Molecular cloning and sequence analysis of an LFY homologous gene from Juglans regia L.

Fuqiang HE , Hongxia WANG , Zhihua ZHANG

Front. Agric. China ›› 2011, Vol. 5 ›› Issue (3) : 366 -371.

PDF (580KB)
Front. Agric. China ›› 2011, Vol. 5 ›› Issue (3) :366 -371. DOI: 10.1007/s11703-011-1095-1
RESEARCH ARTICLE
RESEARCH ARTICLE
Molecular cloning and sequence analysis of an LFY homologous gene from Juglans regia L.
Author information +
History +
PDF (580KB)

Abstract

The existence of a long juvenile phase is found seriously to affect the early-stage economic benefits of later mature walnuts (Juglans regia L.). Studies on LFY, a key gene controlling floral transition and flower differentiation, may be helpful in solving the problem. This study reports the identification and characterization of a JrLFY gene from Juglans regia L., a homolog of FLORICAULA/LFY. The gene was isolated from flower buds of precocious walnut cultivar Zhonglin No. 5 by RT-PCR and RACE. The cDNA sequence of JrLFY (GenBank accession no. GU194836) was 1496 bp and contained an ORF of 1158 bp. Its corresponding genomic sequence (GenBank accession no. HQ019159) showed that the JrLFY contained three exons and two introns. The predicted amino acid sequence of the gene consisted of 385 amino acids and had a conserved region in the C-terminal when being aligned with sequences of other LFY homologs. Phylogenetic analysis showed that the LFY protein of walnut was close to those of hickory and chestnut. These studies will lay a foundation for understanding the mechanism of early fruiting and preparation for transfer of the JrLFY as a transgene to later mature walnuts.

Keywords

walnut / JrLFY / early mature / precocious / juvenility

Cite this article

Download citation ▾
Fuqiang HE, Hongxia WANG, Zhihua ZHANG. Molecular cloning and sequence analysis of an LFY homologous gene from Juglans regia L.. Front. Agric. China, 2011, 5 (3) : 366-371 DOI:10.1007/s11703-011-1095-1

登录浏览全文

4963

注册一个新账户 忘记密码

Introduction

In perennial plants, the period between germination and flowering and fruit set can vary from one year to a few years or to several decades. The “Early Mature” (EM) walnut trees have the ability to flower within one year of germination, and their genotypes are characterized by successive flowering waves and large fruit sets that occur continuously in the following years (Breton et al., 2004). ‘Qingxiang’ cultivar, a later mature walnut, is popularized in China for its many excellent traits such as resistance to diseases, good flavor, suitable shell thickness and so on. However, the juvenility of Qingxiang is much longer than that of EM trees, which has impacted seriously on the early-stage economic benefits.

Plants show a wide variety of inflorescence morphologies, and the pattern of any particular inflorescence form is highly dependent on when and where primordial flowers arise in the shoot meristem (Benlloch et al., 2007; Prusinkiewicz et al., 2007). At the onset of flowering, the conversion of Arabidopsis thaliana meristem identity from secondary inflorescence to flower is largely dependent on endogenous and environmental cues, which eventually converge on the expression of the floral meristem identity gene LEAFY (LFY), encoding transcription factor (Mandel et al., 1992; Bäurle and Dean, 2006; Blázquez et al., 2006; Kobayashi and Weigel, 2007). LFY, a key gene controlling floral transition and flower differentiation, has been characterized in Arabidopsis thaliana and Antirrhinum majus, and many orthologous cDNAs cloned in tree species showed similar expression patterns (Tandre et al., 1995; Brunner et al., 2000; Sheppard et al., 2000; Rotem et al., 2007; Guo and Yang, 2008).

Constitutive expression of LFY is sufficient to convert branches into flowers, indicating that the gene is a critical factor for specifying floral meristem identity (Bowman et al., 1993; Mandel and Yanofsky, 1995). The LFY protein directly activates transcription of AP1 and its redundant homolog CAULIFLOWER (CAL) in the floral meristem (Parcy et al., 1998; Wagner et al., 1999; William et al., 2004). Overexpression of the ArabidopsisLEAFY advanced flowering time in Populus tremula × P. tremuloides (Weigel and Nilsson, 1995). In Citrus, the constitutive expression of Arabidopsis LEAFY allowed flowering and fruit set as early as one year among transgenic trees and their progenies (Peña et al., 2001).

The above results suggest that the attainment of high level of LFY expression is a key step for floral meristem specification. If the JrLFY of EM walnut was transferred into Qingxiang cultivar, it would be compensated for the shortcoming in early-stage economic benefits. As a first stage in this process, the flower buds from Zhonglin No. 5 cultivar were collected to clone the JrLFY from walnuts. To isolate the JrLFY cDNA sequence, we used both the RT-PCR and RACE techniques. The corresponding genomic sequence for JrLFY cDNA sequence can be obtained from direct PCR of genomic DNA. At the same time, the amino acid sequence of JrLFY can be predicted according to its ORF (Open Reading Frame). In addition, the sequences cloned will be analyzed by sequence analysis software. These studies may help us know much about the early fruiting, LFY expression and potential for transgene in serotinous walnuts.

Materials and methods

Experimental materials

The apical buds from Zhonglin No. 5 cultivar were cut and collected at the Agricultural University of Hebei, China, during the period of male flower differentiation. The cut apexes were frozen in liquid nitrogen immediately and stored at -70ºC until use.

Methods

Cloning of cDNA and genomic DNA of JrLFY

Total RNA was extracted from 0.1 g apical bud with the Total RNA isolation Reagent kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions. First-strand cDNA was synthesized with M-MLV-Reverse Trancriptase from Promega following the manufacturer’s instructions. To clone the conserved region of JrLFY, the PCR primers P1 (5′-GGTTGTCCGAAGAGCCG-3′) and P2 (5′-CAGCGTGACAAAGTTGACGAAGT-3′) were designed from the blasted conserved sequence based on LFY genes of other species. The PCR conditions were: first incubated at 94ºC for 3 min, followed by 30 cycles at 94ºC for 30 s, 55ºC for 30s, and 72ºC, 2 min, with the final extension at 72ºC for 10 min. The PCR product was separated on 1% agarose gels and recovered by gel extraction, then cloned into pMD19-T vector (Takara Biotech, Dalian, China), and finally transformed into competent cells of Escherichia coli strain DH5α. White colonies were checked by PCR and the positive colonies were sequenced (Takara Biotech, Dalian, China).

To amplify the 3′ end of JrLFY cDNA, gene-specific primer P3 (5′-GCCTTTGGTCGCCATAGCAGCAC-3′) and P4 (5′-AGCAGCACGCCAAGGATGGGACA-3′) were designed based on the obtained homologous fragments. The first strand cDNA was synthesized according to manufacturer’s instructions of the 3′-RACE system (Takara Biotech, Dalian, China). The first round PCR, using the 3′-RACE outer primer (5′-TACCGTCGTTCCACTAGTGATTT-3′) and P3, was carried out according to the following conditions: initial denaturation at 94ºC for 3 min, followed by 30 cycles at 94ºC for 30 s, 60ºC for 30 s and 72ºC for 2 min, with the final extension at 72ºC for 10 min. An aliquot of 1 μL (1∶50 diluted) primary amplification product was used as a template for the 3′ end-nested amplification under the same PCR condition using inner primer (CGCGGATCCTCCACTAGTGATTTCACTATAGG) and P4. The PCR reaction yielded a product about 500 bp long. The PCR product was separated on 1% agarose gels and was recovered by gel extraction, then cloned into pMD19-T vector (Takara Biotech, Dalian, China), and finally transformed into competent cells of E. coli strain DH5α. White colonies were checked by PCR and the positive colonies were sequenced (Takara Biotech, Dalian, China).

To obtain 5′ end sequence of JrLFY cDNA, a primer P5 (5′-ATGGATCCCGACCCCTTTAC-3′) was designed according to the 5′ end of the sequence (Acc.no. DQ989225) from hickory (Carya cathayensis). Gene-specific primers P6 (5′-CACCGCCATTGCCATTAC-3′) and P7 (5′-TCCACCACTTTCCTCAGGC-3′) were designed based on the obtained homologous fragment. The primary PCR was carried out using P5 and P6 under the following PCR conditions: 94ºC for 5 min, followed by 30 cycles (94ºC for 40 s, 56ºC for 40 s and 72ºC for 1 min), with the final extension at 72ºC for 10 min. An aliquot of 1 μL (1∶50) diluted primary amplification product was used as a template for the 5′ end-nested amplification under the same PCR conditions using primers P5 and P7, and the PCR reaction yielded a product about 550 bp. The PCR product was separated on 1% agarose gels. The target DNA bands were recovered by gel extraction, then cloned into pMD19-T vector (Takara Biotech, Dalian, China), and finally transformed into competent cells of E. coli strain DH5α. White colonies were checked by PCR and the positive colonies were sequenced (Takara Biotech, Dalian, China).

The full length of JrLFY cDNA was amplified with gene-specific primers P5 and P8 (5′-TTAGA AGGGCATGTGATCACC-3′), and the PCR conditions were: 94ºC for 4 min, followed by 33 cycles (94ºC for 40 s, 55ºC for 40 s and 72ºC for 1.5 min), with the final extension at 72ºC for 10 min. The PCR product was separated on 1% agarose gels, and target DNA bands were recovered by gel extraction, then cloned into pMD19-T vector (Takara Biotech, Dalian, China), and finally transformed into competent cells of E. coli strain DH5α. White colonies were checked by PCR and the positive colonies were sequenced (Takara Biotech, Dalian, China).

Meanwhile, Juglans regia genomic DNA was isolated by a modified cetyl-trimethyl-ammonium bromide-based method. The genomic DNA sequence of JrLFY was obtained from direct PCR of genomic DNA using the three sets of primers used above (P5 and P7, P1 and P2, and P4 and P8). Genomic PCR was carried out under the following conditions: 94°C for 5 min, then incubated by a stepped program (94ºC, 40 s; 55ºC, 40 s; 72ºC, 1.5 min) for 35 cycles, and an extension at 72ºC for 10 min. All PCR products were separated on 1% agarose gels, and target DNA bands were recovered by gel extraction, then cloned into pMD19-T vector (Takara Biotech, Dalian, China), and finally transformed into competent cells of E. coli strain DH5α. White colonies were checked by PCR and the positive colonies were sequenced (Takara Biotech, Dalian, China).

Sequence analysis

Nucleotide and protein sequences of different LFY homologs were downloaded from GenBank (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi) and aligned with DNAMAN (Lynnon Biosoft, Vaudreuil, QC, Canada). Theoretical isoelectric point and mass values for the protein were also predicted and calculated using the DNAMAN program. For phylogenetic analysis, other 28 plant LFY protein sequences were retrieved from the GenBank database, and the proteins include Arabidopsis lyrata LFY (AlLFY, AAM27942), A. thaliana LFY (AtLFY, AAM27932), Boechera stricta LFY (BsLFY, AAW70551), Antirrhinum majus LFY (AmFLO, AAA62574), Mangifera indica LFY (MiLFY, ACN97632), Prunus dulcis LFY (PdLFY, AAY30859), Pinus radiate LFY (PrFLL, AAB51587), Capsicum annuum LFY (CaLFY, ABS18396), Carya cathayensis LFY (CcLFY, ABI58284), Cedrela fissilis LFY (CfLFY, AAT46474), Clausena lansium LFY (ClLFY, ABF61861), Castanea mollissima LFY (CmLFY, ABB83126), Cydonia oblonga LFY (CoLFY, BAD10958), Citrus sinensis LFY (CsLFY, AAR01229), Dimocarpus longan LFY (DlLFY, ABA39728), Eriobotrya japonica LFY (EjLFY, BAD10960), Fortunella crassifolia LFY (FcLFY, ABF61858), Glycine max LFY (GmLFY, ABE02270), Hevea brasiliensis LFY (HbLFY, AAT57872), Idahoa scapigera LFY (IsLFY, AAO73069), Impatiens balsamina LFY (IbLFY, CAI61979), Nicotiana tabacum FL2 (NtFL2, AAC48985), Platanus racemosa LFY (PrLFY, AAF77610), Pyrus communis LFY (PcLFY, BAD10957), Silene coeli-rosa LFY (ScLFY, CAC86163), Solanum lycopersicum LFY (SlLFY, AF197935), S. tuberosum LFY (StLFY, ABK56828), and Vitis vinifera LFY (VvLFY, AAN14527). A phylogenetic tree was constructed with Clustal W, and then the unrooted phylogenetic tree was generated.

Results

Cloning of cDNA and genomic DNA of JrLFY

The full length of the JrLFY cDNA was cloned from walnut (Acc. no. GU194836) and contained an ORF of 1158 bp coding a protein of 385 amino acids, corresponding to a 43.15-kDa polypeptide with an isoelectric point of 6.78. To obtain the complete genomic sequence and analyze the structure of the gene, three sets of primers were used for PCR amplification based on the walnut genomic DNA template. PCR products were sequenced and their sizes were about 1100 bp, 1800 bp and 300 bp in length, respectively, and then a JrLFY DNA of 2869 bp was obtained by assembling the above sequences and was deposited in GenBank (Acc. no. HQ019159). The BLAST of JrLFY ORF and its corresponding genomic sequence allowed the prediction of the gene structure (Fig. 1). There were three exons and two introns (first-exon 1-433, first-intron 434-978, second-exon 979-1340, second-intron 1341-2506 and third-exon 2507-2869). This exon–intron organization of JrLFY genomic sequence was similar to that of other plants, and the length of their exons did not remarkably vary; however, there were great differences in the length of the introns among them (Table 1).

Sequence analysis of the JrLFY protein

An alignment of the predicted amino acid sequence of Juglans regia JrLFY, Carya cathayensis CcLFY (Acc. no. ABI58284), Antirrhinum majus AMAFLO (Acc. no. AAA62574), N. tabacum NtFL2 (Acc. no. AAC48985) and A. thaliana AtLFY (Acc. no. NM_125579) was conducted using the DNAMAN program (Fig. 2), and the result showed that the deduced amino acid sequence of JrLFY had a higher identity with CcLFY (98.4%), AMAFLO (78.2%), NtFL2 (81.3%) and AtLFY (70.7%) at the overall amino acid level. A highly conserved region presented in the C-terminal half of the protein, hardly varied among the LFY homologs of these five different plant species. According to these results, we referred to the predicted protein as JrLFY.

To determine the phylogenetic relationship of JrLFY with LFYs from other species, the sequences of 28 LFY proteins were downloaded from GenBank and a phylogenetic tree was constructed. As shown in Fig. 3, a phylogenetic tree analysis for the LFY proteins was conducted by classifying them into four subgroups. JrLFY, CcLFY (hickory), CmLFY (chestnut), CoLFY (quince), EjLFY (loquat), and PcLFY (western pear) were clustered into the same subgroup, which showed that the JrLFY protein was closer to LFY proteins of hickory (Juglandales), chestnut (Fagales), loquat (Rosaceae), western pear (Rosaceae) and quince (Rosaceae). These results suggested that JrLFY was a FLO/LFY homolog gene.

Discussion

Long juvenility has impacted seriously on the early-stage economic benefits of serotinous walnuts like the Qingxiang cultivar. The EM walnut flowering within one year of germination was useful to study the genetic cues controlling flowering and sexual maturity in woody perennials (Breton et al., 2004). Overexpression of the Arabidopsis LEAFY gene advanced flowering time in Populus tremula × P. tremuloides (Weigel and Nilsson, 1995). Therefore, it seems possible that the problem of late flowering could be overcome if the JrLFY of EM walnut was transferred into Qingxiang cultivar. Expression of LFY is weak in leaf primordia during the vegetative phase but is strongly activated in floral meristems at the onset of flowering (Hempel et al., 1997). Therefore, we collected the flower buds from Zhonglin No. 5 cultivar to clone the JrLFY in this article.

In this study, we isolated the full-length cDNA and DNA of JrLFY from Zhonglin No. 5 cultivar. The BLAST of JrLFY ORF and its corresponding genomic sequence allowed the prediction of the gene structure (three exons and two introns). This exon–intron organization of JrLFY genomic sequence was similar to gene organization of LFY gene of other plants including Populus tomentosaLFY (An et al., 2010), Capsicum annuum LFY (Kim et al., 2008), S. tuberosum LFY (Guo and Yang, 2008), B. stricta LFY (Baum et al., 2005), Serapias lingua LFY (Montieri et al., 2004) and so on. Sequence analysis of the JrLFY protein indicated that it contained a highly conserved C-terminal region which has also been described in other plants (Weigel et al., 1992; Carmona et al., 2002). The differences in the conserved region at the protein level have originated from various origins, evolutionary histories and different selection and breeding levels of different species. According to the J. Hutchinson System (an evolutionary theory), Juglandales, Fagales and Rosaceae located in the same branch. Among the three orders, the relationship between Juglandales and Fagales is closer and both are more advanced than Rosaceae. Phylogenetic analysis showed that the JrLFY protein was closer to LFY proteins of hickory (Juglandales), chestnut (Fagales), loquat (Rosaceae), western pear (Rosaceae) and quince (Rosaceae). Walnut and hickory were clustered first, then with chestnut, and together with the loquat, western pear and quince at last. This is consistent with the J. Hutchinson System.

In conclusion, this study was undertaken to analyze the JrLFY by cloning the cDNA and its genomic DNA and determining the phylogenetic relationship. Using the information obtained from these studies, we will enrich the theory of early fruiting and provide theoretical guidance for understanding the gene expression of JrLFY in walnut and potential effects of a transgene JrLFY in serotinous walnuts.

References

[1]

An X M, Wang D M, Wang Z L, Li B, Bo W H, Cao G L, Zhang Z Y (2011). Isolation of a LEAFY homolog from Populus tomentosa: expression of PtLFY in P. tomentosa floral buds and PtLFY-IR-mediated gene silencing in tobacco (Nicotiana tabacum). Plant Cell Rep, 30(1): 89-100

[2]

Baum D A, Yoon H S, Oldham R L (2005). Molecular evolution of the transcription factor LEAFY in Brassicaceae. Mol Phylogenet Evol, 37(1): 1-14

[3]

Bäurle I, Dean C (2006). The timing of developmental transitions in plants. Cell, 125(4): 655-664

[4]

Benlloch R, Berbel A, Serrano-Mislata A, Madueño F (2007). Floral initiation and inflorescence architecture: a comparative view. Ann Bot (Lond), 100(3): 659-676

[5]

Blázquez M A, Ferrándiz C, Madueáo F, Parcy F (2006). How floral meristems are built. Plant Mol Biol, 60(6): 855-870

[6]

Bowman J L, Alvarez J, Weigel D, Meyerowitz E M, Smyth D R (1993). Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes. Development, 119: 721-743

[7]

Breton C, Cornu D, Chriqui D, Sauvanet A, Capelli P, Germain E, Jay-Allemand C (2004). Somatic embryogenesis, micropropagation and plant regeneration of “Early Mature” walnut trees (Juglans regia) that flower in vitro. Tree Physiol, 24(4): 425-435

[8]

Brunner A M, Rottmann W H, Sheppard L A, Krutovskii K, DiFazio S P, Leonardi S, Strauss S H (2000). Structure and expression of duplicate AGAMOUS orthologues in poplar. Plant Mol Biol, 44(5): 619-634

[9]

Carmona M J, Cubas P, Martínez-Zapater J M (2002). VFL, the grapevine FLORICAULA/LEAFY ortholog, is expressed in meristematic regions independently of their fate. Plant Physiol, 130(1): 68-77

[10]

Guo J L, Yang Q (2008). Molecular Cloning and expression analysis of a LFY homologous gene from potato. Plant Mol Biol Rep, 26(4): 324-334

[11]

Hempel F D, Weigel D, Mandel M A, Ditta G, Zambryski P C, Feldman L J, Yanofsky M F (1997). Floral determination and expression of floral regulatory genes in Arabidopsis. Development, 124(19): 3845-3853

[12]

Kim D H, Han M S, Cho H W, Kim D S, Kim H J, Kim B D (2008). Molecular cloning of the CaLFY, putative pepper ortholog of FLO/LFY. Mol Breeding, 22(3): 443-453

[13]

Kobayashi Y, Weigel D (2007). Move on up, it’s time for change—mobile signals controlling photoperiod-dependent flowering. Genes Dev, 21(19): 2371-2384

[14]

Mandel M A, Gustafson-Brown C, Savidge B, Yanofsky M F (1992). Molecular characterization of the Arabidopsis floral homeotic gene APETALA1. Nature, 360(6401): 273-277

[15]

Mandel M A, Yanofsky M F (1995). A gene triggering flower in Arabidopsis. Nature, 377: 522-524

[16]

Montieri S, Gaudio L, Aceto S (2004). Isolation of the LFY/FLO homologue in Orchis italica and evolutionary analysis in some European orchids. Gene, 333: 101-109

[17]

Parcy F, Nilsson O, Busch M A, Lee I, Weigel D (1998). A genetic framework for floral patterning. Nature, 395(6702): 561-566

[18]

Peña L, Martín-Trillo M, Juárez J, Pina J A, Navarro L, Martínez-Zapater J M (2001). Constitutive expression of Arabidopsis LEAFY or APETALA1 genes in citrus reduces their generation time. Nat Biotechnol, 19(3): 263-267

[19]

Prusinkiewicz P, Erasmus Y, Lane B, Harder L D, Coen E (2007). Evolution and development of inflorescence architectures. Science, 316(5830): 1452-1456

[20]

Rotem N, Shemesh E, Peretz Y, Akad F, Edelbaum O, Rabinowitch H D, Sela I, Kamenetsky R (2007). Reproductive development and phenotypic differences in garlic are associated with expression and splicing of LEAFY homologue gaLFY. J Exp Bot, 58(5): 1133-1141

[21]

Sheppard L A, Brunner A M, Krutovskii K V, Rottmann W H, Skinner J S, Vollmer S S, Strauss S H (2000). A DEFICIENS homolog from the dioecious tree black cottonwood is expressed in female and male floral meristems of the two-whorled, unisexual flowers. Plant Physiol, 124(2): 627-640

[22]

Tandre K, Albert V A, Sundås A, Engström P (1995). Conifer homologues to genes that control floral development in angiosperms. Plant Mol Biol, 27(1): 69-78

[23]

Wagner D, Sablowski R W M, Meyerowitz E M (1999). Transcriptional activation of APETALA1 by LEAFY. Science, 285(5427): 582-584

[24]

Weigel D, Alvarez J, Smyth D R, Yanofsky M F, Meyerowitz E M (1992). LEAFY controls floral meristem identity in Arabidopsis. Cell, 69(5): 843-859

[25]

Weigel D, Nilsson O (1995). A developmental switch sufficient for flower initiation in diverse plants. Nature, 377(6549): 495-500

[26]

William D A, Su Y, Smith M R, Lu M, Baldwin D A, Wagner D (2004). Genomic identification of direct target of LEAFY. Proc Natl Acad Sci USA, 101(6): 1775-1780

Rights & permissions

Higher Education Press and Springer-Verlag Berlin Heidelberg

PDF (580KB)

1345

Accesses

0

Citation

Detail

Sections
Recommended

/