Cloning and prokaryotic expression of TaE3 from wheat and preparation of antiserum

Yunwei ZHANG , Xiang GAO , Shengfang HAN , Dongmei WANG

Front. Agric. China ›› 2011, Vol. 5 ›› Issue (4) : 437 -442.

PDF (193KB)
Front. Agric. China ›› 2011, Vol. 5 ›› Issue (4) :437 -442. DOI: 10.1007/s11703-011-1146-7
RESEARCH ARTICLE
RESEARCH ARTICLE
Cloning and prokaryotic expression of TaE3 from wheat and preparation of antiserum
Author information +
History +
PDF (193KB)

Abstract

The E3 ubiquitin ligase is a multi-functional protein that performs vital roles, particularly in various stress environment. To further understand the biological significance of E3 ubiquitin ligase gene from wheat (TaE3), total RNA was isolated from wheat leaves and then TaE3 gene was amplified by PCR after reverse transcription. The PCR product was cloned into PMD19-T vector to sequence subsequently. And then the recombinant expression vector (pET30a-GST-TaE3-His) was constructed and transformed into E. coli strain BL21 (DE3). SDS-PAGE analysis showed that the recombinant E. coli could express a proximate 43 kDa protein. TaE3 fusion protein was purified by Ni-NTA affinity chromatography from recombinant bacterial lysate and was used to immunize rabbit to produce polyclonal antibody. The titer and specificity of the anti-TaE3 antibody were successfully detected by indirect ELISA and western blot analysis.

Keywords

E3 ubiquitin ligase (E3) / wheat / prokaryotic expression / western blot analysis

Cite this article

Download citation ▾
Yunwei ZHANG, Xiang GAO, Shengfang HAN, Dongmei WANG. Cloning and prokaryotic expression of TaE3 from wheat and preparation of antiserum. Front. Agric. China, 2011, 5(4): 437-442 DOI:10.1007/s11703-011-1146-7

登录浏览全文

4963

注册一个新账户 忘记密码

Introduction

Ubiquitination is a post-translational protein modification widely found in eukaryotic cells (Dye and Schulman, 2007; Hunter, 2007). In higher plants, ubiquitinated proteins are involved in diverse cellular processes, including abiotic or biotic stress responses, circadian rhythms, cell cycles, and differentiation (Moon et al., 2004; Smalle and Viestra, 2004; Dreher and Callis, 2007). Ubiquitin (Ub), a highly conserved 76-amino-acid polypeptide, is first activated by an E1 Ub activating enzyme in an ATP-dependent manner and is transferred to an E2 Ub-conjugating enzyme. The Ub-E2 complex then binds an E3 Ub ligase that catalyzes the formation of an isopeptide bond between a lysine residue of the target proteins and the C-terminal glycine of Ub (Smalle and Viestra, 2004). The Lys-48 and Lys-63 residues of Ub are used to form a poly-Ub chain. The most abundant Lys-48-linked poly-ubiquitinated target proteins are rapidly degraded by the 26S proteasome complex, while Lys-63-linked poly-ubiquitination confers nonproteolytic functions, such as DNA repair and protein trafficking (Jacobson et al., 2009). Interaction with other proteins, lipidation, subcellular localization, and protein activity can also be altered by mono- or multi-ubiquitination (Mukhopadhyay and Riezman, 2007).

E3 Ubiquitin ligases are central components of the ubiquitination pathway. The selection of specific targets in the ubiquitination pathway is governed mainly by a very large and diverse family of E3 ligases (Yang et al., 2005; Yang et al., 2008). The Arabidopsis (A. thaliana) genome, for example, is predicted to encode for over 1300 E3 ligases, which can be classified into different subgroups based on the presence of the U-box, really interesting new gene (RING), or homologous to E6-AP C-terminus E2 binding domain (Stone et al., 2005).

Currently, lots of functions of the E3 ubiquitin ligase are identified in plants. Evidence suggests that E3 plays different roles in a variety of biological processes and the pathways of plants defense to biostress (Wang, 1999; Wang et al., 2006; Yang et al., 2006) and abiostress, such as fungus (Yaeno and Iba, 2008), drought (Kraft et al., 2005; Cho et al., 2008; Lee et al., 2009), temperature and hormone stress. Hyun et al. (2009) reported that drought stress-induced Rma1H1, a RING membrane-anchor E3 ubiquitin ligase homolog, regulated aquaporin levels via ubiquitination in transgenic Arabidopsis plants. Prasad and Stone (2010) clarified that Arabidopsis RING E3 ligase XBAT32 regulated lateral root production through its role in ethylene biosynthesis. SCF ubiquitin ligase plays a crucial role in the N gene–mediated resistance response to tobacco mosaic virus, which has been reported these years (Liu et al., 2002). And these achievements have laid a good foundation for the further studies of the function of E3 in plants.

In our laboratory’s former study, Yan et al. (2009) obtained a differentially expressed fragment TaSSH16h508 by the suppression subtractive hybridization in the wheat-leaf rust fungus interaction system. BlastX analysis showed that the deduced amino acid sequence was consistent with the putative wheat E3 ubiquitin protein ligase (GenBank: EEF39625.1). It suggested that TaE3 may be involved in the wheat defense responses to leaf rust. The preparation of antiserum is important to investigate the location, quantity and physiologic functions of TaE3 in the defense responses to wheat leaf rust infection. In this research, we constructed prokaryotic expression vector, successfully expressed and purified fusion protein, and obtained the polyclonal antibody of TaE3 by injecting the purified fusion protein to immunize rabbits. It provided essential materials for further research of TaE3’s functions.

Materials and methods

Materials

E. coli DH5α, BL21 (DE3), and expression vector pET30a-GST were preserved in our laboratory. PMD19-T vector, EcoRI, HindIII and T4 ligase were purchased from TAKARA Company. IPTG (isopropyl-D-thiogalactopyranoside) and X-gal (5-bromo-4-chloro-3-indolyl-D-galactopyranoside) were purchased from Shanghai Sangon Biotechnology Company.

RNA extraction

Total RNAs were extracted from leaf tissue of wheat near-isogenic line TcLr19 following instruction of TaKaRa RNAisoTM Plus. The quality and quantity of RNA were measured by nucleonic acid and protein detection instrument (NanoDrop ND-1000, American). The integrity of RNA was detected by 1% agarose gel electrophoresis.

The amplification of TaE3 gene by PCR

RNA was used as template for synthesis of first-strand cDNA described as reverse transcriptase M-MLV (D2640A). PCR reaction was carried out in 100 µL reaction volume using first-strand cDNA as template at the following conditions: an initial denaturation step at 94°C for 5 min followed by 35 cycles at 94°C for 30 s, 62.1°C for 45 s and 72°C for 2 min. The final extension was at 72°C for 10 min. The primers used in the reaction were listed in the following with the underlined regions noted as restriction enzyme sites for EcoRI and Hind III:

TaE3 primers: F5′CGGAATTCATGCTTGAGAATGACATACGTG 3′

R5′CCCAAGCTTTGTAGATCTCGCCCATTTCC3′

Construction of expression vector

The PCR products were gel-purified and connected with the PMD19-T vector, and then used to transfer competent cells E.coli DH5α. Transformed cells were selected on LB medium with IPTG and X-gal. The positive colonies were picked out separately for the further identification by DNA sequencing. The fragment was digested with EcoRI and HindIII and inserted into pET30a-GST expression vector, designated as PET30a-GST-TaE3-His. After that, the expression vector was tested by the digestion of EcoRI and HindIII.

Expression of TaE3 protein in E. coli BL21 (DE3)

E. coli BL21 cells introduced with the recombinant plasmids above was used for TaE3 expression. The high expression clone was verified by SDS–PAGE analysis and cultured in LB liquid medium overnight at 37°C for small-scale culture. The overnight culture (500 µL) was inoculated into 50 mL of the fresh medium. To optimize its expression, the bacterial culture was grown at 37°C until 0.5-0.8 OD600 nm, at which time protein expression was induced by adding 0.25 mmol/L IPTG, respectively. The cultures were shaken at 180 r/min at 28°C in an 100 mL erlenmeyer flask. After induction, the samples were taken at different time. Then the cells were separated from the culture medium by centrifugation at 8000 r/min for 15 min at 4°C, after that the harvested cellular pellet was resuspended in ice-cold buffer (10 mmol/L Tris–HCl, pH 8.0, and 100 mmol/L DTT). The suspension was sonicated on ice for 5 min (5s/10s) to disintegrate the cells and centrifuged at 12000 r/min for 10 min at 4°C. The supernatant was added with 4 × sample buffer (100 mmol/L Tris-HCl, pH6.8, 4% SDS, 0.02% bromophenol blue, 20% glycerol, and 100 mmol/L DTT), and analyzed by SDS-PAGE.

Protein purification and concentration detection

The recombinant His-tagged protein was purified by Ni-NTA affinity chromatography. Several tubes were added with 100 μL Ni-NTA and 1.8 mL bacterial lysates, respectively, and then incubated overnight at 4°C. The next day, the tubes were centrifuged at 2600 r/min for 5 min at 4°C, in which the supernatant was carefully removed. The Ni-NTA was washed three times with Column Buffer, and then washed twice with 15 mmol/L imidazole, then eluted with 300 mmol/L imidazole and analyzed by SDS-PAGE. The concentration of purified proteins was detected by Coomassie brilliant blue G250. The purified protein was added to a final concentration of 10% glycerol and stored at -80°C.

Antiserum preparation using purified TaE3 fusion protein

The purified fusion protein was injected into rabbits to produce a polyclonal TaE3 antibody. The concrete experimental protocol referred to the method of Cao et al. (2007) and Liu et al. (2010).The serum with the best reactivity toward GST-TaE3-His was collected and stored at -20°C for the use of ELISA, Western blot, and immunohistochemistry assays.

Results

PCR amplification

Total RNA was obtained from mature leaves and analyzed by 1% (w/v) agarose gel electrophoresis (Fig. 1). The ORF of TaE3 about 800 bp with the addition of EcoRI and HindIII restriction sites on both ends was successfully amplified with RT-PCR. The amplified products were analyzed by 1% (w/v) agarose gel electrophoresis (Fig. 2)

Construction of recombinant pET30a-GST-TaE3-His and restriction enzyme digestion

The gene TaE3 amplified by RT-PCR was cloned into PMD19-T vector, designated as PMD19-T-TaE3. The PMD19-T-TaE3 and prokaryotic expression vector plasmid were digested by EcoRI and HindIII, respectively. The recovered target segment was reconstructed to obtain the recombinant plasmid pET30a-GST-TaE3-His and its product was transformed into E. coli DH5α and subsequently sequenced. Sequencing of the recombinant plasmid indicated that the ORF of TaE3 was in frame inserted into the pET30a vector with the beginning of GST-tag in the N-terminal and His-tag in the C-terminal of the recombinant protein. As a result, the recombinant pET30a-GST-TaE3-His was detected by EcoRI and HindIII digestion and analyzed by 1% (w/v) agarose gel electrophoresis (Fig. 3).

Exploration of prokaryotic expression conditions of TaE3 and detection of SDS-PAGE

The recombinant pET30a-GST-TaE3-His was transformed into E. coli BL21 (DE3). To optimize its expression, the bacterial culture was grown at 37°C until 0.5-0.8 OD600 nm, at which time protein expression was induced by adding 0.5 mmol/L, 0.25 mmol/L, 0.125 mmol/L, 0.1 mmol/L and 0 mmol/L IPTG, respectively. After induction, the samples were taken at 0 h, 2 h, 4 h, 6 h and overnight (20 h), and then the protein expression in the supersonic bacterial lyses supernatant was detected by SDS-PAGE analysis. As shown in Fig. 4, a new band appeared at about 43kDa, this is consistent with the theoretical size of fusion protein. The comprehensive analysis of results of Figs. 4A and 4B, we came to a conclusion that under the conditions of induction at 20 h by 0.1 mmol/L IPTG the highest expression level was identified. Therefore, we induced the large-scale fusion protein expression under this condition.

The identity of the pET30a-TaE3-GST fusion proteins

Considered the His-tag of the fusion protein, the identity of the pET30a-TaE3-GST fusion proteins was confirmed by immunodetection using commercial 6 × his of Ni2+-NTA-coupled antibodies as primary antibodies, and HRP labeled rabbit anti-mouse IgG antibodies as secondary antibodies, with a negative control by its right side. And the clear band in channel 1 (Fig. 5).shows that the fusion protein has a good specification to these his-tagged antibodies, which means it probably, is the TaE3 fusion protein.

The purification of TaE3 fusion protein

The Fusion protein was purified by Ni-NTA affinity chromatography. Bacterial lyses supernatant (before purification) and the eluate (after purification) were analyzed by SDS-PAGE (Fig. 6). The purified product had one clear main band and the size of the purified protein was as same as the product of the specific expression. Wash buffer removed most of the unspecific proteins. After elution with an elution buffer, a large scale of the fusion protein was washed down. The concentration of separated protein was 1.0 mg/mL, measured by the method of Coomassie brilliant blue G-250.

Preparation and identification of polyclonal antiserum against TaE3

The New Zealand white rabbits were immunized with the purified fusion protein as antigen. The titer of TaE3 antiserum was 1∶768000 detected by indirect ELISA (Fig. 7). Western blotting detected with prepared TaE3 antiserum as primary antibodies, and HRP labeled rabbit anti-rabbit IgG antibodies as secondary antibodies. The results showed that TaE3 rabbit antiserum positively reacted with E. coli expressed fusion protein (Fig. 8), indicating that the prepared antiserum had a certain specificity.

Discussion

Plant E3 ubquitin ligases have recently attracted much interest due to growing evidence that they play important roles in the mediation of cellular responses to environmental stresses. For example, they are known to participate in cold stress signal transduction (Lee et al., 2001; Dong et al., 2006), in the responses to salt and osmotic stress through increased ABA biosynthesis (Ko et al., 2006), and in the ABA-mediated drought signaling pathway (Zhang et al., 2007).

In the former studies in our laboratory, Yan et al. (2009) constructed a SSH library of wheat and leaf rust interaction, and found that in the 16 h library, this putative E3 gene attained a peak expression, indicated that it may plays crucial roles in the pathway of the interaction between the wheat and the leaf rust. These findings prompted us to construct a fusion vector to express the fusion protein for the further detect of different levels of this E3 ligase in the hours after the fungus inoculated to the wheat leaves.

To facilitate the expression and purification of fusion proteins, in this study, the TaE3 gene fragment was cloned into pET30a-GST vector with a GST-tag and His-tag by using genetic recombination. GST-tag promoted the expression of fusion protein in the front of the insert and His-tag was in favor of purified fusion protein in the back-end of the insert. We successfully constructed the prokaryotic expression vector pET30a-GST-TaE3-His. TaE3 fusion protein was expressed in E. coli BL21 (DE3), and clear bands were obtained by SDS-PAGE separation and stained with Coomassie blue R250 (Fig. 4). We explored the optimal conditions for the prokaryotic expression to obtain the best expression of fusion protein. Fig. 4 shows that the fusion protein was highly expressed in the supernatant at low temperature, low IPTG concentration, therefore we took the condition of induction with 0.1 mmol/L IPTG overnight at 28°C as the best condition to carry out large-scale expression of the fusion protein. In this experiment, we purified fusion protein by Ni-NTA affinity chromatography and obtained a clear main band by SDS-PAGE analysis. We detected antibody titer and specificity by indirect ELISA and Western blotting, respectively. The titer of TaE3 antiserum was 1∶768000 detected by indirect ELISA. Western blot analysis showed that antibody could specifically bind with TaE3 fusion protein, indicating that the specificity of antibody can be used for subsequent functional studies. The preparation of TaE3 antiserum is of great significance on the research of biologic function and complex regulatory network in plants.

References

[1]

Cao Z, Zhang J, Li Y, Xu X, Liu G, Bhattacharrya M K, Yang H, Ren D (2007). Preparation of polyclonal antibody specific for AtPLC4, an Arabidopsis phosphatidylinositol-specific phospholipase C in rabbits. Protein Expr Purif, 52(2): 306–312

[2]

Cho S K, Ryu M Y, Song C, Kwak J M, Kim W T (2008). Arabidopsis PUB22 and PUB23 are homologous U-Box E3 ubiquitin ligases that play combinatory roles in response to drought stress. Plant Cell, 20(7): 1899–1914

[3]

Dong C H, Agarwal M, Zhang Y, Xie Q, Zhu J K (2006). The negative regulator of plant cold responses, HOS1, is a RING E3 ligase that mediates the ubiquitination and degradation of ICE1. Proc Natl Acad Sci USA, 103: 281–8286

[4]

Dreher K, Callis J (2007). Ubiquitin, hormones and biotic stress in plants. Ann Bot (Lond), 99: 787–822

[5]

Dye B T, Schulman B A (2007). Structuralmechanisms underlying post-translational modification by ubiquitin-like proteins. Annu Rev Biophys Biomol Struct, 36: 131–150

[6]

Hunter T (2007). The age of crosstalk: phosphorylation, ubiquitination, and beyond. Mol Cell, 28(5): 730–738

[7]

Jacobson A D, Zhang N Y, Xu P, Han K J, Noone S, Peng J, Liu C W (2009). The lysine 48 and lysine 63 ubiquitin conjugates are processed differently by the 26s proteasome. J Biol Chem, 284: 35485–35494

[8]

Ko J H, Yang S H, Han K H (2006). Upregulation of an Arabidopsis RING-H2 gene, XERICO, confers drought tolerance through increased abscisic acid biosynthesis. Plant J, 47: 343–355

[9]

Kraft E, Stone S L, Ma L, Su N, Gao Y, Lau O S, Deng X W, Callis J (2005). Genome analysis and functional characterization of the E2 and RING-type E3 ligase ubiquitination enzymes of Arabidopsis. Plant Physiol, 139(4): 1597–1611

[10]

Lee H K, Cho S K, Son O, Xu Z, Hwang I, Kim W T (2009). Drought stress-induced Rma1H1, a RING membrane-anchor E3 ubiquitin ligase homolog, regulates aquaporin levels via ubiquitination in transgenic Arabidopsis plants. Plant Cell, 21(2): 622–641

[11]

Lee H, Xiong L, Gong Z, Ishitani M, Stevenson B, Zhu J (2001). The ArabidopsisHOS1 gene negatively regulates cold signal transduction and encodes a RING finger protein that displays cold-regulated nucleo–cytoplasmic partitioning. Genes Dev, 15: 912–924

[12]

Liu W, Yan A, Hou C, Wang D (2010). Cloning and prokaryotic expression in TaCaM2–3 of wheat and preparation of antiserum. Front Agric China, 4(3): 317–322

[13]

Liu Y L, Schiff M, Serino G, Deng X W, Dinesh-Kumar S P (2002). Role of SCF ubiquitin-ligase and the COP9 signalosome in the N gene–mediated resistance response to tobacco mosaic virus. Plant Cell, 14(7): 1483–1496

[14]

Moon J, Parry G, Estelle M (2004). The Ubiquitin-Proteasome Pathway and Plant Development. The Plant Cell, 16: 3181–3195

[15]

Mukhopadhyay D, Riezman H (2007). Proteasome-independent functions of ubiquitin in endocytosis and signaling. Science, 315: 201–205

[16]

Prasad M E, Stone S L (2010). Further analysis of XBAT32, an Arabidopsis RING E3 ligase, involved in ethylene biosynthesis. Plant Signaling Behavior, 5: 1425–1429

[17]

Smalle J, Vierstra R D (2004). The ubiquitin 26S proteasome proteolytic pathway. Annu Rev Plant Biol, 55: 555–590

[18]

Stone S L, Hauksdóttir H, Troy A, Herschleb J, Kraft E, Callis J (2005). Functional analysis of the RING-type ubiquitin ligase family of Arabidopsis. Plant Physiol, 137(1): 13–30

[19]

Wang J (1999). The molecular mechanism of plant disease resistance. Plant Physiology and Molecular Biology, Beijing: Science Press, 784–807 (in Chinese)

[20]

Wang Y S, Pi L Y, Chen X H, Chakrabarty P K, Jiang J, De Leon A L, Liu G Z, Li L, Benny U, Oard J, Ronald P C, Song W Y (2006). Rice XA21 binding protein 3 is a ubiquitin ligase required for full Xa21-mediated disease resistance. Plant Cell, 18(12): 3635–3646

[21]

Yaeno T, Iba K (2008). BAH1/NLA, a RING-type ubiquitin E3 ligase, regulates the accumulation of salicylic acid and immune responses to Pseudomonas syringae DC3000. Plant Physiol, 148(2): 1032–1041

[22]

Yan A H, Zhang L F, Zhang Y W, Wang D M (2009). Early stage SSH library construction of wheat near-isogenic line TcLr19 under the stress of Puccinia recondita f. sp. Tritici. Front Agric China, 3(2): 146–151

[23]

Yang C W, González-Lamothe R, Ewan R A, Rowland O, Yoshioka H, Shenton M, Ye H, O’Donnell E, Jones J D, Sadanandom A (2006). The E3 ubiquitin ligase activity of Arabidopsis plant U-BOX17 and its functional tobacco homolog ACRE276 are required for cell death and defense. Plant Cell, 18(4): 1084–1098

[24]

Yang D Y, Liu K Y, Yu Z H (2005). Ubiquitin ligase E3. Chinese Journal of Cell Biology, 27: 281–285 (in Chinese)

[25]

Yang N, Hou Q M, Nan J, Su X D (2008). The research progress of the structure and function of ubiquitin ligase. Progress in Biochemistry and Biophysics, 35(1): 14–20 (in Chinese)

[26]

Zhang J Y, Broeckling C D, Sumner L W, Wang Z Y (2007). Heterologous expression of two Medicago truncatula putative ERF transcription factor genes, WXP1 and WXP2, in Arabidopsis led to increased leaf wax accumulation and improved drought tolerance, but differential response in freezing tolerance. Plant Mol Biol, 64: 265–278

RIGHTS & PERMISSIONS

Higher Education Press and Springer-Verlag Berlin Heidelberg

PDF (193KB)

1405

Accesses

0

Citation

Detail

Sections
Recommended

/