1. Hubei Key Laboratory of Natural Medicinal Chemistry and Resource Evaluation, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, China
2. College of Physics Science and Technology, Yangzhou University, Yangzhou 225009, China
youhuijuan@hust.edu.cn
Show less
History+
Received
Accepted
Published Online
2024-04-10
2024-05-22
2024-08-06
PDF
(3297KB)
Abstract
CX-5461, also known as pidnarulex, is a strong G4 stabilizer and has received FDA fast-track designation for BRCA1- and BRCA2- mutated cancers. However, quantitative measurements of the unfolding rates of CX-5461-G4 complexes which are important for the regulation function of G4s, remain lacking. Here, we employ single-molecule magnetic tweezers to measure the unfolding force distributions of c-MYC G4s in the presence of different concentrations of CX-5461. The unfolding force distributions exhibit three discrete levels of unfolding force peaks, corresponding to three binding modes. In combination with a fluorescent quenching assay and molecular docking to previously reported ligand-c-MYC G4 structure, we assigned the ~69 pN peak corresponding to the 1:1 (ligand:G4) complex where CX-5461 binds at the G4’s 5'-end. The ~84 pN peak is attributed to the 2:1 complex where CX-5461 occupies both the 5' and 3'. Furthermore, using the Bell-Arrhenius model to fit the unfolding force distributions, we determined the zero-force unfolding rates of 1:1, and 2:1 complexes to be (2.4 ± 0.9) × 10−8 s−1 and (1.4 ± 1.0) × 10−9 s−1 respectively. These findings provide valuable insights for the development of G4-targeted ligands to combat c-MYC-driven cancers.
G-quadruplexes (G4s) in oncogene promoters have emerged as promising targets for both regulating gene expression (Balasubramanian et al.2011) and developing cancer therapies (Wang and Vasquez 2023). Chromatin immunoprecipitation sequencing (ChIP-seq) experiments using a G4-specific antibody revealed over 123,000 G4 structures within human chromatin (Hänsel-Hertsch et al.2016). Notably, G4 structures present in >60% of promoters and ~70% of genes, with particular enrichment in cancer-related genes and regions with somatic copy number amplifications, such as c-MYC (Hänsel-Hertsch et al.2016; Lago et al.2021; Zheng et al.2020). c-MYC, a proto-oncogene with transcription factor activity, plays a critical role in cancer progression when its expression is unregulated, especially due to mutation (Chaudhuri et al.2021; Neidle 2017). The c-MYC gene has two promoters, with the P1 promoter, containing a crucial region called nuclease hypersensitive element III (NHE III) (1). This NHE III region controls 80%–95% of the c-MYC gene’s transcriptional activity (Chaudhuri et al.2021). Pioneering work by the Hurley group demonstrated that small molecules stabilizing G4 structures can inhibit c-MYC transcription, highlighting G4s as a promising anti-cancer target (Siddiqui-Jain et al.2002). To date, over 4300 different G4-targeted ligands have been identified according to the G4 targeting ligand database G4LDB 2.2 (http://www.g4ldb.com) (Asamitsu et al.2019; Wang et al.2022). These ligands include diverse chemical classes such as 2,6-diamido anthraquinones (Sun et al.1997), porphyrin derivative TmPyP4 (Siddiqui-Jain et al.2002), perylene derivative PIPER (Rangan et al.2001), acridine derivative BRACO-19 (Moore et al.2006) and quinoline derivative pyridostatin (PDS) (Rodriguez et al.2008).
CX-5461 (pidnarulex), a naphthyridine derivative, was initially developed as an RNA polymerase I transcription inhibitor for the treatment of hematological malignancies (Khot et al.2019). Recent studies have revealed that the mechanism underpinning the therapeutic efficacy of CX-5461 includes stabilizing G-quadruplex formation and inhibiting topoisomerase II, causing DNA damage (Bossaert et al.2021; Bruno et al.2020; Koh et al.2024; Pan et al.2021). The phase I clinical trial of CX-5461 (NCT02719977) in homologous recombination-deficient solid tumor established clinical proof-of-concept for G4s stabilizer (Hilton et al.2022). However, the kinetic basis of G4s stabilization by CX-5461 remains not fully understood.
Single-molecule force spectroscopy (SMFS) is a powerful tool for investigating the folding and unfolding kinetics of c-MYC promoter G4s under physiologically relevant conditions (Cheng et al.2020; You et al.2015). This technique allows us to quantify how proteins (Cheng et al.2021; You et al.2017) and small ligands (Zhang et al.2024) influence the folding/unfolding rates of c-MYC G4s. We recently employed SMFS with magnetic tweezers and demonstrated that CX-5461 is a strong G4s stabilizer, which significantly increases the average unfolding forces of c-MYC G4s at physiologically relevant potassium concentrations (Zhang et al.2024). While average unfolding forces provide valuable information about the G4s stabilization, they don’t quantify the unfolding rates of CX-5461-G4 complexes. This highlights the untapped potential of SMFS for a deeper understanding of ligand−G4 interactions.
Importantly, ligands can bind to G4s in various stoichiometries (binding ratios). Previous studies have utilized mass spectrometry (MS) to quantify the stoichiometry of several important ligands with telomeric G4s, revealing 1:1 or 2:1 (ligands:G4s) complexes (Marchand et al.2018). Similarly, MS analysis identified imidazole derivatives forming 1:1, 2:1, and 3:1 complexes with c-MYC G4s (Li et al.2022). NMR structural studies further revealed that the carbazole compound BMVC initially binds the 5'-end of c-MYC G4s in a 1:1 complex, and at higher ratios, also binds the 3'-end to form a 2:1 complex (Liu et al.2019). NMR and crystal structures reveal that ligand binding to G4s relies on π–π stacking interactions between the ligands’ hetero-aromatic moieties and the planar G-quartets at the 5'- or 3'-ends of G4s (Dickerhoff et al.2021a; Liu et al.2019). However, the impact of different binding stoichiometries (1:1 or 2:1) on the G4’s unfolding rates and unfolding energy barriers remains unclear.
Here, using our recently developed single-molecule manipulation methods (Zhang et al.2024), we conducted further measurements of the unfolding-force distributions of c-MYC G4s in the presence of different concentrations of CX-5461 (Fig.1). By combining these data with the binding affinities of CX-5461 to both 5'- and 3'-end of c-MYC G4s, determined through a fluorescent quenching assay, we were able to assign the observed unfolding force peaks to distinct CX-5461-G4 complexes (1:1 and 2:1 stoichiometry). This approach allowed us to estimate the estimated zero-force unfolding rates of 1:1 and 2:1 CX-5461-MYC G4 complexes.
2 RESULTS
2.1 CX-5461 binding affinity to 5'- and 3'-end of c-MYC G4 measured by fluorescence quenching assay
To elucidate the binding affinity of CX-5461 to c-MYC G4s, we employed a fluorescence quenching assay. The single-stranded DNA (ssDNA) c-MYC G4s forming sequence was labeled with a carboxyfluorescein (FAM) fluorophore at either the 5'-end or 3'-end and titrated with different concentrations of CX-5461. CX-5461 does not directly quench the fluorescein dye at a concentration of 1 μmol/L (Zhang et al.2024), but upon binds to c-MYC G4s, CX-5461 induced quenching of FAM fluorescence in both 5' and 3' FAM-labeled c-MYC G4s, indicating its ability to bind at both ends. Thus, the dissociation constant Kd of CX-5461 to the binding site on each end of c-MYC G4s can be determined by analyzing the changes in fluorescence intensity. The data was fitted with a quadratic equation, and we obtained the Kd value for the 5'-FAM G4s (0.05 ± 0.01 μmol/L, average ± standard error) was significantly lower compared to the 3'-FAM G4s (0.35 ± 0.03 μmol/L, average ± standard error) (Fig.1). This finding indicated that CX-5461 binds more strongly to the 5'-end than 3'-end of c-MYC G4s. The higher binding affinity of G4s ligands to 5'-end than 3'-end of c-MYC G4s was also observed for several other G4s targeting ligands (Li et al.2022). The binding energy of G4s can be calculated according to the equilibrium constant , where is the Boltzmann constant and T is the absolute temperature. CX-5461 binding the 5'-end and 3'-end complexes were estimated as = –16.8kBT, corresponding to –9.95 kcal/mol, and = –14.9kBT, which corresponds to –8.82 kcal/mol.
To elucidate the binding modes of CX-5461 with c-MYC G4s, we performed a molecular docking simulation using the previously reported solution structure of the 2:1 ligand-G4s complexes (Liu et al.2019). Fig.1 depicts the lowest energy binding conformation of CX-5461, where it stacks on the 5'-end of the c-MYC G4s with the docking score of –10 kcal/mol. This docked conformation reveals that the rigid benzothiazole rings of CX-5461 engage in π–π stacking interactions with two guanine bases, while the two flexible side chains interact with the 5' terminal residues and the phosphate backbone through electrostatic and hydrogen-bonding interactions. Fig.1 shows the lowest docking conformation of CX-5461 bound to the 3'-end of c-MYC G4s with a docking score of –9.3 kcal/mol. The docking results revealed a strong preference for 5’-end binding conformations. Among 100 docked conformations, 92 conformations showed binding at the 5'-end with the lowest docking score of –10 kcal/mol. Conversely, only seven conformations bound to the 3'-end of G4s. We further performed molecular dynamics simulation using both 5'-end and 3'-end docked conformations as initial structures. The root-mean-square deviation (RMSD) remained within 5 Å, suggesting the validity of the initial docking poses (Fig.1 and 1D). It is important to note that while docking scores provide relative binding affinities, they don’t directly refer to the ligand binding energy. A systematic evaluation using different docking programs to analyze different G4s–ligand interactions showed that docking accuracy is limited by the scoring function (Dickerhoff et al.2021b). Despite limitations, four ligands (quindoline I, BMVC, PEQ, and DC4) bind to parallel-stranded c-MYC G4s in a conserved way, suggesting that other molecules may bind similarly (Dickerhoff et al.2021b). Taken together, the docking results, along with the fluorescent quenching measurements, suggest that the CX-5461 preferentially binds to the 5'-end but also can bind to the 3'-end of the c-MYC G4s structures.
2.2 CX-5461 is a G4s stabilizer characterized by single-molecule magnetic tweezers
The impacts of CX-5461 on the unfolding forces of c-MYC G4s were characterized using single-molecule magnetic tweezers to unfold a short dsDNA hairpin that contains a c-MYC promoter G4 forming sequences and complementary strand (Fig.2) (Zhang et al.2024). The Myc-hairpin DNA was ligated with two double-stranded DNA handles (489 bp and 609 bp) and was tethered between a streptavidin-coated paramagnetic bead and a coverslip. Force was applied to the tethered DNA by a pair of magnets and the bead height was monitored based on the diffraction pattern of the image of the beads. Fig.2 and 2C show the overlap of two typical force-bead height curves obtained by the force-ramp experiments using a constant loading rate of 2 pN/s from 5 pN to 90 pN. The sudden extension jumps appearing in force-ramp cycles indicate the unfolding transition of the hairpin (grey) or G4 structures (red), which can be distinguished from the unfolding step sizes as the hairpin and G4 structures are composed of 56 nt and 16 nt, respectively. Subsequently, the force jumps to 5 pN for 60 s to allow the refolding of hairpin or G4 structures. The unfolded ssDNA was held at 5 pN for refolding because force can increase the formation probability of G4s instead of the hairpin.
The Myc-20T hairpin construct was used because the CX-5461 intercalative binding into dsDNA handles can cause significant fluctuations in dsDNA extension (Liu et al.2023). The intercalative binding of CX-5461 to dsDNA handle disrupts the typical overstretching transition of dsDNA usually observed at ~65 pN (Backer et al.2019). The large unfolding step sizes of the hairpin (Fig.2 and 2C, grey) can be used as a reference curve for detecting the G4s unfolding signal. Fig.2 shows the unfolding step size distribution of 232 stretching cycles from six independent Myc-hairpin molecules measured in 0.1 µmol/L CX-5461. A total of 109 unfolding events exhibited an unfolding step size of 16 ± 1 nt (average ± SD), while other 123 unfolding events displayed an unfolding step size of 56 ± 4 nt (average ± SD). These step sizes are consistent with the G4s and hairpin structures, respectively. In the presence of 1 µmol/L CX-5461 (right panel), the distribution of unfolding step sizes again revealed two peaks of 17 ± 1 nt (n = 107) and 57 ± 3 nt (n = 74), which are consistent with G4s and hairpin structures, respectively.
2.3 Unfolding force distributions of G4 in the presence of CX-5461 represent different mechanical stability of 1:1 and 2:1 complexes
The unfolding force distribution could be obtained by repeating the force-ramp stretching cycles and recording the forces at which unfolding events occurred. We next analyze the unfolding rates of CX-5461-G4 complexes by analyzing the unfolding force distributions using a Bell-Arrhenius model (Bell 1978), which described the force-dependent unfolding rate as:
where is the zero-force unfolding rate, and is the distance between the folded state and the transition state. The zero-force unfolding rate is determined by , where A is a prefactor. is the activation energy for G4s unfolding. The Bell-Arrhenius model predicts an unfolding force distribution with a single force peak as:
where is the loading rate (Evans and Ritchie 1997). We previously reported the single-peak unfolding force distribution of c-MYC G4s (Myc2345) at 55 pN and the best fitting to Eq. 2 determined s−1 and nm (You et al.2015).
In the absence of CX-5461, the single-molecule force spectroscopy of c-MYC G4s measured using Myc-hairpin exhibited a single unfolding force peak at 56 ± 4 pN, consistent with previous reports using single-stranded c-MYC G4s sequence (You et al.2015). The unfolding force increased upon CX-5461 binding (≥ 0.1 µmol/L). At 0.1 µmol/L CX-5461, two unfolding force peaks were observed. The lower peak (56 ± 5 pN) accounting for 67% of the population, likely represents the ligand-free G4s. The higher peak (73 ± 3 pN), representing the remaining 33%, likely corresponds to the 5'-bound CX-5461-G4 complex, supported by the Kd obtained from the fluorescent quenching assay. By fitting the measured unfolding force distributions to a two-unfolding force species , we determined the fraction of each population and their zero-force unfolding rates (Tab.1). The global fitting employed three free parameters , , and . A fixed was used for both species based on our previously measured for c-MYC G4s (You et al.2015) and multiple single-molecule studies also suggest that G4s typically exhibit a short unfolding transition distance (<2 nm) (Cheng et al.2020). The for unbound and 5'-end bound states were estimated to be (2.3 ± 0.1) × 10−7 s−1 and (1.6 ± 0.2) × 10−8 s−1 respectively.
As the CX-5461 concentration increased to 1 and 2 µmol/L (Fig.3), the unfolding force peaks shifted and the ~55 pN unliganded population disappeared. At 1 µmol/L, the lower peak (69 ± 5 pN) represented 74% of the population, while the higher peak (84 ± 3 pN) represented 26%. At 2 µmol/L, the lower peak (67 ± 5 pN) represented 44% of the population, while a higher peak (79 ± 6 pN) represented 56%. The corresponding zero-force unfolding rates determined by fitting the distributions were summarized in Tab.1. Combining the results from the fluorescent quenching assay, molecular docking, and previously reported ligand-c-MYC G4 structures, we assigned the ~70 pN peak to the 1:1 complex where CX-5461 binds at the G4’s 5'-end. The ~80 pN peak likely corresponds to the 2:1 complex, where CX-5461 occupies both the 5’- and 3’-end. The average zero-force unfolding rates of 1:1 and 2:1 complexes were estimated to be (2.4 ± 0.9) × 10−8 s−1 and (1.4 ± 1.0) × 10−9 s−1, respectively.
3 DISCUSSION
3.1 Kd and binding energies of CX-5461 to 5'- and 3'-end of c-MYC G4s determined using unfolding force distributions
The binding free energy of CX-5461 to 5' and 3' can be also estimated based on the unfolding force distributions measured at different ligands concentrations. According to Boltzmann distribution, the probability of finding the molecule in a state i that has energy Ui is
where Z is the partition function. Use the ligand free G4s as a control U1 = 0 (no ligand), the energy of G4s bound with ligand can be determined by (1:1, 5'-end bound state), (2:1, 5'-end and 3'-end bound state), (1:1, 3'-end bound state), where is the dissociation constant of 5’-end bound state, is the dissociation constant of 3'-end bound state. The probability of different ligand-bound states can be described as follows:
Rearrange the equation, we obtained , , where the ratio of two probability can be determined by the fraction of unfolding force peak. Because >> , at low concentrations of CX-5461, the two main peaks likely represent no liganded G4s (P1) and 5'-end bound state (P2). Based on the observed fractions of 67% and 32% at 0.1 µmol/L CX-5461, we determined = 0.2 µmol/L for 5'-end binding, corresponding a binding free energy of −15.4kBT. At high concentration (e.g., 1 µmol/L CX-5461), the major two peaks likely represent the 5'-end bound state (P2) and 2:1 CX-5461-G4 complex (P3), with fraction of 74% and 26%, respectively. This suggests = 2.8 µmol/L for 3'-end binding, corresponding to a binding free energy of –12.8kBT. The Kd measured using single-molecule force spectroscopy were higher than that obtained from the fluorescent quenching assay (Fig.1). This discrepancy arises because force spectroscopy detects only interactions that significantly stabilize the G4 structures. In contrast, the fluorescence quenching assay might capture both specific binding events that stabilize the G4s and non-specific interactions between the ligand and G4s that do not affect G4s stability.
3.2 The effects of CX-5461 on the activation energy of c-MYC G4s unfolding estimated from
By fitting the unfolding force distribution with the Bell-Arrhenius model, we obtain the zero-force unfolding rates of 0:1, 1:1, and 2:1 complex (Tab.1). These rates fall in the range of 10–7 s–1, 10–8 s–1, and 10–9 s–1 respectively. Analyzing the zero-force unfolding rates of different species allowed us to estimate the changes in activation energy for unfolding using the equation . While ligand binding can alter the unfolding pathway, leading to a higher activation energy for unfolding, multiple previous force spectroscopy studies of various G4 structures suggest a short unfolding transition distance (< 2 nm) (Cheng et al.2021). This implies that the transition state shares a similar structure with the folded G4s. Based on this, it is reasonable to assume that CX-5461 binding likely doesn’t significantly change the unfolding pathway, and the pre-factor A remains relatively constant. Therefore, the observed decrease in primarily reflects the changes in activation energy for unfolding. Using , we calculated the activation energies change = 4.7 and = 7.5 for the 1:1 and 2:1 complex, respectively. The increased activation energy upon CX-5461 binding to G4s suggests that the CX-5461 has a stronger binding affinity to the folded G4s structure compared to the transition state. The binding of CX-5461 at both the 5'- and 3'-end of G4s further increased the unfolding energy barrier than only bound to the 5'-end of G4s.
It is important to note that reconstructing the free energy landscape of G4s in the presence of ligands requires careful consideration as the effects of ligands on the c-MYC G4s folding/unfolding pathway can be complicated. Previous studies have reported the existence of folding intermediates for c-MYC G4s (Gray et al.2019). Small ligands, such as PDS, can result in even lower unfolding force peaks observed in single-molecule force spectroscopy experiments (Zhang et al.2024). Determining the stoichiometries, binding modes, and structural diversity of G4s remains important for resolving the effects of ligands on G4s folding/unfolding dynamics.
4 CONCLUSION
This work employed single-molecule magnetic tweezers to quantify the unfolding force distributions of c-MYC G4s in the presence of different concentrations of CX-5461. This analysis allowed us to quantify the zero-force unfolding rates of distinct bound states within the CX-5461-G4 complexes. By combing with a fluorescence quenching assay and molecular docking simulations of previously reported ligand-G4 complexes, we assigned the unfolding force peaks to 1:1 and 2:1 complex, where CX-5461 interacts with 5'-end or both the 5'- and 3'-end of c-MYC G4. Furthermore, by fitting the unfolding force distributions with the Bell-Arrhenius model, we obtain the zero-force unfolding rates of 1:1, and 2:1 CX-5461-G4 complexes be (2.4 ± 0.9) × 10−8 s−1 and (1.4 ± 1.0) × 10−9 s−1, respectively. The unfolding force distribution can be used to calculate the binding free energies of CX-5461-G4 complexes and reconstruct the unfolding energy landscape. The methods presented in this study are applicable to a broad spectrum of ligand-G4 interactions, offering valuable insights into the design of G4-targeting ligands for cancer treatments.
5 MATERIALS AND METHODS
5.1 Materials and reagents
CX-5461 was purchased from TargetMol (USA) and stored at –80 °C in DMSO before use. Myc-hairpin DNA: 5’TAGGGTGGGGAGGGTGGGTT(T)20AACCCACCCTCCCCACCCTA was purchased from Sangon Biotech Co., Ltd (China). The Myc-hairpin containing c-MYC G4s forming sequences and the complementary strand were annealed with two flank sequences and then ligated with a BstX1 (Thermo Fisher Scientific, USA) digested dsDNA handles as previously described (Zhang et al.2024). The 5′-thiol labeled 489 bp and 5′-biotin labeled 609 bp dsDNA handles were generated via PCR amplification using 5’-thiol and 5’-biotin primers (Genewiz, China) and DreamTaq DNA polymerase (Thermo Fisher Scientific, USA) using lambda phage DNA (Thermo Fisher Scientific, USA) as the template.
5.2 Single-molecule magnetic tweezers
Magnetic tweezers experiments were performed with BioPSI magnetic tweezers (BioPSI, Singapore). DNA constructs were covalently tethered to a (3-Aminopropyl) Triethoxysilane (Cool Chemical Technology, China) functionalized coverslip via a Sulfo-SMCC (Hunan Hua Teng Pharmaceutical, China) cross-linker. To block nonspecific interactions, bovine serum albumin (BSA) buffer (10 mg/mL BSA, 1 mmol/L 2-mercaptoethanol, 1× PBS, pH 7.4) was introduced into the flow chamber for overnight incubation. Streptavidin-coated paramagnetic beads (Dynal M280, 2.8 μm diameter, Thermo Fisher Scientific, USA) were introduced to attach the 5' biotin-labeled end of DNA. All single-molecule experiments were conducted at room temperature (20–23 °C) in a working buffer (10 mmol/L Tris-HCl, 100 mmol/L KCl, pH 8.0).
5.3 Fluorescence quenching assay and Kd determination
Oligonucleotides labeled with 5'-FAM (excitation 490 nm, emission 520 nm) or 3'-FAM were purchased from Genewiz. 10 nmol/L oligonucleotides and varying ligand concentrations were diluted in assay buffer (10 mmol/L Tris-HCl, pH 8.0, 10 mmol/L KCl, 90 mmol/L LiCl) at a final volume of 20 μL. The fluorescent intensity was measured at 25 °C for 100 s using a Qiagen 36-well RT-PCR instrument (Qiagen Rotor-Gene Q, Germany). The dissociation constant Kd was determined using a quartic equation instead of the Hill equation to minimize the effects of the depletion of the free ligand due to binding to G4s (Thordarson 2011).
in which and are the concentrations of free ligand and substrate (DNA), respectively, and is the concentration of the ligand−DNA complex. The concentrations of total ligands and total substrate (DNA) are denoted by and , respectively. According to the mass balance,
Based on Eqs. 5 and 6, Eq. 7 containing only the total concentration of ligand and DNA can be derived:
Equation 7 has only one relevant real solution (Eq. 8):
The bound fraction of the substrate molecules ,
Equation 9 was used for fitting the bound fraction based on the fluorescence intensity change, at varying ligand concentrations to determine the Kd. represents the maximum fluorescent intensity change and represent the fluorescent intensity change at a total ligand concentration of . We note that Eqs. 5–9 were derived assuming a 1:1 ligand-G4 binding stoichiometry. Because Kd at 5’- and 3’-end significantly different, thus allowed us to use this model to determine Kd at 5’-end. For Kd at the 3’-end, where Kd is much higher than the concentration of FAM-labeled oligo (20 nmol/L), thus minimized the effects caused by depletion of free ligand due to binding to G4s.
5.4 Molecular docking and molecular dynamics simulation
The NMR structure of the c-MYC G4 in complex with a carbazole derivative BMVC was used for semiflexible global docking (2:1 complex, PDB: 6O2I) (Liu et al.2019). Semiflexible global docking with a Lamarckian Genetic Algorithm was carried out using Autodock 4.2.6 and AutoTools 1.5.7 (graphical user interface). The lowest binding energy conformations for the 5’-end complex and 3’-end complex were further validated using molecular dynamic simulation using the Gromacs-2019.6 simulation package and Amber parmbsc1 force field (Ivani et al.2016). A solute box distance of 2.5 nm was defined, setting the minimum distance of 5.0 nm between any two periodic images of a G4s-ligand complex. The TIP3P water molecules soaked the G4-ligand complex model, and system neutralization was carried out using 0.15 mol/L potassium chloride. The ion parameters were from the default ones for the Amber force field. Equilibration of the systems was performed for 125 ps under an NVT ensemble. A 100 ns MD runs were completed and the RMSD values of all atoms of the G4s-ligand complexes from the average structure were analyzed.
Acknowledgements
This work was financially supported in part by grants from the National Natural Science Foundation of China (32171225). We thank Prof. Jie Yan for the suggestions on the free energy analysis. We thank Dr. Yuanlei Cheng for the proof reading.
Compliance with Ethical StandardsConflict of interest
Hui Peng, Yashuo Zhang, Qun Luo, Xinyu Wang and Huijuan You declare that they have no conflict of interest.
Human and animal rights and informed consent
This article does not contain any studies with human or animal subjects performed by any of the authors.
Asamitsu S, Bando T, Sugiyama H. Ligand design to acquire specificity to intended G-quadruplex structures. Chem-Eur J, 2019, 25(2): 417–430
[2]
Backer AS, Biebricher AS, King GA, Wuite GJL, Heller I, Peterman EJG. Single-molecule polarization microscopy of DNA intercalators sheds light on the structure of S-DNA. Sci Adv, 2019, 5(3): eaav1083
[3]
Balasubramanian S, Hurley LH, Neidle S (2011) Targeting G-quadruplexes in gene promoters: a novel anticancer strategy? Nat Rev Drug Discov 10(4): 261−275
[4]
Bell GI. Models for the specific adhesion of cells to cells. Science, 1978, 200(4342): 618–627
[5]
Bossaert M, Pipier A, Riou JF, Noirot C, Nguyên LT, Serre RF, Bouchez O, Defrancq E, Calsou P, Britton S, Gomez D. Transcription-associated topoisomerase 2α a (TOP2A) activity is a major effector of cytotoxicity induced by G-quadruplex ligands. Elife, 2021, 10: e65184
[6]
Bruno PM, Lu MR, Dennis KA, Inam H, Moore CJ, Sheehe J, Elledge SJ, Hemann MT, Pritchard JR. The primary mechanism of cytotoxicity of the chemotherapeutic agent CX-5461 is topoisomerase II poisoning. Proc Natl Acad Sci USA, 2020, 117(8): 4053–4060
[7]
Chaudhuri R, Bhattacharya S, Dash J, Bhattacharya S. Recent update on targeting G-quadruplexes by small molecules for anticancer therapeutics. J Med Chem, 2021, 64(1): 42–70
[8]
Cheng Y, Zhang Y, Gong Z, Zhang X, Li Y, Shi X, Pei Y, You H. High mechanical stability and slow unfolding rates are prevalent in parallel-stranded DNA G-quadruplexes. J Phys Chem Lett, 2020, 11(19): 7966–7971
[9]
Cheng Y, Zhang Y, You H. Characterization of G-quadruplexes folding/unfolding dynamics and interactions with proteins from single-molecule force spectroscopy. Biomolecules, 2021, 11(11): 1579
[10]
Dickerhoff J, Dai J, Yang D. Structural recognition of the MYC promoter G-quadruplex by a quinoline derivative: insights into molecular targeting of parallel G-quadruplexes. Nucleic Acids Res, 2021a, 49(10): 5905–5915
[11]
Dickerhoff J, Warnecke KR, Wang KB, Deng NJ, Yang DZ. Evaluating molecular docking software for small molecule binding to G-quadruplex DNA. Int J Mol Sci, 2021b, 22(19): 10801
[12]
Evans E, Ritchie K. Dynamic strength of molecular adhesion bonds. Biophys J, 1997, 72(4): 1541–1555
[13]
Gray RD, Trent JO, Arumugam S, Chaires JB. Folding landscape of a parallel G-quadruplex. J Phys Chem Lett, 2019, 10(5): 1146–1151
[14]
Hänsel-Hertsch R, Beraldi D, Lensing SV, Marsico G, Zyner K, Parry A, Di Antonio M, Pike J, Kimura H, Narita M, Tannahill D, Balasubramanian S. G-quadruplex structures mark human regulatory chromatin. Nat Genet, 2016, 48(10): 1267–1272
[15]
Hilton J, Gelmon K, Bedard PL, Tu D, Xu H, Tinker AV, Goodwin R, Laurie SA, Jonker D, Hansen AR, Veitch ZW, Renouf DJ, Hagerman L, Lui H, Chen B, Kellar D, Li I, Lee SE, Kono T, Cheng BYC, Yap D, Lai D, Beatty S, Soong J, Pritchard KI, Soria-Bretones I, Chen E, Feilotter H, Rushton M, Seymour L, Aparicio S, Cescon DW (2022) Results of the phase I CCTG IND. 231 trial of CX-5461 in patients with advanced solid tumors enriched for DNA-repair deficiencies. Nat Commun 13(1): 3607.
[16]
Ivani I, Dans PD, Noy A, Perez A, Faustino I, Hospital A, Walther J, Andrio P, Goni R, Balaceanu A, Portella G, Battistini F, Gelpi JL, Gonzalez C, Vendruscolo M, Laughton CA, Harris SA, Case DA, Orozco M. Parmbsc1: a refined force field for DNA simulations. Nat Methods, 2016, 13(1): 55–58
[17]
Khot A, Brajanovski N, Cameron DP, Hein N, Maclachlan KH, Sanij E, Lim J, Soong J, Link E, Blombery P, Thompson ER, Fellowes A, Sheppard KE, McArthur GA, Pearson RB, Hannan RD, Poortinga G, Harrison SJ. First-in-human RNA polymerase I transcription inhibitor CX-5461 in patients with advanced hematologic cancers: results of a phase I dose-escalation study. Cancer Discov, 2019, 9(8): 1036–1049
[18]
Koh GCC, Boushaki S, Zhao SJ, Pregnall AM, Sadiyah F, Badja C, Memari Y, Georgakopoulos-Soares I, Nik-Zainal S. The chemotherapeutic drug CX-5461 is a potent mutagen in cultured human cells. Nat Genet, 2024, 56(1): 23–26
[19]
Lago S, Nadai M, Cernilogar FM, Kazerani M, Moreno HD, Schotta G, Richter SN. Promoter G-quadruplexes and transcription factors cooperate to shape the cell type-specific transcriptome. Nat Commun, 2021, 12(1): 3885
[20]
Li ML, Yuan JM, Yuan H, Wu BH, Huang SL, Li QJ, Ou TM, Wang HG, Tan JH, Li D, Chen SB, Huang ZS. Design, synthesis, and evaluation of new sugar-substituted imidazole derivatives as selectivetranscription repressors targeting the promoter G-quadruplex. J Med Chem, 2022, 65(19): 12675–12700
[21]
Liu TY, Wu YY, Qin LY, Luo Q, Li WZ, Cheng YL, Tu YS, You HJ. Nonselective intercalation of G-quadruplex-targeting ligands into double-stranded DNA quantified by single-molecule stretching. J Phys Chem B, 2023, 127(26): 5859–5868
[22]
Liu W, Lin C, Wu G, Dai J, Chang TC, Yang D. Structures of 1:1 and 2:1 complexes of BMVC and MYC promoter G-quadruplex reveal a mechanism of ligand conformation adjustment for G4-recognition. Nucleic Acids Res, 2019, 47(22): 11931–11942
[23]
Marchand A, Rosu F, Zenobi R, Gabelica V. Thermal denaturation of DNA G-quadruplexes and their complexes with ligands: thermodynamic analysis of the multiple states revealed by mass spectrometry. J Am Chem Soc, 2018, 140(39): 12553–12565
[24]
Moore MJB, Schultes CM, Cuesta J, Cuenca F, Gunaratnam M, Tanious FA, Wilson WD, Neidle S (2006) Trisubstituted acridines as G-quadruplex telomere targeting agents. Effects of extensions of the 3, 6-and 9-side chains on quadruplex binding, telomerase activity, and cell proliferation. J Med Chem 49(2): 582−599
[25]
Neidle S. Quadruplex nucleic acids as targets for anticancer therapeutics. Nat Rev Chem, 2017, 1(5): 0041
[26]
Pan M, Wright WC, Chapple RH, Zubair A, Sandhu M, Batchelder JE, Huddle BC, Low J, Blankenship KB, Wang YZ, Gordon B, Archer P, Brady SW, Natarajan S, Posgai MJ, Schuetz J, Miller D, Kalathur R, Chen SQ, Connelly JP, Babu MM, Dyer MA, Pruett-Miller SM, Freeman BB, Chen TS, Godley LA, Blanchard SC, Stewart E, Easton J, Geeleher P. The chemotherapeutic CX-5461 primarily targets TOP2B and exhibits selective activity in high-risk neuroblastoma. Nat Commun, 2021, 12(1): 6468
[27]
Rangan A, Fedoroff OY, Hurley LH. Induction of duplex to G-quadruplex transition in the c-myc promoter region by a small molecule. J Biol Chem, 2001, 276(7): 4640–4646
[28]
Rodriguez R, Müller S, Yeoman JA, Trentesaux C, Riou JF, Balasubramanian S. A novel small molecule that alters shelterin integrity and triggers a DNA-damage response at telomeres. J Am Chem Soc, 2008, 130(47): 15758–15759
[29]
Siddiqui-Jain A, Grand CL, Bearss DJ, Hurley LH. Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc Natl Acad Sci USA, 2002, 99(18): 11593–11598
[30]
Sun DY, Thompson B, Cathers BE, Salazar M, Kerwin SM, Trent JO, Jenkins TC, Neidle S, Hurley LH. Inhibition of human telomerase by a G-quadruplex-interactive compound. J Med Chem, 1997, 40(14): 2113–2116
[31]
Thordarson P. Determining association constants from titration experiments in supramolecular chemistry. Chem Soc Rev, 2011, 40(3): 1305–1323
[32]
Wang G, Vasquez KM. Dynamic alternative DNA structures in biology and disease. Nat Rev Genet, 2023, 24(4): 211–234
[33]
Wang YH, Yang QF, Lin X, Chen D, Wang ZY, Chen B, Han HY, Chen HD, Cai KC, Li Q, Yang S, Tang YL, Li F (2022) G4LDB 2.2: a database for discovering and studying G-quadruplex and i-Motif ligands. Nucleic Acids Res 50(D1): D150-D160
[34]
You H, Lattmann S, Rhodes D, Yan J. RHAU helicase stabilizes G4 in its nucleotide-free state and destabilizes G4 upon ATP hydrolysis. Nucleic Acids Res, 2017, 45(1): 206–214
[35]
You H, Wu J, Shao F, Yan J. Stability and kinetics of c-MYC promoter G-quadruplexes studied by single-molecule manipulation. J Am Chem Soc, 2015, 137(7): 2424–2427
[36]
Zhang Y, Cheng Y, Luo Q, Wu T, Huo J, Yin M, Peng H, Xiao Y, Tong Q, You H. Distinguishing G-quadruplexes stabilizer and chaperone for c-MYC promoter G-quadruplexes through single-molecule manipulation. J Am Chem Soc, 2024, 146(6): 3689–3699
[37]
Zheng KW, Zhang JY, He YD, Gong JY, Wen CJ, Chen JN, Hao YH, Zhao Y, Tan Z. Detection of genomic G-quadruplexes in living cells using a small artificial protein. Nucleic Acids Res, 2020, 48(20): 11706–11720
RIGHTS & PERMISSIONS
The Author(s) 2024. Published by Higher Education Press. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0)