Knockdown of ACS9 expression in Arabidopsis decreases the tolerance to salt and osmotic stress

Xueli HAN , Yonggang PAN , Yingchao LIU , Jihong XING , Jingao DONG

Front. Agric. China ›› 2011, Vol. 5 ›› Issue (2) : 181 -186.

PDF (263KB)
Front. Agric. China ›› 2011, Vol. 5 ›› Issue (2) :181 -186. DOI: 10.1007/s11703-011-1022-5
RESEARCH ARTICLE
RESEARCH ARTICLE
Knockdown of ACS9 expression in Arabidopsis decreases the tolerance to salt and osmotic stress
Author information +
History +
PDF (263KB)

Abstract

Based on the DNA sequence of ACS9, two produced fragments were subcloned into binary vector pCAMBIA1300 in antisense and sense orientations, and the generated RNA interference (RNAi) vector was then transformed into Arabidopsis thaliana. The stress resistance function of ACS9 gene in Arabidopsis thaliana was researched by determination of stress resistance physiologic indexes, NaCl and PEG6000 resistance. The results showed that the inhibition of ACS9 expression enhanced the sensitivity to high concentration NaCl (150 mmol/L) and PEG6000(7%) in Arabidopsis thaliana seeding stage. The proline contents and water loss rates in transgenic plants were 0.68 and 1.4 times higher than those in the wild-type leaves, respectively, indicating that the inhibition of ACS9 expression due to salt and drought resistant was reduced and suggested that ACS9 gene played important roles in plant salt and drought tolerance.

Keywords

ACS9 gene / RNAi vector / functional analysis / stress resistance

Cite this article

Download citation ▾
Xueli HAN, Yonggang PAN, Yingchao LIU, Jihong XING, Jingao DONG. Knockdown of ACS9 expression in Arabidopsis decreases the tolerance to salt and osmotic stress. Front. Agric. China, 2011, 5(2): 181-186 DOI:10.1007/s11703-011-1022-5

登录浏览全文

4963

注册一个新账户 忘记密码

Introduction

The gas ethylene (C2H4) is known as a signaling molecule that regulates a variety of developmental processes and stress responses in plants (Abeles et al., 1992). Ethylene production in plant cells is enhanced by a variety of external factors, including wound, pathogen attack, hormone treatment, chilling injury, drought, or the presence of heavy metals (Yang and Hoffman, 1984; Alonso and Stepanova, 2004; Chen et al., 2005). The biosynthetic pathway of ethylene is clarified by Adams and Yang (1979). The production of ethylene in higher plants is from S-adenosyl-L-methionine (AdoMet), which is converted to 1-aminocyclopropane-1-carboxylic acid (ACC) by ACC synthase (ACS) and then to ethylene by ACC oxidase (Adams and Yang, 1979). The step of ACC formation is the main rate-limiting step in the ethylene biosynthesis (Alonso and Stepanova, 2004). ACS is the key enzyme that regulates the majority of cases in ethylene production responding to stress (Boller et al., 1979).

ACS is encoded by a multigene family in all examined plant species (Bleecker and Kende, 2000). In Arabidopsis, the ACS gene family encodes nine polypeptides including one nonfunctional gene ACS1 and eight functional genes ACS2, ACS4–9, and ACS11 (Yamagami et al., 2003). Each ACS gene shows a unique expression profile during Arabidopsis growth and development and is able to respond to different hormonal and environmental signals, whereas a single developmental or environmental stimulus can induce the coexpression of several ACS genes (Tsuchisaka and Theologis, 2004; Peng et al., 2005).

Expression of ACS gene can be induced either in such specific tissues as hypocotyl, leaf, root, tuber, petiole, flower, petal, pistil, and fruit or in responses to such biotic and/or abiotic factors as radiation, Cu2+, Li+, wound, protein kinase inhibitor, IAA, ethylene, chilling, and pathogens (Ge et al., 2000; Wang et al., 2005). Mechanical wound and insect attack can induce the ethylene synthesis and ACS gene expression (Liu et al., 1993; O’Donnell et al., 1996; Alonso and Stepanova, 2004), while the ethylene regulates the damage stimulation on plants in turn (Ronald et al., 2007). Numerous ACS genes have been found to be wound-inducible (Ge et al., 2000). It is found that ACS4 and ACS5 are responsive to wounding treatment, while ACS7 is not induced (Peng et al., 2005). All these results show that ACS genes play important roles in plant stress-resistance. ACS functional analysis has future significance for understanding the regulating mode of ethylene in plant developmental processes.

RNA interference (RNAi) technology is currently a more effective method of gene suppressed expression (Chuang and Meyerowitz, 2000). In the previous study, we speculated that ACS9 gene was involved in plant stress-resistance responses (Pan, 2009). To understand the role of ACS9 gene in response to diverse stresses during plant development, RNAi expression vector was constructed according to its nucleotide sequence. The recombinant carried by Agrobacterium was introduced into Arabidopsis plants through the flowers dipped in bacterial cultures. When the transgenic plants were treated with salt and drought stress, we understood the gene function by analyzing their sensitivity to the stresses?

Methods

Plant materials and growth conditions

Arabidopsis thaliana ecotype Columbia (Col) was used throughout this study. Seeds were surface sterilized for 10 min in 10% sodium hypochlorite, washed with sterilized water for five times, and germinated on the selection medium plate (1/2 Murashige-Skoog media containing 50 mg/L hygromycin, 1% agar, pH 5.7). After cold treatment at 4°C for 2 d, the plates were incubated at 22±1°C under 16 h light/8 h dark (light grow seedlings) for two weeks or under the dark (etiolated seedlings) for 3-10 days to produce Arabidopsis seedlings.

For seed germination assays, at least 100 seeds from transgenic lines and wild-type plants were sterilized and planted on MS triplicate plates supplemented with different concentrations of NaCl and PEG6000. The plates were cultured in a growth chamber at 22±1°C under long-day conditions (16 h light/8 h dark) after cold treatment at 4°C for 2 days. The germinated seeds (emergence of radicals) were counted and characterized after 10 days.

Construction of RNAi silencing vector

Specific fragment of ACS9 gene were obtained by multiple sequence alignment using DNAMAN software. The degenerate primers, designed according to intron location of ACS9 gene and multiple cloning site of vector pCAMBIA1300, were used for amplifying specific fragments of ACS9 gene. The primers were given as follows: P1:TAAGGATCCGCTGCTGGTTCAACATCTGC(BamHI); P2:TGTGAGCTCACACGAGACCGAAACTTGAC(SacI); P3:CGCGGATCCGCTCAAGCTCTAATGGGTTC(BamHI); P4:TGCTCTAGAACACGAGACCGAAACTTGAC(XbaI).

Antisense fragments and sense fragments were amplified, and two product fragments were subcloned into binary vector pCAMBIA1300 after restriction digestion analysis, and then, RNAi vector pCAMBIA1300-ACS9i was introduced into Agrobacterium GV3101.

Transformation and molecular identification of transgenic lines

The recombinant was introduced into Arabidopsis plants using floral dipping method (Clough and Bent, 1998). The independent transformants were screened on 1/2 MS media. The transformed seedlings of green and expanded leaves were screened out from the yellow-colored nontransformed seedlings and transferred to soil for 2 to 3 weeks.

The PCR primers used to confirm the recombinant transgenes in transgenic plants were P5: 5'-GCTGCTAAAGGAGATGAATG-3' and P6: 5'-GAATAAGGAGGATCAACGAC-3'. Genomic DNA was isolated from transgenic plants as template for PCR amplification (Weigel and Glazebrook, 2004). ACS9 gene expression in the transgenic lines was determined with total RNA isolated from seven-day-old etiolated seedlings treated with 50 mol/L CHX (Yamagami et al., 2003).

Characterization of mutant phenotypes

Hypocotyl-length and root-length measurements were carried out with light and dark-grown seedlings grown on normal conditions for 3-10 days. After potted seedlings grew in drought treatments for 2 weeks with constant watering, then the water was withheld, and pictures were taken after 3 weeks treatment.

Seedlings were watered in treatment with 150 mmol/L NaCl for 2 weeks when phenotypes were characterized.

Measurement of proline and water loss rate

Transgenic plants and wild-type plants were watered with 150 mmol/L NaCl for 48 d; proline contents were determined as previously described (Bates et al., 1973). Rosette leaves were detached from transgenic plants and wild-type plants growing under normal conditions for 3 weeks and weighed immediately on a piece of weighing paper at designated times. The percentage loss of fresh weight was calculated on the basis of the initial weight of the leaves (Zhizhong et al., 2005). Three replicates were made for each line.

Results

Construction of RNAi vector

After a series of molecular operations, the two produced fragments were introduced into binary vector pCAMBIA1300 and generated RNAi vector pCAMBIA1300-ACS9i. Restriction digestion analysis of pCAMBIA1300-ACS9i showed that it contains sense and antisense fragments of ACS9 gene, indicating that the RNAi vector pCAMBIA1300-ACS9i was constructed correctly (Fig. 1).

Screening and molecular identification of transgenic plants

The independent transformants were screened on 1/2 MS media containing 50 mg/L hygromycin and 1% agar. The transformed seedlings of green and expanded leaves were screened out from the yellow-colored nontransformed seedlings.

Genomic DNA was isolated from five transgenic plants randomly selected as template for PCR amplification. The result showed that a specific purpose of bands at size of about 801 bp fragment in line for expectations from all the tested plants with the blank plasmid pCAMBIA1300 as positive control, whereas the control wild-type plants did not have amplified bands (Fig. 2).

Total RNA was isolated from seven-day-old etiolated seedlings treated with 50 mol/L CHX. The levels of expression of ACS9 gene were determined in wild-type and transgenic plants by RT-PCR. Two transgenic plants with significant downexpression of ACS9 gene were obtained, indicating that the expression of the target gene was suppressed (Fig. 3). We chose obviously the down-expression of transgenic plants (four lanes, later recorded as M) for the following study.

Seed growth of transgenic plants and wild-type plants

Transgenic plants could enhance the growth of hypocotyl and root of 10 d etiolated seeds better than wild-type plants whose hypocotyl length was similar to the root length of the transgenic plants (Fig. 4). However, the transgenic plants could only enhance the hypocotyl growth of 3 days light-grown seeds. In addition, phenotypes showed no apparent difference in mature transgenic plants and wild-type plants.

Tolerance of transgenic plants to osmotic stress during both germination and growth

When seeds were sown on MS medium supplemented with different concentrations of NaCl for 10 days, the germination of transgenic plants and wild-type plants showed no apparent difference on normal condition. However, as NaCl concentrations were increased, there was a decrease in germination, while no apparent difference was found in transgenic plants and wild-type plants in the same concentrations of NaCl (Fig. 5A). The cotyledons of transgenic plants were etiolated and even died after germination, while about 40% wild-type plants grew out green cotyledons in 150 mmol/L NaCl (Fig. 5B). Wild-type plants less enhanced germination as compared with transgenic plants; however, both could hardly survive 300 mmol/L NaCl, which suggested that the suppression of ACS9 genes affected the sensitivity of Arabidopsis to the NaCl and reduced its resistance to salt stress.

Seed germination of transgenic plants and wild-type plants showed no apparent difference when treated with different concentrations of PEG6000. However, the root length of 10-days-old seedlings of wild-type plants treated with 5% and 7% PEG6000 was longer than that of transgenic plants (Fig. 6). We observed that the seedlings of transgenic plants turned brown and the center parts of the seedlings blackened, while the wild-type seedlings were still green. This indicates that the ACS9 gene was inhibited, and the tolerance of Arabidopsis to drought was reduced.

Detection of osmotic physiologic indexes

Proline is one of the most effective osmotic regulators, and free proline content is an important indicator of the ability of plants to be adapted to stresses. The proline content was determined when treated with 150 mmol/L NaCl solution for 48 h. The result showed that the proline content in transgenic plants was 0.82 times as high as that of wild type. When treated with 150 mmol/L NaCl solution, the significant increase in the proline content of transgenic plants appeared, but it was (0.68 times) less than that of the wild-type plants (Fig. 7).

Excised-leaf water loss rate could reflect the drought resistance of plants, and the more the drought resistance, the smaller the excised-leaf water loss rate is (Clarke and Mccaig, 1982). We found that the leaf water loss rate of transgenic plants was always higher than that of the wild-type plants in our study, indicating the greatest difference between transgenic plants and wild-type. After 4 h in vitro, the water loss rate in transgenic plants leaves was 1.4 times as high as that of wild-type leaves (Fig. 8). In conclusion, our result suggests that transgenic plants can reduce the capacity of salt and drought resistance.

Discussion

Gene expression of reduction or inactivation is often used in molecular biology studies to determine the gene functions through phenotypic observation. RNAi technology has features without a large amount of screening and separation as compared with several other technologies used for functionality missing, and it easily generates the mutation of function loss or reduction (Smith et al., 2000). In our study, we used RNAi technology in making down expression of ACS9 gene in transgenic plants in order to further study gene functions.

In plant growth and development process, there exist a variety of unfavorable factors affecting the survival of plants as adversity stresses. Ethylene carries stress-related signal molecule regulating plant biologic stress and abiotic stress responses (Ge et al., 2000; Alonso and Stepanova, 2004). We found that ethylene as a negative regulator of plant stress resistance (Straeten et al., 1990) can inhibit root elongation and promote plant aging process under water stress, thereby reducing the drought resistance of plants. Ethylene contains a response factor to improve drought resistance capacity in tomatoes (Cornelius and James, 2006). Gómez-Cadenas et al. (1998) reported that ethylene has a moderating effect on leaf shedding by salt stress, and the ethylene insensitive mutants (ein2, ein3, etr1) can enhance the sensitivity of pathogens B. cinerea (Ferrari et al., 2003). These findings suggest that ethylene acts as an endogenetic regulator in stress responses (Pierik et al., 2006).

Recently, Tsuchisaka has reported that ethylene-mediated processes are orchestrated by a combinatorial interplay among ACS isoforms (Tsuchisaka et al., 2009). Our study showed that ACS9 genes down-expression in transgenic Arabidopsis enhanced sensitivity compared with Columbia wild-type to high salt (150 mmol/L NaCl) and drought (7% PEG6000) stress, indicating ACS9 gene may be provided protective effect for osmotic stress, directly or indirectly. Free proline content and determination of leaf water loss rate further confirmed this result. For further certify function of ACS9 gene, knockdown of ACS9 expression in other Arabidopsis lines is under study. In addition, interaction among ACS9 gene and other family genes in response to adversity stress and the role of ethylene need to study in regulatory these processes in future.

References

[1]

Abeles F B, Morgan P W, Saltveit M E Jr (1992). Ethylene in plant biology. New York: Academic Press, Inc

[2]

Adams D O, Yang S F (1979). Ethylene biosynthesis: Identification of 1-aminocyclopropane-1-carboxylic acid as an intermediate in the conversion of methionine to ethylene. Proc Natl Acad Sci USA, 76(1): 170-174

[3]

Alonso J M, Stepanova A N (2004). The ethylene signaling pathway. Science, 306(5701): 1513-1515

[4]

Bates L S, Waldren R P, Teare I D (1973). Rapid determination of free proline for water-strress studies. Plant and Soil, 39(1): 205-207

[5]

Bleecker A B, Kende H (2000). Ethylene: a gaseous signal molecule in plants. Annu Rev Cell Dev Biol, 16(1): 1-18

[6]

Boller T, Herner R C, Kende H (1979). Assay for and enzymatic formation of an ethylene precursor, 1-aminocyclopropane-1-carboxylic acid. Planta, 145(3): 293-303

[7]

Chen Y F, Etheridge N, Schaller G E (2005). Ethylene signal transduction. Annals of Botany, 95(6): 901-915

[8]

Chen Z Z, Hong X H, Zhang H R, Wang Y Q, Li X, Zhu J K, Gong Z Z (2005). Disruption of the cellulose synthasegene, AtCesA8/IRX1, enhances drought and osmotic stress tolerance in Arabidopsis. The Plant J, 43: 273-283

[9]

Chuang C F, Meyerowitz E M (2000). Specific and heritable genetic interference by double-stranded RNA in Arabidopsis thaliana. Proc Natl Acad Sci USA, 97(9): 4985-4990

[10]

Clarke J M, Mccaig T N (1982). Evaluation of techniques for screening for drought resistance in wheat. Crop Sci, 22: 503-506

[11]

Clough S J, Bent A F (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J, 16(6): 735-743

[12]

Cornelius S B, James J G (2006). Ripening in the tomato Green-ripe mutant is inhibited by ectopic expression of a protein that disrupts ethylene signaling. PNAS, 103(20): 7923-7928

[13]

Ferrari S, Vairo D, Ausubel F M, Cervone F, Lorenzo D G (2003).Tandemly duplicated Arabidopsis genes that encode polygalacturonase-inhibiting proteins are regulated coordinately by different signal transduction pathways in response to fungal infection. Plant Cell, 15(1): 93-106

[14]

Ge L, Liu J Z, Wong W S, Hsiao W L W, Chong K, Xu Z K, Yang S F, Kung S D, Li N (2000). Identication of a novel multiple environmental factor-responsive 1-aminocyclopropane-1-carboxylate synthase gene, NT-ACS2, from tobacco. Plant Cell Environ, 23(11): 169-182

[15]

Gómez-Cadenas A, Tadeo F R, Primo-Millo E, Talon M (1998). Involvement of abscisic acid and ethylene in the responses of citrus seedlings to salt shock. Physiologia Plantarum, 103(4): 475-484

[16]

Liu D, Li N, Dube S, Kalinski A, Herman E, Mattoo A K (1993). Molecular characterization of a rapidly and transiently wound-induced soybean (Glycine max L.) gene encoding 1-aminocyclopropane-1-carboxylate synthase. Plant and Cell Physiol, 34: 1151-1157

[17]

O’Donnell P J, Calvert C, Atzorn R, Wasternack C, Leyser H M O, Bowles D J (1996). Ethylene as a signal mediating the wound response of tomato plants. Science, 274(5294): 1914-1917

[18]

Pan Y G (2009). Functional confirmation and promoter activity of Phytophthora infestans-defense related ACS9 gene in Arabidopsis. Dissertation for the Master Degree. Baoding: Agricultural University of Hebei, 38-39 (in Chinese)

[19]

Peng H P, Lin T Y, Wang N N, Shih M C (2005). Differential expression of genes encoding 1-aminocyclopropane-1-carboxylate synthase in Arabidopsis during hypoxia. Plant Mol Biol, 58(1): 15-25

[20]

Pierik R, Sasidharan R, Voesenek L A C J (2007). Growth control by ethylene: Adjusting pheno types to the environment. Plant Growth Regul, 26(2): 188-200

[21]

Pierik R, Tholen D, Poorter H, Visser E J, Voesenek L A C J (2006). The Janus face of ethylene: growth inhibition and stimulation. Trends in Plant Sci, 11(4): 176-183

[22]

Smith N A, Singh S P, Wang M B, Stoutjesdijk P A, Green A G, Waterhouse P M (2000). Total silencing by intron-spliced hairpin RNAs. Nature, 407(6802): 319-320

[23]

Straeten D V, Wiemeersch V L, Goodman H M, Montagu M V (1990). Cloning and sequence of two different cDNAs encoding 1-aminocyclopropane-1-carboxylate synthase in tomato. Proc Natl Acad Sci USA, 87(12): 4859-4863

[24]

Tsuchisaka A, Guixia Yu, Hailing Jin, Alonso J M, Ecker J R, Xiaoming Zhang, Shang Gao, Theologis A (2009). A combinatorial interplay among the 1-aminocyclopropane-1-carboxylate isoforms regulates ethylene biosynthesis in Arabidopsis thaliana. Genetics, 183(3): 979-1003

[25]

Tsuchisaka A, Theologis A (2004). Unique and overlapping expression patterns among the Arabidopsis 1-amino-cyclopropane-1-carboxylate synthase gene family members. Plant Physiol, 136(2): 2982-3000

[26]

Wang N N, Shih M C, Li N (2005). The GUS reporter-aided analysis of the promoter activities of Arabidopsis ACC synthase genes AtACS4, AtACS5, and AtACS7 induced by hormones and stresses. Journal of Experimental Botany, 56(413): 909-920

[27]

Weigel D, Glazebrook J (2004). Arabidopsis: A Laboratory Manual. Beijing: Chinese Industry Press, 165-166

[28]

Yamagami T, Tsuchisaka A, Yamada K, Haddon W F, Harden L A, Theologis A (2003). Biochemical diversity among the 1-amino-cyclopropane-1-carboxylate synthase isozymes encoded by the Arabidopsis gene family. J Biol Chem, 278(49): 49102-49112

[29]

Yang S F, Hoffman N E (1984). Ethylene biosynthesis and its regulation in higher plants. Annu Rev Plant Physiol, 35(1): 155-189

RIGHTS & PERMISSIONS

Higher Education Press and Springer-Verlag Berlin Heidelberg

PDF (263KB)

1212

Accesses

0

Citation

Detail

Sections
Recommended

/