typical chlorine doses will likely effectively diminish extracellular DNA and ARGs.

Plasmid DNA/ARGs were less readily broken down than genomic DNA.

The Bioanalyzer methodology effectively documented damage incurred to DNA.

There is a need to improve understanding of the effect of chlorine disinfection on antibiotic resistance genes (ARGs) in order to advance relevant drinking water, wastewater, and reuse treatments. However, few studies have explicitly assessed the physical effects on the DNA. Here we examined the effects of free chlorine (1–20 mg Cl2/L) on extracellular genomic, plasmid DNA and select ARGs. Chlorination was found to decrease the fluorometric signal of extracellular genomic and plasmid DNA (ranging from 0.005 to 0.05 mg/mL) by 70%, relative to a no-chlorine control. Resulting DNA was further subject to a fragment analysis using a Bioanalyzer, indicating that chlorination resulted in fragmentation. Moreover, chlorine also effectively deactivated both chromosomal- and plasmid-borne ARGs, mecA and tetA, respectively. For concentrations >2 mg Cl2//L × 30 min, chlorine efficiently reduced the qPCR signal when the initial concentration of ARGs was 105 copies/mL or less. Notably, genomic DNA and mecA gene signals were more readily reduced by chlorine than the plasmid-borne tetA gene (by ~2 fold). Based on the results of qPCR with short (~200 bps) and long amplicons (~1200 bps), chlorination could destroy the integrity of ARGs, which likely reduces the possibility of natural transformation. Overall, our findings strongly illustrate that chlorination could be an effective method for inactivating extracellular chromosomal- and plasmid-borne DNA and ARGs.

Keywords Antibiotic resistance      Antibiotic resistance genes (ARGs)      Extracellular DNA/ARGs      Chlorination     
This article is part of themed collection: Environmental Antibiotics and Antibiotic Resistance (Xin Yu, Hui Li & Virender K. Sharma)
Corresponding Authors: Peter Vikesland,Amy Pruden   
Issue Date: 06 June 2019
 Cite this article:   
Menglu Zhang,Sheng Chen,Xin Yu, et al. Degradation of extracellular genomic, plasmid DNA and specific antibiotic resistance genes by chlorination[J]. Front. Environ. Sci. Eng., 2019, 13(3): 38.
 URL:  
http://journal.hep.com.cn/fese/EN/10.1007/s11783-019-1124-5
http://journal.hep.com.cn/fese/EN/Y2019/V13/I3/38
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Menglu Zhang
Sheng Chen
Xin Yu
Peter Vikesland
Amy Pruden
Primer TA(℃) Amplicon length (bps) Forward primer Reserve primer Reference
mecA-long 53.5 1018 CGCAACGTTCAATTT AAT TTT GTT AA CCACTTCATATCTTG TAA CG McKinney and Pruden (2012)
mecA-short 53.5 92 CGCAACGTTCAATTTAAT TGGTCTTTCTGGATTCCTGGA Volkmann et al. (2007)
tetA- long 56.5 1054 GTA ATT CTG AGC
ACT GTC GC
CAT AGA TCG CCG
TGA AGA GG
McKinney and Pruden (2012)
tetA-short 56.5 160 CATGCTCGGAATGATTGCCG CCTGACGTTCCTCATCCACC This study
Tab.1  Primers used in this study. TA means annealing temperature
Fig.1  Removal efficiency based on fluorometric quantification of extracellular genomic and plasmid DNA with increasing chlorine dose. (a) Genomic DNA; (b) First-order reaction kinetics of genomic DNA; (c) Plasmid DNA; (d) First-order reaction kinetics of plasmid DNA. The initial DNA concentration was 5 mg/mL for all experiments.
Chlorine concentration
(mg/L)
DNA concentration (mg/mL)
Genomic DNA Plasmid DNA
0.5 0.05 0.5 0.05 0.005
1 66.98±5.03 18.65±2.01 23.87±10.76 NA
2 64.04±5.78 22.17±11.95 38.74±7.65 NA
4 62.19±0.46 25.61±16.13 72.88±7.14 NA
20 98.09±2.70 40.85±13.73 NA NA
Tab.2  Chlorine removal efficiency of lower concentration extracellular DNA after 30 min contact time. All of the samples were conducted in triplicate
Fig.2  Range of genomic DNA fragment size after chlorination for 30 min: (a) 0.5 mg/mL; (b) 0.05 mg/mL.
Fig.3  Range of plasmid DNA fragment sizes after chlorination for 30 min: (a) 0.5 mg/mL; (b) 0.05 mg/mL.
DNA concentration
(mg/mL)
Number of mecA gene
(log10 copies/mL)
Number of tetA gene
(log10 copies/mL)
0.5 6.39±0.30 6.21±0.11
0.05 5.56±0.34 5.49±0.19
0.005 4.74±0.36 4.62±0.12
Tab.3  Corresponding gene copies for each DNA concentration. Gene copies were determined by qPCR with short amplicons, respectively. Each test was conducted in triplicate
Fig.4  Reduction in mecA short and long amplicon qPCR signal with increased chlorine dose applied for 30 min. Initial gene copy concentrations for experiments (a)–(f) are indicated the different initial DNA concentrations during chlorination: (a), (b) 0.5 mg/mL; (c), (d) 0.05 mg/mL; (e), (f) 0.005 mg/mL. Error bars represent standard deviation of experimental triplicates. Data below the qPCR detection limit is not plotted.
Fig.5  Reduction in tetA short and long amplicon qPCR signal with increased chlorine dose applied for 30 min. Initial gene copy concentrations for experiments (a)–(f) are indicated the different initial DNA concentrations during chlorination: (a), (b) 0.5 mg/mL; (c), (d) 0.05 mg/mL; (e), (f) 0.005 mg/mL. Error bars represent standard deviation of experimental triplicates. Data below the qPCR detection limit is not plotted.
1 J Bae, E Oh, B Jeon (2014). Enhanced transmission of antibiotic resistance in Campylobacter jejuni biofilms by natural transformation. Antimicrobial Agents and Chemotherapy, 58(12): 7573–7575
https://doi.org/10.1128/AAC.04066-14 pmid: 25267685
2 T J Beebee (1991). Analysis, purification and quantification of extracellular DNA from aquatic environments. Freshwater Biology, 25(3): 525–532
https://doi.org/10.1111/j.1365-2427.1991.tb01395.x
3 X Bellanger, H Guilloteau, S Bonot, C Merlin (2014). Demonstrating plasmid-based horizontal gene transfer in complex environmental matrices: A practical approach for a critical review. Science of the Total Environment, 493: 872–882
https://doi.org/10.1016/j.scitotenv.2014.06.070 pmid: 25000583
4 S Bergeron, R Boopathy, R Nathaniel, A Corbin, G LaFleur (2015). Presence of antibiotic resistant bacteria and antibiotic resistance genes in raw source water and treated drinking water. International Biodeterioration & Biodegradation, 102: 370–374
https://doi.org/10.1016/j.ibiod.2015.04.017
5 F Bertolla, P Simonet (1999). Horizontal gene transfers in the environment: natural transformation as a putative process for gene transfers between transgenic plants and microorganisms. Research in Microbiology, 150(6): 375–384
https://doi.org/10.1016/S0923-2508(99)80072-2 pmid: 10466405
6 F Bichai, B Barbeau, Y Dullemont, W Hijnen (2010). Role of predation by zooplankton in transport and fate of protozoan (oo)cysts in granular activated carbon filtration. Water Research, 44(4): 1072–1081
https://doi.org/10.1016/j.watres.2009.09.001 pmid: 19853879
7 M Blokesch (2016). Natural competence for transformation. Current Biology, 26(21): R1126–R1130
https://doi.org/10.1016/j.cub.2016.08.058 pmid: 27825443
8 G Bukholm, T Tannaes, A B B Kjelsberg, N Smith-Erichsen (2002). An outbreak of multidrug-resistant Pseudomonas aeruginosa associated with increased risk of patient death in an intensive care unit. Infection Control and Hospital Epidemiology, 23(08): 441–446
https://doi.org/10.1086/502082 pmid: 12186209
9 C J Burrows, J G Muller (1998). Oxidative nucleobase modifications leading to strand scission. Chemical Reviews, 98(3): 1109–1152
https://doi.org/10.1021/cr960421s pmid: 11848927
10 P H Chang, B Juhrend, T M Olson, C F Marrs, K R Wigginton (2017). Degradation of extracellular antibiotic resistance genes with UV254 treatment. Environmental Science & Technology, 51(11): 6185–6192
https://doi.org/10.1021/acs.est.7b01120 pmid: 28475324
11 R C Clowes (1972). Molecular structure of bacterial plasmids. Bacteriological Reviews, 36(3): 361–405
pmid: 4345849
12 E C Coniey, V A Saunders, J R Saunders (1986). Deletion and rearrangement of plasmid DNA during transformation of Escherichia coli with linear plasmid molecules. Nucleic Acids Research, 14(22): 8905–8917
https://doi.org/10.1093/nar/14.22.8905 pmid: 3024124
13 G F Craun (2018). Waterborne Diseases in the US. Boca Raton, FL: CRC Press
https://doi.org/10.1201/9781351077668
14 O K Dalrymple, E Stefanakos, M A Trotz, D Y Goswami (2010). A review of the mechanisms and modeling of photocatalytic disinfection. Applied Catalysis B: Environmental, 98(1–2): 27–38
https://doi.org/10.1016/j.apcatb.2010.05.001
15 J Davison (1999). Genetic exchange between bacteria in the environment. Plasmid, 42(2): 73–91
https://doi.org/10.1006/plas.1999.1421 pmid: 10489325
16 F de la Cruz, J Davies (2000). Horizontal gene transfer and the origin of species: Lessons from bacteria. Trends in Microbiology, 8(3): 128–133
https://doi.org/10.1016/S0966-842X(00)01703-0 pmid: 10707066
17 G del Solar, R Giraldo, M J Ruiz-Echevarría, M Espinosa, R Díaz-Orejas (1998). Replication and control of circular bacterial plasmids. Microbiology and Molecular Biology Reviews, 62(2): 434–464
pmid: 9618448
18 B A Diep, S R Gill, R F Chang, T H Phan, J H Chen, M G Davidson, F Lin, J Lin, H A Carleton, E F Mongodin, G F Sensabaugh, F Perdreau-Remington (2006). Complete genome sequence of USA300, an epidemic clone of community-acquired meticillin-resistant Staphylococcus aureus. Lancet, 367(9512): 731–739
https://doi.org/10.1016/S0140-6736(06)68231-7 pmid: 16517273
19 M C Dodd (2012). Potential impacts of disinfection processes on elimination and deactivation of antibiotic resistance genes during water and wastewater treatment. Journal of Environmental Monitoring, 14(7): 1754–1771
https://doi.org/10.1039/c2em00006g pmid: 22572858
20 S Dukan, D Touati (1996). Hypochlorous acid stress in Escherichia coli: Resistance, DNA damage, and comparison with hydrogen peroxide stress. Journal of Bacteriology, 178(21): 6145–6150
https://doi.org/10.1128/jb.178.21.6145-6150.1996 pmid: 8892812
21 A C Eischeid, J N Meyer, K G Linden (2009). UV disinfection of adenoviruses: Molecular indications of DNA damage efficiency. Applied and Environmental Microbiology, 75(1): 23–28
https://doi.org/10.1128/AEM.02199-08 pmid: 18978087
22 D M Fernando, H M Tun, J Poole, R Patidar, R Li, R Mi, G E A Amarawansha, W G D Fernando, E Khafipour, A Farenhorst, A Kumar (2016). Detection of antibiotic resistance genes in source and drinking water samples from a First Nations Community in Canada. Applied and Environmental Microbiology, 82(15): 4767–4775
https://doi.org/10.1128/AEM.00798-16 pmid: 27235436
23 S Fleige, M W Pfaffl (2006). RNA integrity and the effect on the real-time qRT-PCR performance. Molecular Aspects of Medicine, 27(2–3): 126–139
https://doi.org/10.1016/j.mam.2005.12.003 pmid: 16469371
24 C N Freeman, L Scriver, K D Neudorf, L Truelstrup Hansen, R C Jamieson, C K Yost (2018). Antimicrobial resistance gene surveillance in the receiving waters of an upgraded wastewater treatment plant. FACETS, 3(1): 128–138
https://doi.org/10.1139/facets-2017-0085
25 W F Fricke, M S Wright, A H Lindell, D M Harkins, C Baker-Austin, J Ravel, R Stepanauskas (2008). Insights into the environmental resistance gene pool from the genome sequence of the multidrug-resistant environmental isolate Escherichia coli SMS-3-5. Journal of Bacteriology, 190(20): 6779–6794
https://doi.org/10.1128/JB.00661-08 pmid: 18708504
26 M E Frischer, G J Stewart, J H Paul (1994). Plasmid transfer to indigenous marine bacterial populations by natural transformation. FEMS Microbiology Ecology, 15(1–2): 127–135
https://doi.org/10.1111/j.1574-6941.1994.tb00237.x
27 E Harrison, M A Brockhurst (2012). Plasmid-mediated horizontal gene transfer is a coevolutionary process. Trends in Microbiology, 20(6): 262–267
https://doi.org/10.1016/j.tim.2012.04.003 pmid: 22564249
28 C L Hawkins, M J Davies (2002). Hypochlorite-induced damage to DNA, RNA, and polynucleotides: Formation of chloramines and nitrogen-centered radicals. Chemical Research in Toxicology, 15(1): 83–92
https://doi.org/10.1021/tx015548d pmid: 11800600
29 K J Howe, J C Crittenden, D W Hand, R R Trussell, G Tchobanoglous (2012). Principles of Water Treatment. Hoboken, NJ: John Wiley & Sons
30 J J Huang, H Y Hu, Y H Wu, B Wei, Y Lu (2013). Effect of chlorination and ultraviolet disinfection on tetA-mediated tetracycline resistance of Escherichia coli. Chemosphere, 90(8): 2247–2253
https://doi.org/10.1016/j.chemosphere.2012.10.008 pmid: 23123077
31 S Jia, P Shi, Q Hu, B Li, T Zhang, X X Zhang (2015). Bacterial community shift drives antibiotic resistance promotion during drinking water chlorination. Environmental Science & Technology, 49(20): 12271–12279
https://doi.org/10.1021/acs.est.5b03521 pmid: 26397118
32 L Jiang, X Hu, T Xu, H Zhang, D Sheng, D Yin (2013). Prevalence of antibiotic resistance genes and their relationship with antibiotics in the Huangpu River and the drinking water sources, Shanghai, China. Science of the Total Environment, 458– 460: 267–272
https://doi.org/10.1016/j.scitotenv.2013.04.038 pmid: 23664984
33 X Jiang, M M H Ellabaan, P Charusanti, C Munck, K Blin, Y Tong, T Weber, M O A Sommer, S Y Lee (2017). Dissemination of antibiotic resistance genes from antibiotic producers to pathogens. Nature Communications, 8: 15784
https://doi.org/10.1038/ncomms15784 pmid: 28589945
34 P Kulkarni, N D Olson, J N Paulson, M Pop, C Maddox, E Claye, R E Rosenberg Goldstein, M Sharma, S G Gibbs, E F Mongodin, A R Sapkota (2018). Conventional wastewater treatment and reuse site practices modify bacterial community structure but do not eliminate some opportunistic pathogens in reclaimed water. Science of the Total Environment, 639: 1126–1137
https://doi.org/10.1016/j.scitotenv.2018.05.178 pmid: 29929281
35 H Y Lau, N J Ashbolt (2009). The role of biofilms and protozoa in Legionella pathogenesis: Implications for drinking water. Journal of Applied Microbiology, 107(2): 368–378
https://doi.org/10.1111/j.1365-2672.2009.04208.x pmid: 19302312
36 L S Lerman, L J Tolmach (1959). Genetic transformation. II. The significance of damage to the DNA molecule. Biochimica et Biophysica Acta, 33(2): 371–387
https://doi.org/10.1016/0006-3002(59)90127-1 pmid: 13670908
37 Y H Li, P C Lau, J H Lee, R P Ellen, D G Cvitkovitch (2001). Natural genetic transformation of Streptococcus mutans growing in biofilms. Journal of Bacteriology, 183(3): 897–908
https://doi.org/10.1128/JB.183.3.897-908.2001 pmid: 11208787
38 Q Liu, M Li, X Liu, Q Zhang, R Liu, Z Wang, X Shi, J Quan, X Shen, F Zhang (2018a). Removal of sulfamethoxazole and trimethoprim from reclaimed water and the biodegradation mechanism. Frontiers of Environmental Science & Engineering, 12(6): 6
https://doi.org/10.1007/s11783-018-1048-5
39 S S Liu, H M Qu, D Yang, H Hu, W L Liu, Z G Qiu, A M Hou, J Guo, J W Li, Z Q Shen, M Jin (2018b). Chlorine disinfection increases both intracellular and extracellular antibiotic resistance genes in a full-scale wastewater treatment plant. Water Research, 136: 131–136
https://doi.org/10.1016/j.watres.2018.02.036 pmid: 29501757
40 M G Lorenz, W Wackernagel (1994). Bacterial gene transfer by natural genetic transformation in the environment. Microbiological Reviews, 58(3): 563–602
pmid: 7968924
41 A Masotti, T Preckel (2006). Analysis of small RNAs with the Agilent 2100 Bioanalyzer. Nature Methods, 3(8): 658
https://doi.org/10.1038/nmeth908
42 C W McKinney, K A Loftin, M T Meyer, J G Davis, A Pruden (2010). tet and sul antibiotic resistance genes in livestock lagoons of various operation type, configuration, and antibiotic occurrence. Environmental Science & Technology, 44(16): 6102–6109
https://doi.org/10.1021/es9038165 pmid: 20704205
43 C W McKinney, A Pruden (2012). Ultraviolet disinfection of antibiotic resistant bacteria and their antibiotic resistance genes in water and wastewater. Environmental Science & Technology, 46(24): 13393–13400
https://doi.org/10.1021/es303652q pmid: 23153396
44 J W Metch, Y Ma, A Pruden, P J Vikesland (2015). Enhanced disinfection by-product formation due to nanoparticles in wastewater treatment plant effluents. Environmental Science. Water Research & Technology, 1(6): 823–831
https://doi.org/10.1039/C5EW00114E
45 N B Öncü, Y Z Menceloğlu, I A Balcıoğlu (2011). Comparison of the effectiveness of chlorine, ozone, and photocatalytic disinfection in reducing the risk of antibiotic resistance pollution. Journal of Advanced Oxidation Technologies, 14(2): 196–203
https://doi.org/10.1515/jaots-2011-0203
46 J Park, W Park (2011). Phenotypic and physiological changes in Acinetobacter sp. strain DR1 with exogenous plasmid. Current Microbiology, 62(1): 249–254
https://doi.org/10.1007/s00284-010-9698-y pmid: 20607540
47 B M Pecson, M Ackermann, T Kohn (2011). Framework for using quantitative PCR as a nonculture based method to estimate virus infectivity. Environmental Science & Technology, 45(6): 2257–2263
https://doi.org/10.1021/es103488e pmid: 21322644
48 A J Pinto, C Xi, L Raskin (2012). Bacterial community structure in the drinking water microbiome is governed by filtration processes. Environmental Science & Technology, 46(16): 8851–8859
https://doi.org/10.1021/es302042t pmid: 22793041
49 W A Prütz (1996). Hypochlorous acid interactions with thiols, nucleotides, DNA, and other biological substrates. Archives of Biochemistry and Biophysics, 332(1): 110–120
https://doi.org/10.1006/abbi.1996.0322 pmid: 8806715
50 W A Prütz (1998). Interactions of hypochlorous acid with pyrimidine nucleotides, and secondary reactions of chlorinated pyrimidines with GSH, NADH, and other substrates. Archives of Biochemistry and Biophysics, 349(1): 183–191
https://doi.org/10.1006/abbi.1997.0440 pmid: 9439597
51 E Sanganyado, W Gwenzi (2019). Antibiotic resistance in drinking water systems: Occurrence, removal, and human health risks. Science of the Total Environment, 669: 785–797
https://doi.org/10.1016/j.scitotenv.2019.03.162 pmid: 30897437
52 A D Shah, Z Q Liu, E Salhi, T Höfer, B Werschkun, U Von Gunten (2015). Formation of disinfection by-products during ballast water treatment with ozone, chlorine, and peracetic acid: Influence of water quality parameters. Environmental Science. Water Research & Technology, 1(4): 465–480
https://doi.org/10.1039/C5EW00061K
53 S Sinha, R J Redfield (2012). Natural DNA uptake by Escherichia coli. PLoS One, 7(4): e35620
https://doi.org/10.1371/journal.pone.0035620 pmid: 22532864
54 A Srinivasan, H J Lehmler, L W Robertson, G Ludewig (2001). Production of DNA strand breaks in vitro and reactive oxygen species in vitro and in HL-60 cells by PCB metabolites. Toxicological Sciences, 60(1): 92–102
https://doi.org/10.1093/toxsci/60.1.92 pmid: 11222876
55 H C Su, Y S Liu, C G Pan, J Chen, L Y He, G G Ying (2018). Persistence of antibiotic resistance genes and bacterial community changes in drinking water treatment system: From drinking water source to tap water. Science of the Total Environment, 616– 617: 453–461
https://doi.org/10.1016/j.scitotenv.2017.10.318 pmid: 29127799
56 C Suquet, J J Warren, N Seth, J K Hurst (2010). Comparative study of HOCl-inflicted damage to bacterial DNA ex vivo and within cells. Archives of Biochemistry and Biophysics, 493(2): 135–142
https://doi.org/10.1016/j.abb.2009.10.006 pmid: 19850004
57 C M Thomas, K M Nielsen (2005). Mechanisms of, and barriers to, horizontal gene transfer between bacteria. Nature Reviews. Microbiology, 3(9): 711–721
https://doi.org/10.1038/nrmicro1234 pmid: 16138099
58 J M Thomas, N J Ashbolt (2011). Do free-living amoebae in treated drinking water systems present an emerging health risk? Environmental Science & Technology, 45(3): 860–869
https://doi.org/10.1021/es102876y pmid: 21194220
59 A Tornevi, M Simonsson, B Forsberg, M Säve-Söderbergh, J Toljander (2016). Efficacy of water treatment processes and endemic gastrointestinal illness: A multi-city study in Sweden. Water Research, 102: 263–270
https://doi.org/10.1016/j.watres.2016.06.018 pmid: 27362446
60 H Volkmann, T Schwartz, S Kirchen, C Stofer, U Obst (2007). Evaluation of inhibition and cross-reaction effects on real-time PCR applied to the total DNA of wastewater samples for the quantification of bacterial antibiotic resistance genes and taxon-specific targets. Molecular and Cellular Probes, 21(2): 125–133
https://doi.org/10.1016/j.mcp.2006.08.009 pmid: 17056226
61 G Wen, X Xu, T Huang, H Zhu, J Ma (2017). Inactivation of three genera of dominant fungal spores in groundwater using chlorine dioxide: Effectiveness, influencing factors, and mechanisms. Water Research, 125: 132–140
https://doi.org/10.1016/j.watres.2017.08.038 pmid: 28843153
62 L Xu, W Ouyang, Y Qian, C Su, J Su, H Chen (2016). High-throughput profiling of antibiotic resistance genes in drinking water treatment plants and distribution systems. Environmental Pollution, 213: 119–126
https://doi.org/10.1016/j.envpol.2016.02.013 pmid: 26890482
63 L Xu, C Zhang, P Xu, X C Wang (2017). Mechanisms of ultraviolet disinfection and chlorination of Escherichia coli: Culturability, membrane permeability, metabolism, and genetic damage. Journal of Environmental Sciences-China, 65: 356–366
https://doi.org/10.1016/j.jes.2017.07.006 pmid: 29548407
64 Y Yoon, M C Dodd, Y Lee (2018). Elimination of transforming activity and gene degradation during UV and UV/H2O2 treatment of plasmid-encoded antibiotic resistance genes. Environmental Science: Water Research & Technology, 4(9): 1239–1251
https://doi.org/10.1039/C8EW00200B
65 Q B Yuan, M T Guo, J Yang (2015). Fate of antibiotic resistant bacteria and genes during wastewater chlorination: Implication for antibiotic resistance control. PLoS One, 10(3): e0119403
https://doi.org/10.1371/journal.pone.0119403 pmid: 25738838
66 T Zhang, Y Hu, L Jiang, S Yao, K Lin, Y Zhou, C Cui (2019). Removal of antibiotic resistance genes and control of horizontal transfer risk by UV, chlorination and UV/chlorination treatments of drinking water. Chemical Engineering Journal, 358: 589–597
https://doi.org/10.1016/j.cej.2018.09.218
67 X Zhang, B Wu, Y Zhang, T Zhang, L Yang, H H P Fang, T Ford, S Cheng (2009a). Class 1 integronase gene and tetracycline resistance genes tetA and tetC in different water environments of Jiangsu Province, China. Ecotoxicology (London, England), 18(6): 652–660
https://doi.org/10.1007/s10646-009-0332-3 pmid: 19495963
68 X Zhang, T Zhang, H H Fang(2009b). Antibiotic resistance genes in water environment. Applied Microbiology and Biotechnology, 82(3): 397–414
https://doi.org/10.1007/s00253-008-1829-z
Related articles from Frontiers Journals
[1] Lian Yang, Qinxue Wen, Zhiqiang Chen, Ran Duan, Pan Yang. Impacts of advanced treatment processes on elimination of antibiotic resistance genes in a municipal wastewater treatment plant[J]. Front. Environ. Sci. Eng., 2019, 13(3): 32-.
[2] Qiaowen Tan, Weiying Li, Junpeng Zhang, Wei Zhou, Jiping Chen, Yue Li, Jie Ma. Presence, dissemination and removal of antibiotic resistant bacteria and antibiotic resistance genes in urban drinking water system: A review[J]. Front. Environ. Sci. Eng., 2019, 13(3): 36-.
[3] Virender K. Sharma, Xin Yu, Thomas J. McDonald, Chetan Jinadatha, Dionysios D. Dionysiou, Mingbao Feng. Elimination of antibiotic resistance genes and control of horizontal transfer risk by UV-based treatment of drinking water: A mini review[J]. Front. Environ. Sci. Eng., 2019, 13(3): 37-.
[4] Yangyang Yu, Xiaolin Zhu, Guanlan Wu, Chengzhi Wang, Xing Yuan. Analysis of antibiotic resistance of Escherichia coli isolated from the Yitong River in North-east China[J]. Front. Environ. Sci. Eng., 2019, 13(3): 39-.
[5] Monika Nowrotek, Łukasz Jałowiecki, Monika Harnisz, Grażyna Anna Płaza. Culturomics and metagenomics: In understanding of environmental resistome[J]. Front. Environ. Sci. Eng., 2019, 13(3): 40-.
[6] Gastón Azziz, Matías Giménez, Héctor Romero, Patricia M. Valdespino-Castillo, Luisa I. Falcón, Lucas A. M. Ruberto, Walter P. Mac Cormack, Silvia Batista. Detection of presumed genes encoding beta-lactamases by sequence based screening of metagenomes derived from Antarctic microbial mats[J]. Front. Environ. Sci. Eng., 2019, 13(3): 44-.
[7] Xuan Zhu, Chengsong Ye, Yuxin Wang, Lihua Chen, Lin Feng. Assessment of antibiotic resistance genes in dialysis water treatment processes[J]. Front. Environ. Sci. Eng., 2019, 13(3): 45-.
[8] Lifeng Cao, Weihua Sun, Yuting Zhang, Shimin Feng, Jinyun Dong, Yongming Zhang, Bruce E. Rittmann. Competition for electrons between reductive dechlorination and denitrification[J]. Front. Environ. Sci. Eng., 2017, 11(6): 14-.
[9] Yu Liu, Qiao Zhang, Yu Hong. Formation of disinfection byproducts from accumulated soluble products of oleaginous microalga after chlorination[J]. Front. Environ. Sci. Eng., 2017, 11(6): 1-.
[10] Dawei Liang, Shanquan Wang. Development and characterization of an anaerobic microcosm for reductive dechlorination of PCBs[J]. Front. Environ. Sci. Eng., 2017, 11(6): 2-.
[11] Yuchen PANG,Jingjing HUANG,Jinying XI,Hongying HU,Yun ZHU. Effect of ultraviolet irradiation and chlorination on ampicillin-resistant Escherichia coli and its ampicillin resistance gene[J]. Front. Environ. Sci. Eng., 2016, 10(3): 522-530.
[12] Jiangkun DU,Jianguo BAO,Wei HU. Efficient dechlorination of 2,4-dichlorophenol in an aqueous media with a mild pH using a Pd/TiO2NTs/Ti cathode[J]. Front. Environ. Sci. Eng., 2015, 9(5): 919-928.
[13] Bhanukiran SUNKARA,Yang SU,Jingjing ZHAN,Jibao HE,Gary L. MCPHERSON,Vijay T. JOHN. Iron-carbon composite microspheres prepared through a facile aerosol-based process for the simultaneous adsorption and reduction of chlorinated hydrocarbons[J]. Front. Environ. Sci. Eng., 2015, 9(5): 939-947.
[14] Man ZHANG,Feng HE,Dongye ZHAO. Catalytic activity of noble metal nanoparticles toward hydrodechlorination: influence of catalyst electronic structure and nature of adsorption[J]. Front. Environ. Sci. Eng., 2015, 9(5): 888-896.
[15] Xiaomao WANG,Garcia Leal M I,Xiaolu ZHANG,Hongwei YANG,Yuefeng XIE. Haloacetic acids in swimming pool and spa water in the United States and China[J]. Front. Environ. Sci. Eng., 2014, 8(6): 820-824.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed