Please wait a minute...

Frontiers of Environmental Science & Engineering

Front. Environ. Sci. Eng.    2017, Vol. 11 Issue (6) : 2     https://doi.org/10.1007/s11783-017-0939-1
RESEARCH ARTICLE
Development and characterization of an anaerobic microcosm for reductive dechlorination of PCBs
Dawei Liang1(), Shanquan Wang2
1. School of Space and Environment, Beihang University, Beijing 100083, China
2. School of Environmental Science and Engineering, Sun Yat-sen University, Guangzhou 510275, China
Download: PDF(1514 KB)   HTML
Export: BibTeX | EndNote | Reference Manager | ProCite | RefWorks
Abstract

A robust PCB-dechlorinating sediment-free enrichment culture is developed.

This enrichment culture can extensively dechlorinate a PCB mixture Aroclor 1260.

This culture effectively catalyzes major meta-PCBs dechlorination.

This study facilitates the exploration of PCB dechlorinators for bioremediation.

The toxic and recalcitrant polychlorinated biphenyls (PCBs) adversely affect human and biota by bioaccumulation and biomagnification through food chain. In this study, an anaerobic microcosm was developed to extensively dechlorinate hexa- and hepta-CBs in Aroclor 1260. After 4 months of incubation in defined mineral salts medium amended PCBs (70 mmol·L1) and lactate (10 mmol·L1), the culture dechlorinated hexa-CBs from 40.2% to 8.7% and hepta-CBs 33.6% to 11.6%, with dechlorination efficiencies of 78.3% and 65.5%, respectively (all in moL ratio). This dechlorination process led to tetra-CBs (46.4%) as the predominant dechlorination products, followed by penta- (22.1%) and tri-CBs (5.4%). The number of meta chlorines per biphenyl decreased from 2.50 to 1.41. Results of quantitative real-time PCR show that Dehalococcoides cells increased from 2.39 × 105±0.5 × 105 to 4.99 × 107±0.32 × 107 copies mL1 after 120 days of incubation, suggesting that Dehalococcoides play a major role in reductive dechlorination of PCBs. This study could prove the feasibility of anaerobic reductive culture enrichment for the dehalogenation of highly chlorinated PCBs, which is prior to be applied for in situ bioremediation of notorious halogenated compounds.

Keywords Polychlorinated biphenyls (PCBs)      Microbial reductive dechlorination      Dehalococcoides      Pathway     
Corresponding Author(s): Dawei Liang   
Issue Date: 10 May 2017
 Cite this article:   
Dawei Liang,Shanquan Wang. Development and characterization of an anaerobic microcosm for reductive dechlorination of PCBs[J]. Front. Environ. Sci. Eng., 2017, 11(6): 2.
 URL:  
http://journal.hep.com.cn/fese/EN/10.1007/s11783-017-0939-1
http://journal.hep.com.cn/fese/EN/Y2017/V11/I6/2
Service
E-mail this article
E-mail Alert
RSS
Articles by authors
Dawei Liang
Shanquan Wang
primersequence
(5′-3′)
targeting groupreferences
HC1FGATGAACGCTAGCGGCGDehalococcoides[]
DHC1377RGGTTGGCACATCGACTTCAA
BB1FAACCTTCGGGTCCTACTGTCDesulfomonas[]
BB1RGCCGAACTGACCCCTATGTT
Deb179FTGTATTGTCCGAGAGGCADehalobacter[]
Deb1007RACTCCCATATCTCTACGG
Dd1FAATACCGNATAAGCTTATCCCDesulfitobacterium[]
Dd1RTAGCGATTCCGACTTCATGTTC
Geo196FGAATATGCTCCTGATTCGeobacter lovleyi[]
Geo999RACCCTCTACTTTCATAG
14FAGAGTTTGATCCTGGCTCAGDF-1/o-17[]
Dehal1265RCCTATTGCTACCTGCTGTACC
341FGCCGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGG
GGGCCTACGGGAGGCAGCAG
Eubacteria
518RATTACCGCGGCTGCTGG
Chl348F/GCCGCCCGCCGCGCGCGG)GAGGCAGCAGCAAGGAAChloroflexi[]
Dehal884RGGCGGGACACTTAAAGCG
Tab.1  PCR primers and probes used in this study for 16S rRNA gene targeted different group of bacteria
Fig.1  PCB dechlorination profile of sediment-free enrichment culture GD1
Fig.2  PCB dechlorination profile of the sediment free enrichment culture GD1 according to the chlorine substitute position
Fig.3  PCB dechlorination pathway in sediment free culture and the mass balance of the dechlorination products and substrates (Cont’d)
speciesaffiliationfragment length/bppopulation
/(clones %)
closest phylogenetic relativesimilarity
/%
GD1-A-1Spirochaetes134114.6Uncultured bacterium clone XJ109 (EF648155)95
GD1-A-2Spirochaetes14432.1Uncultured bacterium clone TANB18 (AY667253)96
GD1-A-3Firmicutes14089.4Uncultured bacterium clone LS4-242 (AB234271)97
GD1-A-5Bacteroidetes13898.3Iron-reducing bacterium clone HN11 (FJ269051)99
GD1-A-6Bacteroidetes13949.4Iron-reducing bacterium clone CL-W2 (DQ677015)99
GD1-A-8Bacteroidetes139010.4Uncultured bacterium clone A-3D (AY953234)99
GD1-A-9d-Proteobacteria14139.4Pelobacter propionicus DSM 2379 (CP000482)98
GD1-A-23Bacteroidetes13903.1Uncultured bacterium clone A25B8 (DQ447181)99
GD1-A-37Synergistetes13743.1Uncultured bacterium clone R2B-12 (FJ167482)98
GD1-A-41d-Proteobacteria14083.1Uncultured bacterium clone B19 (EU234202)99
GD1-B-1Chloroflexi1354aDehalococcoides sp. BAV199.9
Tab.2  Phylogenetic analysis of predominant species in PCB dechlorinating sediment-free enrichment culture GD1 based on 16S rRNA gene sequences
1 U.S. Department of Health and Human Services-ATSDR. Toxicological Profile for Polychlorinated Biphenyls (PCBs). 2000. Available online at . ( accessed Nov 26, 2016)
2 Passatore L, Rossetti S, Juwarkar A A, Massacci A. Phytoremediation and bioremediation of polychlorinated biphenyls (PCBs): state of knowledge and research perspectives. Journal of Hazardous Materials, 2014, 278: 189–202
https://doi.org/10.1016/j.jhazmat.2014.05.051 pmid: 24976127
3 Bedard D L, Bunnell S C, Smullen L A. Stimulation of microbial para-dechlorination of polychlorinated biphenyls that have persisted in Housatonic River sediment for decades. Environmental Science & Technology, 1996, 30(2): 687–694
https://doi.org/10.1021/es950463i
4 Yan T, LaPara T M, Novak P J. The effect of varying levels of sodium bicarbonate on polychlorinated biphenyl dechlorination in Hudson River sediment cultures. Environmental Microbiology, 2006, 8(7): 1288–1298
https://doi.org/10.1111/j.1462-2920.2006.01037.x pmid: 16817937
5 Wu Q, Sowers K R, May H D. Establishment of a polychlorinated biphenyl-dechlorinating microbial consortium, specific for doubly flanked chlorines, in a defined, sediment-free medium. Applied and Environmental Microbiology, 2000, 66(1): 49–53
https://doi.org/10.1128/AEM.66.1.49-53.2000 pmid: 10618202
6 Wang S, He J. Dechlorination of commercial PCBs and other multiple halogenated compounds by a sediment-free culture containing Dehalococcoides and Dehalobacter. Environmental Science & Technology, 2013, 47(18): 10526–10534
pmid: 23964900
7 Bedard D L. A case study for microbial biodegradation: anaerobic bacterial reductive dechlorination of polychlorinated biphenyls-from sediment to defined medium. Annual Review of Microbiology, 2008, 62(1): 253–270
https://doi.org/10.1146/annurev.micro.62.081307.162733 pmid: 18729735
8 Fennell D E, Nijenhuis I, Wilson S F, Zinder S H, Häggblom M M. Dehalococcoides ethenogenes strain 195 reductively dechlorinates diverse chlorinated aromatic pollutants. Environmental Science & Technology, 2004, 38(7): 2075–2081
https://doi.org/10.1021/es034989b pmid: 15112809
9 Adrian L, Dudková V, Demnerová K, Bedard D L. “Dehalococcoides” sp. strain CBDB1 extensively dechlorinates the commercial polychlorinated biphenyl mixture aroclor 1260. Applied and Environmental Microbiology, 2009, 75(13): 4516–4524
https://doi.org/10.1128/AEM.00102-09 pmid: 19429555
10 Adrian L, Hansen S K, Fung J M, Görisch H, Zinder S H. Growth of Dehalococcoides strains with chlorophenols as electron acceptors. Environmental Science & Technology, 2007, 41(7): 2318–2323
https://doi.org/10.1021/es062076m pmid: 17438781
11 Fricker A D, LaRoe S L, Shea M E, Bedard D L. Dehalococcoides mccartyi strain JNA dechlorinates multiple chlorinated phenols including pentachlorophenol and harbors at least 19 reductive dehalogenase homoLogous genes. Environmental Science & Technology, 2014, 48(24): 14300–14308
https://doi.org/10.1021/es503553f pmid: 25377868
12 Wiegel J, Wu Q. Microbial reductive dehalogenation of polychlorinated biphenyls. FEMS Microbiology Ecology, 2000, 32(1): 1–15
https://doi.org/10.1111/j.1574-6941.2000.tb00693.x pmid: 10779614
13 Bedard D L, Bailey J J, Reiss B L, Jerzak G V. Development and characterization of stable sediment-free anaerobic bacterial enrichment cultures that dechlorinate aroclor 1260. Applied and Environmental Microbiology, 2006, 72(4): 2460–2470
https://doi.org/10.1128/AEM.72.4.2460-2470.2006 pmid: 16597944
14 Cutter L A, Watts J E M, Sowers K R, May H D. Identification of a microorganism that links its growth to the reductive dechlorination of 2,3,5,6-chlorobiphenyl. Environmental Microbiology, 2001, 3(11): 699–709
https://doi.org/10.1046/j.1462-2920.2001.00246.x pmid: 11846760
15 He J, Robrock K R, Alvarez-Cohen L. Microbial reductive debromination of polybrominated diphenyl ethers (PBDEs). Environmental Science & Technology, 2006, 40(14): 4429–4434
https://doi.org/10.1021/es052508d pmid: 16903281
16 He J, Ritalahti K M, Yang K L, Koenigsberg S S, Löffler F E. Detoxification of vinyl chloride to ethene coupled to growth of an anaerobic bacterium. Nature, 2003, 424(6944): 62–65
https://doi.org/10.1038/nature01717 pmid: 12840758
17 Wang S, He J. Phylogenetically distinct bacteria involve extensive dechlorination of aroclor 1260 in sediment-free cultures. PLoS One, 2013, 8(3): e59178
https://doi.org/10.1371/journal.pone.0059178 pmid: 23554991
18 Chu S, Hong C S. Retention indexes for temperature-programmed gas chromatography of polychlorinated biphenyls. Analytical Chemistry, 2004, 76(18): 5486–5497
https://doi.org/10.1021/ac049526i pmid: 15362911
19 Hendrickson E R, Payne J A, Young R M, Starr M G, Perry M P, Fahnestock S, Ellis D E, Ebersole R C. MoLecular analysis of Dehalococcoides 16S ribosomal DNA from chloroethene-contaminated sites throughout North America and Europe. Applied and Environmental Microbiology, 2002, 68(2): 485–495
https://doi.org/10.1128/AEM.68.2.485-495.2002 pmid: 11823182
20 Löffler F E, Sun Q, Li J, Tiedje J M. 16S rRNA gene-based detection of tetrachloroethene-dechlorinating Desulfuromonas and Dehalococcoides species. Applied and Environmental Microbiology, 2000, 66(4): 1369–1374
https://doi.org/10.1128/AEM.66.4.1369-1374.2000 pmid: 10742213
21 Schlötelburg C, Wintzingerode C, Hauck R, Wintzingerode F, Hegemann W, Göbel U B. Microbial structure of an anaerobic bioreactor population that continuously dechlorinates 1,2-dichloropropane. FEMS Microbiology Ecology, 2002, 39(3): 229–237
https://doi.org/10.1016/S0168-6496(02)00177-0 pmid: 19709202
22 el Fantroussi S, Mahillon J, Naveau H, Agathos S N. Introduction of anaerobic dechlorinating bacteria into soil slurry microcosms and nested-PCR monitoring. Applied and Environmental Microbiology, 1997, 63(2): 806–811
pmid: 9023963
23 Sung Y, Fletcher K E, Ritalahti K M, Apkarian R P, Ramos-Hernández N, Sanford R A, Mesbah N M, Löffler F E. Geobacter lovleyi sp. nov. strain SZ, a novel metal-reducing and tetrachloroethene-dechlorinating bacterium. Applied and Environmental Microbiology, 2006, 72(4): 2775–2782
https://doi.org/10.1128/AEM.72.4.2775-2782.2006 pmid: 16597982
24 Watts J E M, Fagervold S K, May H D, Sowers K R. A PCR-based specific assay reveals a population of bacteria within the Chloroflexi associated with the reductive dehalogenation of polychlorinated biphenyls. Microbiology, 2005, 151(6): 2039–2046
https://doi.org/10.1099/mic.0.27819-0 pmid: 15942010
25 Fagervold S K, Watts J E M, May H D, Sowers K R. Sequential reductive dechlorination of meta-chlorinated polychlorinated biphenyl congeners in sediment microcosms by two different Chloroflexi phylotypes. Applied and Environmental Microbiology, 2005, 71(12): 8085–8090
https://doi.org/10.1128/AEM.71.12.8085-8090.2005 pmid: 16332789
26 Bedard D L, Ritalahti K M, Löffler F E. The Dehalococcoides population in sediment-free mixed cultures metabolically dechlorinates the commercial polychlorinated biphenyl mixture aroclor 1260. Applied and Environmental Microbiology, 2007, 73(8): 2513–2521
https://doi.org/10.1128/AEM.02909-06 pmid: 17308182
27 Wang S, He J. Two-step denaturing gradient gel electrophoresis (2S-DGGE), a gel-based strategy to capture full-length 16S rRNA gene sequences. Applied Microbiology and Biotechnology, 2012, 95(5): 1305–1312
https://doi.org/10.1007/s00253-012-4251-5 pmid: 22772864
28 Cheng D, He J. Isolation and characterization of “Dehalococcoides” sp. strain MB, which dechlorinates tetrachloroethene to trans-1,2-dichloroethene. Applied and Environmental Microbiology, 2009, 75(18): 5910–5918
https://doi.org/10.1128/AEM.00767-09 pmid: 19633106
29 Bedard D L, May R J. Characterization of the polychlorinated biphenyls in the sediments of Woods Pond: evidence for microbial dechlorination of Aroclor 1260 in situ. Environmental Science & Technology, 1996, 30(1): 237–245 
https://doi.org/10.1021/es950262e
30 Fagervold S K, May H D, Sowers K R. Microbial reductive dechlorination of aroclor 1260 in Baltimore harbor sediment microcosms is catalyzed by three phylotypes within the phylum Chloroflexi. Applied and Environmental Microbiology, 2007, 73(9): 3009–3018 
https://doi.org/10.1128/AEM.02958-06 pmid: 17351091 
31 Bedard D L, Pohl E A, Bailey J J, Murphy A. Characterization of the PCB substrate range of microbial dechlorination process LP. Environmental Science & Technology, 2005, 39(17): 6831–6838
https://doi.org/10.1021/es050255i pmid: 16190246
32 Berkaw M, Sowers K R, May H D. Anaerobic ortho dechlorination of polychlorinated biphenyls by estuarine sediments from Baltimore Harbor. Applied and Environmental Microbiology, 1996, 62(7): 2534–2539 
pmid: 16535360
33 Van Dort H M, Bedard D L. Reductive ortho and meta dechlorination of a polychlorinated biphenyl congener by anaerobic microorganisms. Applied and Environmental Microbiology, 1991, 57(5): 1576–1578
pmid: 16348498
34 Williams W A. Microbial reductive dechlorination of trichlorobiphenyls in anaerobic sediment slurries. Environmental Science & Technology, 1994, 28(4): 630–635
https://doi.org/10.1021/es00053a015 pmid: 22196545
35 Ahsanul Islam M, Edwards E A, Mahadevan R. Characterizing the metabolism of Dehalococcoides with a constraint-based model. PLoS Computational Biology, 2010, 6(8): e1000887
https://doi.org/10.1371/journal.pcbi.1000887 pmid: 20811585
36 HugL A, BeikoR G, RoweA R, RichardsonR E, EdwardsE A. Comparative metagenomics of three Dehalococcoides-containing enrichment cultures: the role of the non-dechlorinating community.BMC Genomics, 2012, 13(1): 327
https://doi.org/10.1186/1471-2164-13-327 pmid: 22823523 
Related articles from Frontiers Journals
[1] Milan Malhotra, Anurag Garg. Characterization of value-added chemicals derived from the thermal hydrolysis and wet oxidation of sewage sludge[J]. Front. Environ. Sci. Eng., 2021, 15(1): 13-.
[2] Yapeng Song, Hui Gong, Jianbing Wang, Fengmin Chang, Kaijun Wang. Enhanced triallyl isocyanurate (TAIC) degradation through application of an O3/UV process: Performance optimization and degradation pathways[J]. Front. Environ. Sci. Eng., 2020, 14(4): 64-.
[3] Zuotao Zhang, Chongyang Wang, Jianzhong He, Hui Wang. Anaerobic phenanthrene biodegradation with four kinds of electron acceptors enriched from the same mixed inoculum and exploration of metabolic pathways[J]. Front. Environ. Sci. Eng., 2019, 13(5): 80-.
[4] Zhenfeng Han, Ying Miao, Jing Dong, Zhiqiang Shen, Yuexi Zhou, Shan Liu, Chunping Yang. Enhanced nitrogen removal and microbial analysis in partially saturated constructed wetland for treating anaerobically digested swine wastewater[J]. Front. Environ. Sci. Eng., 2019, 13(4): 52-.
[5] Yuan Chen, Shaodong Xie, Bin Luo. Seasonal variations of transport pathways and potential sources of PM2.5 in Chengdu, China (2012–2013)[J]. Front. Environ. Sci. Eng., 2018, 12(1): 12-.
[6] Shanshan Ding, Wen Huang, Shaogui Yang, Danjun Mao, Julong Yuan, Yuxuan Dai, Jijie Kong, Cheng Sun, Huan He, Shiyin Li, Limin Zhang. Degradation of Azo dye direct black BN based on adsorption and microwave-induced catalytic reaction[J]. Front. Environ. Sci. Eng., 2018, 12(1): 5-.
[7] Jun HUANG, Yamei HUI, Toru MATSUMURA, Gang YU, Shubo DENG, Makoto YAMAUCHI, Changmin WU, Norimasa YAMAZAKI. Detailed analysis of PCBs and PCDD/Fs impurities in a dielectric oil sample (ASKAREL Nr 1740) from an imported transformer in China[J]. Front Envir Sci Eng, 2014, 8(2): 195-204.
[8] Osamu SHITAMICHI, Taiki MATSUI, Yamei HUI, Weiwei CHEN, Totaro IMASAKA. Determination of persistent organic pollutants by gas chromatography/laser multiphoton ionization/time-of-flight mass spectrometry[J]. Front Envir Sci Eng, 2012, 6(1): 26-31.
[9] Yueping BAO, Qiuying HUANG, Wenlong WANG, Jiangjie XU, Fan JIANG, Chenghong FENG. Application of quantum chemical descriptors into quantitative structure-property relationship models for prediction of the photolysis half-life of PCBs in water[J]. Front Envir Sci Eng Chin, 2011, 5(4): 505-511.
[10] HE Yiliang, ZHAO Bin, HUGHES Joseph B., HAN Sung Soo. Fenton oxidation of 2,4- and 2,6-dinitrotoluene and acetone inhibition[J]. Front.Environ.Sci.Eng., 2008, 2(3): 326-332.
[11] PI Yunzheng, WANG Jianlong. Pathway of the ozonation of 2,4,6-trichlorophenol in aqueous solution[J]. Front.Environ.Sci.Eng., 2007, 1(2): 179-183.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed