Differential effects of recombinant fusion proteins TAT-OCT4 and TAT-NANOG on adult human fibroblasts

Jiani CAO , Zhifeng XIAO , Bing CHEN , Yuan GAO , Chunying SHI , Jinhuan WANG , Jianwu DAI

Front. Biol. ›› 2010, Vol. 5 ›› Issue (5) : 424 -430.

PDF (290KB)
Front. Biol. ›› 2010, Vol. 5 ›› Issue (5) :424 -430. DOI: 10.1007/s11515-010-0800-4
RESEARCH ARTICLE
RESEARCH ARTICLE
Differential effects of recombinant fusion proteins TAT-OCT4 and TAT-NANOG on adult human fibroblasts
Author information +
History +
PDF (290KB)

Abstract

OCT4 and NANOG are two important transcription factors for maintaining the pluripotency and self-renewal abilities of embryonic stem (ES) cells. Meanwhile they play key roles in the induced pluripotent stem (iPS) cells. In this study, recombinant transcript factors TAT-NANOG and TAT-OCT4, which contained a fused powerful protein transduction domain (PTD) TAT from human immunodeficiency virus (HIV), were produced. Each fusion protein could be transported into human adult fibroblasts (HAF) successfully and activated the endogenous transcription of both nanog and oct4. Our study revealed the inter-regulation and autoregulation abilities of solo oct4 or nanog in the process of iPS cell reprogramming. Meanwhile the transduction of TAT-NANOG could accelerate the growth rate of HAF cells, and the key cell cycle regulator cdc25a was up-regulated. Thus cdc25a may be involved in the regulation of cell growth by NANOG. In addition, the TAT fusion protein technology provided a novel way to improve cell growth that is more controllable and safer.

Keywords

induced pluripotent stem cells (iPS cells) / OCT4 / NANOG / protein transduction domain / TAT / cell proliferation

Cite this article

Download citation ▾
Jiani CAO, Zhifeng XIAO, Bing CHEN, Yuan GAO, Chunying SHI, Jinhuan WANG, Jianwu DAI. Differential effects of recombinant fusion proteins TAT-OCT4 and TAT-NANOG on adult human fibroblasts. Front. Biol., 2010, 5 (5) : 424-430 DOI:10.1007/s11515-010-0800-4

登录浏览全文

4963

注册一个新账户 忘记密码

Introduction

NANOG and OCT4 are two essential transcription factors that regulate the early development and embryonic stem (ES) cell identity (Chambers et al., 2003; Mitsui et al., 2003; Hay et al., 2004; Matin et al., 2004; Zaehres et al., 2005; Loh et al., 2006). oct4 belongs to the POU family, and is almost exclusively expressed in ES cells. It is expressed in all blastomeres of early developing embryos, but later it is restricted to the inner cell mass (ICM) and down-regulated in trophectodermal and primitive endoderm (Nichols et al., 1998; Niwa et al., 2000). At maturity, oct4 expression is restricted to developing germ cells (Pesce and Schöler, 2001). Knockdown of oct4 by RNA interference (RNAi) in murine ES cells results in cell differentiation (Hay et al., 2004; Hough et al., 2006). Previous studies indicate that oct4 controls the pluripotency of ES cells in a quantitative fashion. Increase of oct4 expression drives ES cells to endoderm and mesoderm lineages, while repression of its expression will lead to ES cell differentiation into trophectoderm lineage (Niwa et al., 2000; Niwa, 2001). nanog encodes a homeodomain-bearing transcription factor and its function is to maintain the undifferentiated state and self-renewal of stem cells (Chambers et al., 2003; Mitsui et al., 2003; Silva et al., 2009). It is expressed in the ICM of human blastocysts, undifferentiated ES cells and embryonic carcinoma (EC) cells, whereas during ES cell differentiation it is downregulated (Chambers et al., 2003; Hyslop et al., 2005). It has been shown that overexpression of nanog in mouse ESCs confers the cells pluripotency independently of the leukemia inhibitory factor – STAT3 pathway (Chambers et al., 2003; Mitsui et al., 2003), clonal expansion of murine ES cells, and the maintenance of oct4 expression (Chambers et al., 2003). Whereas downregulation of nanog in mouse and human ES cells will lead to the loss of pluripotency with the appearance of reduced cell proliferation ability and differentiation toward extraembryonic lineages (Chambers et al., 2003; Mitsui et al., 2003; Hyslop et al., 2005; Zaehres et al., 2005). Thus, nanog may function as a key regulator in maintaining the pluripotency of stem cells.

Recently, studies on stem cells have shown that somatic cells could be reprogrammed to pluripotent stem cells (iPS cells) by the forced expression of oct4, sox2, klf4 and c-myc (Takahashi and Yamanaka, 2006; Takahashi et al., 2007) or oct4, sox2, nanog and lin28 (Yu et al., 2007, 2009) through transgenic technology. iPS cells could also be induced successively by recombinant transcription factors (OCT4, SOX2, KLF4 and C-MYC) carrying a poly-arginine PTD (protein transduction domain) (Kim et al., 2009; Zhou et al., 2009). These exploratory studies indicate that transient administration of defined amounts of fusion proteins of these transcription factors in a controllable fashion may provide safer and more promising route of getting clinically feasible iPS cells from somatic cells.

Despite these findings, studies about the effects of single iPS cell inducing factor on somatic cells are still lacking. Here we fused NANOG or OCT4 to a powerful PTD TAT (YGRKKRRQRR) from human immunodeficiency virus (HIV) (Green and Loewenstein, 1988; Nagahara et al., 1998), and transported them to the human adult fibroblast (HAF) cells respectively. Each fusion transcription factor could activate the endogenous expression of both nanog and oct4. In addition, TAT-NANOG could promote the growth rate of HAF cells, and a key cell cycle regulator cdc25a was up-regulated in the TAT-NANOG transduced HAF cells.

Materials and methods

Generation of TAT-OCT4 and TAT-NANOG fusion proteins

Genes of TAT-OCT4 and TAT-NANOG were generated by PCR and inserted into vector pET-28a (Novagen) respectively. The primers used are shown as below:

oct4 forward primer 1: 5′ataCATATGTATGGCCGCAAAAAACGCCGCCAGCGCCGCCGCTATCCGTATG3′; oct4 forward primer 2:5′CGCCGCTATCCGTATGATGTGCCGGATGTGGCGGAGCTCATGGCGGGACACCTGG 3′; and oct4 reverse primer: 5′ataGCGG-CCGCTTATCAGTTTGAATGCA3′, and nanog forward primer: 5′GAGCTCATGAGTGTGGATCCAGC-TT3′, and nanog reverse primer: 5′GCGGCCGCTCACACGTCTTCAGGTT3′.

The constructed vectors were transformed into E. coli BL21 Rostta-Gami strain respectively, and then the fusion proteins were induced with 1 mmol/L isopropyl b-D-thiogalactopyranoside (IPTG) at 37°C for 5 h. The inclusion bodies of both recombinant proteins were harvested from the cell lysis by centrifugation and solubilized in buffer A (8 mol/L urea,100 mmol/L Tris [pH 8.0], 100 mmol/L NaCl). The solubilized fusion proteins were purified by nickel chelate chromatography (Amersham Biosciences) and then stored at -80°C for further use. The expression and purification of the recombinant proteins were analyzed with 15% (wt/vol) sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under reducing condition. Target proteins were identified by western-blotting with anti-NANOG and anti-OCT4 antibodies respectively. Concentration of proteins was monitored with Bradford method and bovine serum albumin (BSA) as a standard (Bradford, 1976).

Transfection of human adult fibroblasts and MCF-7 cells with TAT-OCT4 or TAT-NANOG

Human adult fibroblasts (HAF) and MCF-7 cells were maintained in high glucose Dulbecco’s modified Eagle’s medium (DMEM) (Hyclone) supplemented with 10% fetal calf serum (characterized FBS, Hyclone), 100X non-essential amino acid solution (Hyclone), 100 mmol/L sodium pyruvate (Hyclone), 100 U/mL penicillin (Gibco), 100 μg/mL streptomycin (Gibco) at 37°C in a humidified atmosphere of 5% CO2 in air. For all the protein transduction experiments, cells were inoculated at a proper density in the low serum medium (2% FBS) containing 0.2 μmol/L TAT-OCT4, TAT-NANOG, or PBS.

Immunofluorescence staining

The HAF cells were treated with the fusion proteins or PBS described above for 2 h. Then the medium was removed, and the cells were washed with PBS 5 times to remove the nonadherent cells and proteins attached to the outer surface of the cells. Immunocytochemistry was performed according to standard protocol. Briefly, the cells were fixed with 4% paraformaldehyde (Merk, Hohenbrunn, Germany), washed 3 times by PBS, and then incubated in PBS containing 0.5% TritonX-100. The cells were incubated with the primary antibody anti-HA (Sigma; 1∶300) at 4°C overnight. After washing 3 times with PBS, cells were incubated with the secondary antibody goat anti-mouse IgM-FITC (Sigma; 1∶5000) for 20 min at 37°C. Nuclei were detected by propidium iodide (PI) (Sigma) staining. Then the unbound antibody was aspirated and washed by PBS for 3 times. The images of treated cells were captured with a Zeiss Axiovert 200 (Carl Zeiss).

Reporter assay

MCF-7 cells were seeded in a 24-well plate, transduced with the fusion proteins or the identical volume of PBS respectively followed by transfecting with the NANOG reporter or OCT4 reporter plasmid (0.8 μg per well, kindly gifted by Professor Duanqing PEI) using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. pTK-Renilla (0.0016 μg per well, Promaga) was co-transfected as an internal reference. Then the transfected cells were continually treated with the fusion proteins or PBS. 36 h later, luciferase assay was performed using the dual-luciferase reporter assay system (Promega) and Luminometer following the manufacturer’s instructions.

Cell growth analysis

HAF cells were inoculated at 5000 cells per well in 48-well plates and treated with the proteins or PBS as described. 48 h later the viable cells were counted using a hemocytomer.

Real-time PCR

HAF cells were incubated with the proteins or PBS for 48 h, and total RNAs were extracted using Trizol (Invitrogen) reagent, and then digested with Dnase I (Invitrogen) following the manufacturer’s recommendations. The reverse transcription reactions were performed with Super Transcript III (Invitrogen). Real-time PCR analyses were conducted using Power SYBR Green (Applied Biosystems). Signals were detected with an ABI7900 Real-Time PCR System (Applied Biosystems). Primer sets used to detect mRNA are listed as follow: cdc25a forward primer: 5′AGCTCCAGCACTCGGTCAGT 3′; cdc25a reverse primer: 5′CCAGGTGGAGACTCCTCTTGAG 3′; cdk6 forward primer: 5′ TGAACCAAAATGCCACATACACT3′; cdk6 reverse primer: 5′TTCGGCCTTTCGCATAGG3′; nanog forward primer: 5′CCAAAGGCAAACAACCCACTT3′; nanog reverse primer 5′CGGGACCTTGTCTTCCTTTTT 3′; oct4 forward primer: 5′CGACCATCTGCCGCTTTG3′; oct4 reverse primer: 5′GCCGCAGCTTACACATGTTCT3′; htert forward primer: 5′ CGGAGACCACGTTTCAAAAGA3′; htert reverse primer: 5′ TTTGCAACTTGCTCCAGACACT3′; rex-1 forward primer: 5′CCTGCAGGCGGAAATAGAAC3′; rex-1 reverse primer: 5′GCACACATAGCCATCACATAAGG3′; sox2 forward primer: 5′CCATCCACACTCACGCAAAA3′; sox2 reverse primer: 5′ AAGTCCAGGATCTCTCTCATAAAAGTTT3′; β-actin forward primer: 5′ACCGAGCGCGGCTACAG3′; β-actin reverse primer: 5′CTTAATGTCACGCACGATTTCC3′.

Data analysis

Data were analyzed by Student’s t test. P<0.05 was considered statistical significance.

Results

Production of TAT-OCT4 and TAT-NANOG fusion proteins

The expression plasmids of TAT-OCT4 and TAT-NANOG were constructed based on pET28a. The structures and the functional module are shown in Fig. 1A. After induction with IPTG, the strains containing p-TAT-OCT4 and p-TAT-NANOG produced an approximately 50 kD (TAT-OCT4) and an approximately 45 kD (TAT-NANOG) protein (Fig. 1B, lanes 6 and 7). The fusion proteins were purified and then identified by Western blot (Fig. 1C and D).

The TAT-fusion proteins had transcription activity

HAF cells were incubated with the fusion proteins or PBS for 2 h respectively, and then the immunofluorescence staining was performed to determine the intracellular localization of the fusion proteins. Internalization was visualized using fluorescence microscopy (Fig. 2A).

Transcription activities of TAT-OCT4 and TAT-NANOG were measured by luciferase assay. The relative luciferase activities of TAT-OCT4 and TAT-NANOG treated cells were approximately 2.00±0.23 and 1.67±0.19 fold compared with the controls respectively (Fig. 2B).

The TAT-fusion proteins could activate the transcription of endogenous oct4 and nanog

It has been shown that in ES cells, OCT4, SOX2, and NANOG collaborate to form regulatory circuitry consisting of autoregulatory and feedforward loops that contribute to the pluripotency and self-renew maintenance (Boyer et al., 2005). Transcription of endogenous nanog and oct4 in HAF cells treated by TAT-fusion transcription factors (TFs) and PBS were detected by real-time PCR. In the TAT-OCT4 or TAT-NANOG treated HAF cells, the endogenous expression of oct4 and nanog had improved at different levels compared with the control (PBS treated cells) respectively (Fig. 3A and B). However, the endogenous transcription of ESC markers: sox2, rex-1 and htert remained negative in the TAT fusion proteins treated HAF cells (Fig. 3C).

TAT-NANOG promoted HAF cell proliferation and the expression of cdc25a was up-regulated

Forced expression of nanog by the transgenetic methods could increase the growth rate of MSCs (Go et al., 2008) and NIH3T3 (Zhang et al., 2005; Piestun et al., 2006). Our data showed that the HAF cell proliferation rate could also be up-regulated significantly by the fusion protein TAT-NANOG (Fig. 4A and B).

Previous research indicated that nanog could promote the proliferation of human ES cells through direct regulation of transcription of two important cell cycle regulators, cdk6 and cdc25a (Zhang et al., 2009). The real-time PCR reactions were performed to determine the expression of cdk6 and cdc25a in the cells treated with the TAT fusion proteins and the control HAF cells. The data indicated that the expression of cdc25a was significantly activated by TAT-NANOG (Fig. 5A), while the transcription of cdk6 showed no significant difference among TAT-NANOG, TAT-OCT4 and control groups (Fig. 5B).

Discussion

TAT was a powerful transduction domain that could transduce proteins of various sizes into a wide variety of cells in vitro and in vivo (Schwarze et al., 1999). Here this technology (Nagahara et al., 1998) was applied to produce TAT-NANOG and TAT-OCT4 fusion proteins that could be successfully transported into HAF cells and MCF-7 cells, and then activated the transcription of their target genes.

oct4, nanog and sox2 are considered to form transcriptional regulatory circuitry for pluripotency and self-renewal of ES cells (Boyer et al., 2005; Loh et al., 2006; Wang et al., 2006). Consequently, the ectopic expression of oct4, sox2, nanog and lin28 in fibroblasts are sufficient to produce induced pluripotent stem cells (iPSCs) (Yu et al., 2007, 2009). Here we showed that the endogenous transcription of oct4 and nanog in HAF cells could also be activated by the administration of the exogenous recombinant PTD fusion TFs, TAT-OCT4 or TAT-NANOG solely. It also revealed the transcription variation of the endogenous nanog and oct4 during the formation of iPS cells. However, neither TAT-OCT4 nor TAT-NANOG could activate the expression of endogenous sox2. This might be caused by the limited power of the recombinant protein and the different environment of HAF cells. Alternatively this may be an indication that both oct4 and sox2 are indispensable in somatic cell reprogramming. Seemingly, single recombinant TF was not sufficient to activate the reprogramming related genes rex-1 and htert.

According to previous studies, the overexpression of nanog in NH3T3 and human ES cells by the transgenetic methods could enhance cell proliferation and accelerate the S-phase entry (Zhang et al., 2005; Zhang et al., 2009). Here we had proved that the fusion protein TAT-NANOG could also improve the cell growth rate of HAF cells significantly, and this might provide a more controllable and safer way to accelerate the cell proliferation for cell culture in vitro. While in our data TAT-OCT4 could not improve the cell growth efficiently. This suggested that nanog may have more specific impact on cell proliferation. Although the transduction of TAT-OCT4 could activate the transcription of the endogenous transcription of nanog (approximately 10 fold compared with the control), it was much lower than the activation of endogenous nanog by TAT-NANOG (approximately 4000 fold compared with the control). It has been suggested that cdk6 and cdc25a could be the targets of nanog that accelerated S-phase entry in human ES cells (Zhang et al., 2009). We detected the relative transcription change of the two cell cycle regulators. In the HAF cells, the exogenous TAT-NANOG could up-regulate the transcription of cdc25a, while the TAT-OCT4 could not. However, the transcription of cdk6 showed no significant difference between the TAT fusion proteins treated groups and the control. The results indicated that the cdc25a participated in the cell cycle regulation of the HAF activated by nanog.

In conclusion, we have produced the transducible transcription factors TAT-OCT4 and TAT-NANOG, which could activate the endogenous expression of oct4 and nanog. It also reflected the inter-regulation and the auto-regulation of nanog and oct4 during iPS cell induction. Application of the fusion protein TAT-NANOG can accelerate cell proliferation efficiently. This, in addition, might provide a potential method to expand mature cells in vitro.

References

[1]

Boyer L A, Lee T I, Cole M F, Johnstone S E, Levine S S, Zucker J P, Guenther M G, Kumar R M, Murray H L, Jenner R G, Gifford D K, Melton D A, Jaenisch R, Young R A (2005). Core transcriptional regulatory circuitry in human embryonic stem cells. Cell, 122(6): 947–956

[2]

Bradford M M (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, 72: 248–254

[3]

Chambers I, Colby D, Robertson M, Nichols J, Lee S, Tweedie S, Smith A (2003). Functional expression cloning of nanog, a pluripotency sustaining factor in embryonic stem cells. Cell, 113(5): 643–655

[4]

Go M J, Takenaka C, Ohgushi H (2008). Forced expression of Sox2 or nanog in human bone marrow derived mesenchymal stem cells maintains their expansion and differentiation capabilities. Exp Cell Res, 314(5): 1147–1154

[5]

Green M, Loewenstein P M (1988). Autonomous functional domains of chemically synthesized human immunodeficiency virus tat trans-activator protein. Cell, 55(6): 1179–1188

[6]

Hay D C, Sutherland L, Clark J, Burdon T (2004). Oct-4 knockdown induces similar patterns of endoderm and trophoblast differentiation markers in human and mouse embryonic stem cells. Stem Cells, 22(2): 225–235

[7]

Hough S R, Clements I, Welch P J, Wiederholt K A (2006). Differentiation of mouse embryonic stem cells after RNA interference-mediated silencing of OCT4 and nanog. Stem Cells, 24(6): 1467–1475

[8]

Hyslop L, Stojkovic M, Armstrong L, Walter T, Stojkovic P, Przyborski S, Herbert M, Murdoch A, Strachan T, Lako M (2005). Downregulation of NANOG induces differentiation of human embryonic stem cells to extraembryonic lineages. Stem Cells, 23(8): 1035–1043

[9]

Kim D, Kim C H, Moon J I, Chung Y G, Chang M Y, Han B S, Ko S, Yang E, Cha K Y, Lanza R, Kim K S (2009). Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins. Cell Stem Cell, 4(6): 472–476

[10]

Loh Y H, Wu Q, Chew J L, Vega V B, Zhang W, Chen X, Bourque G, George J, Leong B, Liu J, Wong K Y, Sung K W, Lee C W, Zhao X D, Chiu K P, Lipovich L, Kuznetsov V A, Robson P, Stanton L W, Wei C L, Ruan Y, Lim B, Ng H H (2006). The oct4 and nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nat Genet, 38(4): 431–440

[11]

Matin M M, Walsh J R, Gokhale P J, Draper J S, Bahrami A R, Morton I, Moore H D, Andrews P W (2004). Specific knockdown of oct4 and beta2-microglobulin expression by RNA interference in human embryonic stem cells and embryonic carcinoma cells. Stem Cells, 22(5): 659–668

[12]

Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, Takahashi K, Maruyama M, Maeda M, Yamanaka S (2003). The homeoprotein nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell, 113(5): 631–642

[13]

Nagahara H, Vocero-Akbani A M, Snyder E L, Ho A, Latham D G, Lissy N A, Becker-Hapak M, Ezhevsky S A, Dowdy S F (1998). Transduction of full-length TAT fusion proteins into mammalian cells: TAT-p27Kip1 induces cell migration. Nat Med, 4(12): 1449–1452

[14]

Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klewe-Nebenius D, Chambers I, Schöler H, Smith A (1998). Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor oct4. Cell, 95(3): 379–391

[15]

Niwa H (2001). Molecular mechanism to maintain stem cell renewal of ES cells. Cell Struct Funct, 26(3): 137–148

[16]

Niwa H, Miyazaki J, Smith A G (2000). Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet, 24(4): 372–376

[17]

Pesce M, Schöler H R (2001). Oct-4: gatekeeper in the beginnings of mammalian development. Stem Cells, 19(4): 271–278

[18]

Piestun D, Kochupurakkal B S, Jacob-Hirsch J, Zeligson S, Koudritsky M, Domany E, Amariglio N, Rechavi G, Givol D (2006). nanog transforms NIH3T3 cells and targets cell-type restricted genes. Biochem Biophys Res Commun, 343(1): 279–285

[19]

Schwarze S R, Ho A, Vocero-Akbani A, Dowdy S F (1999). In vivo protein transduction: delivery of a biologically active protein into the mouse. Science, 285(5433): 1569–1572

[20]

Silva J, Nichols J, Theunissen T W, Guo G, van Oosten A L, Barrandon O, Wray J, Yamanaka S, Chambers I, Smith A (2009). nanog is the gateway to the pluripotent ground state. Cell, 138(4): 722–737

[21]

Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell, 131(5): 861–872

[22]

Takahashi K, Yamanaka S (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 126(4): 663–676

[23]

Wang J, Rao S, Chu J, Shen X, Levasseur D N, Theunissen T W, Orkin S H (2006). A protein interaction network for pluripotency of embryonic stem cells. Nature, 444(7117): 364–368

[24]

Yu J, Hu K, Smuga-Otto K, Tian S, Stewart R, Slukvin I I, Thomson J A (2009). Human induced pluripotent stem cells free of vector and transgene sequences. Science, 324(5928): 797–801

[25]

Yu J, Vodyanik M A, Smuga-Otto K, Antosiewicz-Bourget J, Frane J L, Tian S, Nie J, Jonsdottir G A, Ruotti V, Stewart R, Slukvin II, Thomson J A (2007). Induced pluripotent stem cell lines derived from human somatic cells. Science, 318, 1917–1920

[26]

Zaehres H, Lensch M W, Daheron L, Stewart S A, Itskovitz-Eldor J, Daley G Q (2005). High-efficiency RNA interference in human embryonic stem cells. Stem Cells, 23(3): 299–305

[27]

Zhang J, Wang X, Chen B, Suo G, Zhao Y, Duan Z, Dai J (2005). Expression of nanog gene promotes NIH3T3 cell proliferation. Biochem Biophys Res Commun, 338(2): 1098–1102

[28]

Zhang X, Neganova I, Przyborski S, Yang C, Cooke M, Atkinson S P, Anyfantis G, Fenyk S, Keith W N, Hoare S F, Hughes O, Strachan T, Stojkovic M, Hinds P W, Armstrong L, Lako M (2009). A role for NANOG in G1 to S transition in human embryonic stem cells through direct binding of CDK6 and cdc25a. J Cell Biol, 184(1): 67–82

[29]

Zhou H, Wu S, Joo J Y, Zhu S, Han D W, Lin T, Trauger S, Bien G, Yao S, Zhu Y, Siuzdak G, Schöler H R, Duan L, Ding S (2009). Generation of induced pluripotent stem cells using recombinant proteins. Cell Stem Cell, 4(5): 381–384

RIGHTS & PERMISSIONS

Higher Education Press and Springer-Verlag Berlin Heidelberg

PDF (290KB)

1715

Accesses

0

Citation

Detail

Sections
Recommended

/